A yellow tricholoma terreum variety not easy to brown and a mnp molecular identification method and application thereof

Abstract

The application discloses a yellow Flammulina velutipes variety not prone to browning and a MNP molecular identification method and application thereof, and aims at the problems of the existing yellow Flammulina velutipes variety in production, such as the easy occurrence of brown spots on a pileus, the deep brown of a stipe base, the easy browning after harvesting, and the low yield, and provides a yellow Flammulina velutipes variety 'Shangyanjin 7' not prone to browning, high in valine and glutamic acid contents, and high in yield, and a MNP molecular fingerprint spectrum of the yellow Flammulina velutipes variety 'Shangyanjin 7'.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of Flammulina velutipes breeding and strain molecular identification, and particularly relates to a yellow Flammulina velutipes variety not prone to browning and a MNP molecular identification method and application thereof. BACKGROUND

[0002] Flammulina velutipes is not only rich in nutrients, crisp and tender in texture, and delicious in taste, but also has medicinal values such as promoting intelligence development and anti-tumor. However, Flammulina velutipes products are seriously homogeneous, and the benefits are decreasing year by year, which limits the development of the industry; in addition, although yellow Flammulina velutipes has been widely welcomed by consumers, the average price is also much higher than that of white varieties, but there are main bottleneck problems such as easy browning of fruiting bodies that affect the quality of commodities. Browning will directly affect the appearance, fresh food and storage of edible fungi, thereby reducing the commodity value, and even causing the circulation of products to be blocked. At present, the browning of yellow Flammulina velutipes fruiting bodies has become a major obstacle to the development of the industry.

[0003] During the growth and development of yellow Flammulina velutipes, there are strains prone to browning, and the fruiting bodies of yellow Flammulina velutipes are prone to enzymatic browning during harvesting and storage. After browning occurs, on the one hand, Flammulina velutipes belongs to a low-temperature variety, and low temperature will aggravate the degree of browning, resulting in a decrease in the commodity properties of yellow Flammulina velutipes and economic losses; on the other hand, after browning, chemical reactions occur, which change the original ecological balance of the fruiting bodies of Flammulina velutipes, and ultimately affect the normal physiological functions of the fruiting bodies. Therefore, it is urgent to breed a yellow Flammulina velutipes variety that is not prone to browning, has good commodity properties and high quality, and to provide a theoretical basis for Flammulina velutipes browning-resistant variety breeding and production process improvement. SUMMARY

[0004] The present application aims at the current production and breeding status of yellow Flammulina velutipes, and provides a yellow Flammulina velutipes variety 'Shangjianjin 7' not prone to browning and the construction of MNP molecular fingerprint thereof.

[0005] The present application aims at the current production and breeding status of yellow Flammulina velutipes, and provides a yellow Flammulina velutipes variety 'Shangjianjin 7' not prone to browning and the construction of MNP molecular fingerprint thereof.

[0006] The present application aims at the current production and breeding status of yellow Flammulina velutipes, and provides a yellow Flammulina velutipes variety 'Shangjianjin 7' not prone to browning and the construction of MNP molecular fingerprint thereof.

[0007] The present application aims at the market demand for yellow Flammulina velutipes fruiting body which is prone to browning after production and harvesting and has a short shelf life, and provides a yellow Flammulina velutipes variety 'Shangjianjin 7' with fruiting bodies which are not prone to browning and are storage-resistant, and the construction of the MNP molecular fingerprint of the variety.

[0008] The present application aims at the market demand for yellow Flammulina velutipes fruiting body which is prone to browning after production and harvesting and has a short shelf life, and provides a yellow Flammulina velutipes variety 'Shangjianjin 7' with fruiting bodies which are not prone to browning and are storage-resistant, and the construction of the MNP molecular fingerprint of the variety.

[0009] The yellow Flammulina velutipes variety 'Shangjianjin 7' of the present application was deposited with the Guangdong Microbial Culture Collection Center on March 15, 2024, at the address of 59 Building, 5th Floor, Guangdong Academy of Microbiology, 100 Xianlie Middle Road, Guangzhou, and the deposit number is GDMCC No: 64423.

[0010] The above-mentioned Flammulina velutipes variety 'Shangjianjin 7' is obtained by protoplast monokaryon hybridization of the parent Flammulina velutipes 'Shangjian No. 1' (deposit number GDMCC No: 61490) and the parent 'FV1923' (a wild domesticated and selected variety of the Edible Fungus Research Institute of Shanghai Academy of Agricultural Sciences, deposit number GDMCC No: 61518). The fruiting body of the Flammulina velutipes variety 'Shangjianjin 7' at the harvesting time has a small, round, thick and inwardly buckled cap, a mountain-shaped top end in the longitudinal section, flat gills arranged regularly, and a columnar and thick stipe. The fruiting bodies are neat, uniform in color, not prone to browning, and have good overall commodity characteristics and quality.

[0011] The valine content in the above-mentioned Flammulina velutipes variety 'Shangjianjin 7' is 1.869 mg / g, which is increased by 1.43 x 10 4 % compared with the parent 'Shangjian No. 1', increased by 802.90% compared with the parent 'FV1923', increased by 6.82 x 10 3 % compared with the white production main cultivar, and increased by 21.21% compared with the yellow production main cultivar. The glutamic acid content in the Flammulina velutipes variety 'Shangjianjin 7' is 5.188 mg / g, which is increased by 670.88% compared with the parent 'Shangjian No. 1', increased by 3.45 x 10 4 % compared with the parent 'FV1923', increased by 252.93% compared with the white production main cultivar, and increased by 28.73% compared with the yellow production main cultivar.

[0012] The MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangjianjin 7' includes 8 MNP marker sites: SEQ ID NO: 1-16.

[0013] The amplification primers of the MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangjianjin 7' are as follows: the primers of SEQ ID NO: 1-2 are as follows: forward primer (5->3) cgcctctaaacaagtacgtttcatt; reverse primer (5->3) ttttgaagataggccaggacatctt.

[0014] The amplification primers of the MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangjianjin 7' are as follows: the primers of SEQ ID NO: 3-4 are as follows: forward primer (5->3) gatcttctcaagaaccagtcctacc; reverse primer (5->3) gatgagagaggctgcttggtc.

[0015] The amplification primers of the MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangjianjin 7' are as follows: the primers of SEQ ID NO: 5-6 are as follows: forward primer (5->3) tctactttggaggaatgaagaaccc; reverse primer (5->3) tacatttgttgagagcgagaagaga.

[0016] The amplification primers of the MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangjianjin 7' are as follows: the primers of SEQ ID NO: 7-8 are as follows: forward primer (5->3) gcctaccaatattttacgctgtctc; reverse primer (5->3) tattctaggaaacgcgtacgagtac.

[0017] The amplification primers of the MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangjianjin 7' are as follows: the primers of SEQ ID NO: 9-10 are as follows: forward primer (5->3) tcaagaggaaaataagcatgaggcaa; reverse primer (5->3) tcaggtcagtagctatagtattcaaatcgt.

[0018] The amplification primers of the MNP molecular fingerprint of the above-mentioned Flammulina velutipes variety 'Shangjianjin 7' are as follows: the primers of SEQ ID NO: 11-12 are as follows: forward primer (5->3) cagcatattggcacatacgtagttt; reverse primer (5->3) atcgttccaagttttacgtaggtca.

[0019] The amplification primer of the above-mentioned Flammulina velutipes variety 'Shangjianjin 7' MNP molecular fingerprint is as follows: the primers of SEQ ID NO: 13-14 are as follows: forward primer (5->3) aatagaccagctagaaatcacaactatgc; reverse primer (5->3) gtcttgcatgaaaatagttgcaactc.

[0020] The amplification primer of the above-mentioned Flammulina velutipes variety 'Shangjianjin 7' MNP molecular fingerprint is as follows: the primers of SEQ ID NO: 15-16 are as follows: forward primer (5->3) gacctctcgctactctcacatttat; reverse primer (5->3) gcgtctgactacgatgaaatttgta.

[0021] The beneficial effects of the present application are as follows: the average yield of the Flammulina velutipes variety 'Shangjianjin 7' in factory bottle cultivation can reach 382.66 g / bottle (1500 mL); it is higher than that of the yellow parent control 'FV1923' (278.97 g / bottle); the growth period is 1 day shorter than that of the parent control 'FV1923'. The cap of 'Shangjianjin 7' is thick, with an average diameter of 0.96 cm and a thickness of 0.16 cm; the average diameter of the stem is 0.28 cm, and the length is 17.51 cm. The appearance of the fruiting body of 'Shangjianjin 7' is as follows: light yellow, not easy to brown; the cap is small, round, thick, and inwardly buckled, and the longitudinal section is mountain-shaped at the top; the stem is thick, and the fruiting body is neat; the cap is smaller than that of the parent 'Shangjian No. 1', not easy to open, and the stem is thick; the cap is smaller than that of the parent 'FV1923', and the base is yellow. 'Shangjianjin 7' has excellent properties, meets the diversified market demand, is suitable for factory annual bottle cultivation, and has a good application and popularization prospect. The MNP molecular fingerprint of the Flammulina velutipes variety 'Shangjianjin 7' has specificity and specificity in identifying the Flammulina velutipes strain 'Shangjianjin 7'. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced as follows:

[0023] Figure 1 The fruiting body morphological chart of 'Shangjianjin 7' and the parent 'J4137' and the production main cultivar.

[0024] Figure 2 The fruiting body morphological chart of 'Shangjianjin 7' and the production main cultivar 5 days after harvesting. DETAILED DESCRIPTION

[0025] In order to make the above-mentioned purposes, features and advantages of the present application more apparent and easy to understand, the specific implementation manner of the present application will be described in detail below with specific examples.

[0026] Example 1

[0027] Breeding of Flammulina velutipes variety 'Shangjianjin 7'

[0028] In November 2020, protoplast monokaryons of Flammulina velutipes varieties 'Shangjian No. 1' and 'FV1923' were prepared, and the protoplast monokaryons of the two strains were subjected to single hybrid pairing and microscopic examination, and 60 hybrid offspring were obtained. In the laboratory, 40 hybrid offspring were subjected to preliminary screening and small-scale cultivation screening according to colony morphology, growth rate, and shake flask mycelium morphology. Eight excellent offspring were obtained. In 2021, small-scale preliminary screening of hybrid new combinations was carried out at Shanghai Xuelong Biotechnology Co., Ltd. (Dezhou base) using conventional bottle cultivation formula. Each bottle contained about 950 g of wet material, with a water content of about 65% and a natural pH. Each strain was cultivated in 16 bottles. After sterilization and inoculation, the cultivation bottles were moved to the cultivation room, where they were cultured in the dark at a temperature of 14-19°C and a humidity of more than 85%. After the mycelium was scratched, it was moved to the fruiting room for fruiting management and fruiting trait recording, yield statistics, etc. After one round of small-scale preliminary screening, 5 of the 40 hybrid offspring were eliminated at the primordium stage. Among the 35 strains that could form fruiting bodies, 30 could form normal fruiting bodies, and 5 had abnormal fruiting body morphology. Based on the results of the small-scale preliminary screening, 15 strains with less browning, smaller caps, higher yields, and thicker stems were selected for small-scale re-screening. The formula and management mode were the same as those of the small-scale preliminary screening. Each strain was cultivated in 160 bottles. According to the screening results, 5 strains with less browning, smaller caps, higher yields, and thicker stems were selected for comparison with the parent strains. In 2022, pilot tests were conducted at Shanghai Xuelong Biotechnology Co., Ltd. (Dezhou base) and Hebei Guangming Jiudaomuguo Biotechnology Co., Ltd. The results showed that the hybrid offspring of protoplast monokaryon No. 21 of 'Shangjian No. 1' and protoplast monokaryon No. 29 of 'FV1923' performed well, with moderate stem adhesion, medium stem length, small cap diameter, moderate number of fruiting bodies, less browning, primordium formation 1 day earlier than the parent strains, and higher average yield per bottle than 'FV1923'. In 2023, the strain continued to be cultivated in pilot tests and demonstration cultivation at Shanghai Xuelong Biotechnology Co., Ltd. (Dezhou base), both using factory cultivation mode for fruiting. The results of the pilot tests and demonstration cultivation showed that the strain grew rapidly, had a short growth period, good mushroom shape, fast primordium formation, many primordia, small and thick caps, thick and sturdy stems, light yellow color, less browning, high yield, short growth cycle, and good storage resistance. Under suitable cultivation conditions, the yield was higher than that of the parent strain 'FV1923', and the final name was 'Shangjianjin 7'.

[0029] The nutritional characteristics of Flammulina velutipes variety 'Shangjianjin 7' and its parents 'Shangjian 1' and 'FV1923' were determined and compared. The results showed that the total content of amino acids in Flammulina velutipes variety 'Shangjianjin 7' was lower than that of parent 'FV1923', but higher than that of the production control (Table 1). Among them, the valine content in Flammulina velutipes variety 'Shangjianjin 7' was increased by 1.43×10 4 % compared with parent 'Shangjian 1', by 802.90% compared with parent 'FV1923', by 6.82×10 3 % compared with the white production main cultivar control, and by 21.21% compared with the yellow production main cultivar control. The glutamic acid content in Flammulina velutipes variety 'Shangjianjin 7' was increased by 670.88% compared with parent 'Shangjian 1', by 3.45×10 4 % compared with parent 'FV1923', by 252.93% compared with the white production main cultivar control, and by 28.73% compared with the yellow production main cultivar control. It is shown that the nutrition-enhanced variety can be developed by hybridization.

[0030] Table 1 Comparison of amino acid characteristics of 'Shangjianjin 7' with its parents and production controls (DW: mg / g)

[0031]

[0032]

[0033] Example 2:

[0034] Construction of MNP molecular fingerprint of Flammulina velutipes variety 'Shangjianjin 7':

[0035] (1) Mycelium culture: Flammulina velutipes strain 'Shangjianjin 7' was transferred to potato dextrose agar solid medium (PDA) and cultured at 19℃ for 7 days, and then the mycelium was collected;

[0036] (2) Genomic DNA extraction: The genomic DNA of the above mycelium was extracted by using a kit, the purity of the DNA of the sample to be tested was determined by using a spectrophotometer, 1 μL of the DNA of the sample to be tested was used to determine the concentration by using a Qubit fluorescence quantification instrument, and the concentration of the sample DNA was adjusted to be between 30 ng / μL and 50 ng / μL;

[0037] (3) Multiplex polymerase chain reaction (PCR): the MNP marker sites of the above extracted Flammulina velutipes strain 'Shangjianjin 7' sample were amplified by using multiplex PCR to obtain multiplex PCR amplification products.

[0038] The PCR amplification system is 30 μL in total volume, including: 4 μL of primer set (0.2 μM for each primer), 4 μL of DNA sample to be tested (20 ng / μL-30 ng / μL in concentration), 10 μL of GenoPlexs 3×T Master Mix (manufacturer: Shijiazhuang Boruit Biotechnology Co., Ltd.), 12 μL of ddH2O, and oscillation mixing to obtain a mixture for multiplex PCR amplification.

[0039] The PCR amplification reaction program is 95℃ for 3 min; (95℃ for 20 s, 60℃ for 4 min) for 15 cycles; 72℃ for 4 min; and 10℃ for storage. The multiplex PCR amplification product is purified.

[0040] (4) Construction of high-throughput sequencing library and sequencing: according to the operation instructions of the high-throughput sequencing kit and the high-throughput sequencer, the high-throughput sequencing library obtained from the multiplex PCR amplification is subjected to high-throughput sequencing. The average coverage multiple of high-throughput sequencing is set to be more than 700 times, and the sequencing length is not less than 300 bp.

[0041] To the multiplex PCR amplification product, 10 μL of GenoPlexs 3×T Master Mix, 2 μL of P5 primer with a concentration of 5 μM, 2 μL of P7 barcode primer (containing sample barcodes in the primer) with a concentration of 5 μM, and 16 μL of ddH2O are added, oscillation mixing and short centrifugation.

[0042] The PCR amplification reaction program is 95℃ for 3 min; (95℃ for 20 s, 60℃ for 4 min) for 15 cycles; 72℃ for 4 min; and 10℃ for storage. The multiplex PCR amplification product is purified.

[0043] The high-throughput sequencing is performed by using an illumina Next Seq550 sequencer to sequence the library, and the sequencing data of the sample to be tested is obtained. The detailed sequencing steps are shown in the instruction manual of the sequencer.

[0044] (5) Data alignment: the sequencing data of the Flammulina velutipes strain 'Shangyanjin 7' are homologously aligned to the DNA sequences of the MNP marker sites on the Flammulina velutipes reference genome, and the average coverage multiple of the detected marker sites is counted. The genotype record of the detected MNP marker site is recorded as all the detected allelotype of the site, wherein the detected allelotype refers to the detected DNA fragment composed of the first to last base of the marker, and different detected allelotype is separated by " / ".

[0045] The sequencing data of the sample to be tested is aligned to the reference genome of Flammulina velutipes by using data alignment software Bowtie2 (version number 2.1.0) to obtain the MNP marked DNA sequence of each sample to be tested. The alignment result is saved in SAM (The Sequence Alignment / Map format) format.

[0046] Table 2 List of 14 MNP marker sites and primer information of Flammulina velutipes variety 'Shangjianjin 7'

[0047]

[0048] (6) Calculate genetic similarity: based on the principle that at least 1 SNP difference in the same MNP marker site allelic genotype in different Flammulina velutipes strains is considered to be different, the number of different MNP markers in pairwise comparison of different Flammulina velutipes strains is counted, and the marker site that can significantly distinguish any Flammulina velutipes strain is selected according to the different MNP marker sites. When the genetic similarity (GS) of the sample to be tested and the control sample is less than 96%, it is determined to be "different strains".

[0049] Genetic similarity GS = n / N x 100%, wherein N is the number of MNP sites amplified by the test strain and the 'Shangjianjin 7' variety, and n is the number of MNP sites with the same genotype among the MNP sites amplified by the test strain and the 'Shangjianjin 7' variety.

[0050] Table 3 Genetic similarity (GS) of Flammulina velutipes variety 'Shangjianjin 7' and other Flammulina velutipes strains

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064] From the results of Table 3, the highest genetic similarity of Flammulina velutipes variety 'Shangjianjin 7' and other 266 Flammulina velutipes strains is 91.97%, and the lowest is 0%. Except for strains JZG221224001, JZG221224002, JZG221224003, JZG221224006, JZG221224017, JZG221224035, JZG221224088 and JZG240509043, the genetic similarity is higher than 90%, the genetic similarity of the rest is relatively low, which shows that the genetic difference between Flammulina velutipes variety 'Shangjianjin 7' and other Flammulina velutipes strains is large, and Flammulina velutipes variety 'Shangjianjin 7' can be effectively identified through the MNP marker site.

[0065] Table 4 Storage stability test of Shangjianjin 7' and main production cultivars

[0066]

[0067] From Table 4, it can be seen that Shangjianjin 7 is more difficult to brown than other main production cultivars, and has significantly higher storage stability.

[0068] It should be noted that the above examples are only used to illustrate the technical solutions of the present application and are not limiting. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present application, and they should be covered in the scope of the claims of the present application.

Claims

1. A type of yellow enoki mushroom that does not easily turn brown ( Flammulina filiformis The method for MNP molecular identification of strains is characterized by: The 8 pairs of MNP marker primers shown in SEQ ID NO: 1-16 are used for MNP molecular identification of the Flammulina velutipes strain. Flammulina filiformis The Flammulina velutipes strain has a preservation number of GDMCC No: 64423, and was preserved in the Guangdong Microbial Culture Collection Center on March 15, 2024.

2. The method of claim 1, wherein: The Pleurotus eryngii strain with the preservation number of GDMCC No: 64423 Flammulina filiformis ) has high yield of valine and glutamic acid.

3. The method of claim 1, wherein: When the fungal strain to be identified is the same as the enoki mushroom with the preservation number GDMCCNo: 64423 ( Flammulina filiformis When the genetic similarity (GS) between strains is greater than or equal to 96%, they are identified as the same strain.

4. The method of claim 3, wherein: The MNP molecular identification includes performing PCR amplification on the test Flammulina velutipes strain by using 8 pairs of MNP marker primers shown in SEQ ID NO: 1-16, and sequencing the amplification product.

5. The method of claim 3, wherein: Genetic similarity GS = n / N x 100%, wherein N is the number of MNP sites amplified by the test strain and the Flammulina velutipes (MNP-1) strain with the preservation number GDMCC No: 64423 together, and n is the number of MNP sites with the same genotype in the MNP sites amplified by the test strain and the Flammulina velutipes (MNP-1) strain with the preservation number GDMCC No: 64423 together. Flammulina filiformis = n / N x 100%, wherein N is the number of MNP sites amplified by the test strain and the Flammulina velutipes (MNP-1) strain with the preservation number GDMCC No: 64423 together, and n is the number of MNP sites with the same genotype in the MNP sites amplified by the test strain and the Flammulina velutipes (MNP-1) strain with the preservation number GDMCC No: 64423 together. Flammulina filiformis = n / N x 100%, wherein N is the number of MNP sites amplified by the test strain

Images