Recombinant engineering bacteria co-expressing bip for producing anti-tumor ginseng peptide and application thereof
By co-expressing the molecular chaperone protein BIP and the anti-tumor ginseng peptide F0630 in Pichia pastoris GS115 and using methanol fermentation induction method, the problems of low production efficiency and high cost of ginseng peptide in the existing technology were solved, realizing low-cost and high-efficiency production of anti-tumor ginseng peptide with significant anti-tumor activity.
Patent Information
- Application Number
- CN202411263344.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-10
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2044-09-10
AI Technical Summary
Existing technologies for the preparation of ginseng peptides suffer from problems such as complex operation, high cost, low efficiency, and significant environmental pollution. In particular, chemical synthesis and separation and extraction methods are difficult to achieve efficient and low-cost production of anti-tumor ginseng peptides.
Using Pichia pastoris GS115 as the host strain, and co-expressing the molecular chaperone protein BIP and the recombinant plasmid of the anti-tumor ginseng peptide F0630, the anti-tumor ginseng peptide was produced stably and efficiently through shake-flask fermentation induction with methanol as the substrate.
The efficient production of anti-tumor ginseng peptides has been achieved, which is characterized by low cost and environmental friendliness, and the product has stable function and significant anti-tumor effect.
Smart Images

Figure CN119040161B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of bioengineering, and particularly relates to a recombinant engineering bacterium for co-expressing BIP to produce an anti-tumor ginseng peptide and application thereof. BACKGROUND
[0002] Among numerous anti-tumor drugs, polypeptide drugs are attracting much attention due to their unique advantages. These drugs have a small molecular weight, can more effectively penetrate cell membranes, have high bioavailability, strong targeting, low damage to normal cells, and low toxicity, and the like. Therefore, polypeptide drugs have great potential and application prospects in anti-tumor treatment, and are an important direction of current and future anti-tumor drug research.
[0003] Ginseng peptides have anti-tumor, anti-stress, and antioxidant activities. Current ginseng peptide preparation can be achieved by three methods: isolation and extraction from nature, artificial chemical synthesis, and biological recombinant expression. The isolation and extraction method is limited by the complexity of operation, time consumption, high cost, and low extraction efficiency. In contrast, the chemical synthesis method is costly, has many by-products, has a cumbersome separation and purification process, and can be affected by the environment. The biological recombinant expression technology has become a research hotspot due to its short culture period, low cost, and high expression amount. This method has the advantages of high production efficiency and small environmental pollution by expressing ginseng peptide genes in host organisms, indicating the future development direction of ginseng peptide production.
[0004] Pichia pastoris is a single-cell eukaryote. It has the characteristics of prokaryotes, such as easy cultivation, fast reproduction, and convenient genetic engineering operation, and also has the ability of eukaryotes to correctly fold and post-translationally process and modify gene products. Therefore, Pichia pastoris is often used to express foreign proteins. Therefore, based on synthetic biology technology, using Pichia pastoris as a recombinant protein expression system to develop a recombinant strain capable of efficiently expressing functional ginseng peptides and their derivatives shows greater application prospects. SUMMARY
[0005] The technical problem to be solved by the present application is to provide a recombinant engineering bacterium for co-expressing BIP to produce an anti-tumor ginseng peptide and application thereof to solve the above problems of the prior art. The engineering bacterium of the present application uses Pichia pastoris GS115 as the host bacterium, co-expresses the human ginseng polypeptide gene with strong anti-colon cancer activity and the molecular chaperone protein BIP that can help protein to correctly fold and secrete, and realizes stable and efficient production of recombinant anti-tumor ginseng peptide F0630.
[0006] To solve the above technical problems, the technical scheme adopted by the present application is: a recombinant engineering bacterium for co-expressing BIP to produce an anti-tumor ginseng peptide, characterized in that the engineering bacterium is Pichia pastoris, which is preserved in the China General Microbiological Culture Collection Center with a preservation number of CGMCC NO: 29804 and a preservation date of January 29, 2024.
[0007] The above-mentioned recombinant engineering bacterium for co-expressing BIP to produce an anti-tumor ginseng peptide is characterized in that the host bacterium of the recombinant engineering bacterium is Pichia pastoris GS115, and the host bacterium has the recombinant plasmid pPIC9K-F0630 linearized by Sal I enzyme and the recombinant plasmid pGAPZB-BIP linearized by Avr II enzyme.
[0008] The above-mentioned recombinant engineering bacterium for co-expressing BIP to produce an anti-tumor ginseng peptide is characterized in that the recombinant plasmid pPIC9K-F0630 is a recombinant plasmid pPIC9K-F0630 obtained by inserting a gene encoding an anti-tumor ginseng peptide into a pPIC9K plasmid.
[0009] The above-mentioned recombinant engineering bacterium for co-expressing BIP to produce an anti-tumor ginseng peptide is characterized in that the nucleic acid sequence of the anti-tumor ginseng peptide is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2.
[0010] The above-mentioned recombinant engineering bacterium for co-expressing BIP to produce an anti-tumor ginseng peptide is characterized in that the recombinant plasmid pGAPZB-BIP is a recombinant plasmid pGAPZB-BIP obtained by inserting a gene encoding a molecular chaperone protein BIP into a pGAPZB plasmid.
[0011] The above-mentioned recombinant engineering bacterium for co-expressing BIP to produce an anti-tumor ginseng peptide is characterized in that the nucleic acid sequence of the molecular chaperone protein BIP is shown in SEQ ID NO. 3, and the amino acid sequence is shown in SEQ ID NO. 4.
[0012] In addition, the present application also provides a method for producing an anti-tumor ginseng peptide, characterized in that it comprises: fermenting and inducing the above-mentioned recombinant engineering bacterium.
[0013] The above-mentioned method is characterized in that the fermenting and inducing comprises: streaking culture of the recombinant engineering bacterium on a YPD culture medium to obtain single colonies, picking the single colonies and transferring them into a BMGY shake flask culture medium for culture until OD 600 = 10-15, resuspending the bacterial cells in a BMMY shake flask culture medium containing methanol, and performing 72 h of induction fermentation culture at 28-30°C and a rotation speed of 200 rpm, wherein methanol is added every 24 h during the induction fermentation culture process, and centrifugation is performed to obtain the anti-tumor ginseng peptide.
[0014] The method as claimed in the preceding item, characterized in that the methanol is added in an amount of 1% (w / v) of the final concentration of the system every 24 h during the induction of the fermentation culture.
[0015] The method as claimed in the preceding item, characterized in that the cell is resuspended in the BMMY flask culture medium containing methanol to an OD 600 of 1.
[0016] Compared with the prior art, the present application has the following advantages:
[0017] 1. The present application uses Pichia pastoris GS115 as a host strain, and through co-expression of chaperone protein and anti-tumor ginseng peptide, an anti-tumor ginseng peptide capable of effectively inhibiting the growth of tumor cells is obtained, so that the synthesis of anti-tumor ginseng peptide by a microbial method is realized.
[0018] 2. In the method for producing anti-tumor ginseng peptide by the recombinant engineering bacteria co-expressing BIP according to the present application, methanol is used as a substrate for shake flask fermentation induction, and the method has the characteristics of stable function of the product ginseng peptide and low fermentation cost.
[0019] 3. The recombinant engineering bacteria co-expressing BIP for producing anti-tumor ginseng peptide according to the present application has a great application prospect, and has great potential in the preparation of anti-tumor ginseng peptide and products containing anti-tumor ginseng peptide.
[0020] The technical solutions of the present application will be further described in detail below in combination with the drawings and examples.
[0021] Drawings of the specification
[0022] Figure 1 is a plasmid map of the recombinant plasmid pPIC9K-F0630;
[0023] Figure 2 is a plasmid map of the chaperone constitutive expression plasmid pGAPZB-BIP;
[0024] Figure 3 is a gel electrophoresis map of linearized pPIC9K-F0630;
[0025] Figure 4 is a PCR gel electrophoresis map of GS115-pPIC9K-F0630 colonies;
[0026] Figure 5 is an SDS-PAGE map of recombinant ginseng peptide F0630;
[0027] Figure 6 is a graph of the inhibition rate of ginseng peptides with different numbers of FKEHGY repeats on CT-26 cells. DETAILED DESCRIPTION
[0028] In the following examples, various processes and methods that are not described in detail are conventional methods known in the art.
[0029] Example 1
[0030] Construction of recombinant Pichia pastoris expression vector pPIC9K and codon optimization of ginseng peptide
[0031] (1) According to the codon preference of Pichia pastoris, the ginseng peptide gene F0630 is codon optimized, EcoR I restriction site, Not I restriction site and AAAAGA signal peptide restriction site are introduced, pPIC9K is used as an expression vector, and a recombinant plasmid pPIC9K-F0630 is constructed; the optimized nucleic acid sequence is shown in SEQ. ID. No. 1, and the amino acid sequence is shown in SEQ ID NO. 2; the insertion site of the optimized gene sequence is after the AAAAGA signal peptide restriction site; the obtained recombinant plasmid pPIC9K-F0630 is handed over to China Genesee Biotechnology Co., Ltd.; the ginseng hexapeptide has good anti-tumor efficacy, but the content in ginseng is very low, and it cannot be prepared on a large scale by plant extraction method, and at the same time, due to the too short coding gene, it is difficult to express efficiently by genetic engineering means, the present application uses genetic engineering technology to repeat the expression gene of ginseng hexapeptide for 30 times, optimizes according to the codon preference of Pichia pastoris, and translates and expresses the derived ginseng peptide F0630 with anti-tumor synergistic effect; the plasmid map of the recombinant plasmid pPIC9K-F0630 is shown in Figure 1 ;
[0032] SEQ ID NO. 1:
[0033] TTCAAAGAGCACGGCTACTTTAAGGAACATGGCTACTTCAAGGAACACGGATACTTTAAAGAACATGGATACTTTAAAGAGCATGGATACTTCAAAGAACACGGTTACTTCAAAGAGCATGGTTACTTCAAAGAGCATGGTTATTTCAAAGAGCACGGTTACTTTAAAGAGCACGGTTACTTCAAAGAGCACGGATACTTCAAAGAACATGGCTATTTCAAAGAGCATGGCTACTTTAAAGAACACGGATATTTCAAGGAGCATGGCTATTTCAAAGAGCATGGATATTTCAAAGAACACGGCTACTTCAAAGAGCACGGTTATTTCAAAGAGCACGGCTATTTCAAAGAACATGGTTACTTCAAAGAGCACGGCTACTTTAAGGAACATGGCTACTTCAAGGAACACGGATACTTTAAAGAACATGGATACTTTAAAGAGCATGGATACTTCAAAGAACACGGTTACTTCAAAGAGCATGGTTACTTCAAAGAGCATGGTTATTTCAAAGAGCACGGTTACTTTAAAGAGCACGGTTAC
[0034] SEQ ID NO. 2:
[0035] FKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGYFKEHGY
[0036] (2) using Sal I enzyme to single enzyme cut the recombinant plasmid pPIC9K-F0630, obtaining linearized recombinant plasmid, after alcohol precipitation purification, the linearized recombinant plasmid is electroporated into Pichia pastoris engineering bacteria GS115 competent cells, positive transformant screening is carried out on histidine-deficient MD plate, high copy screening of the positive transformant screened is carried out on YPD plate with G418 resistance, obtaining template transformant, PCR identification is carried out on the template transformant, obtaining recombinant Pichia pastoris engineering bacteria GS115 / pPIC9K-F0630; the mass of the recombinant plasmid pPIC9K-F0630 is 10 μg; the electroporation is carried out at 1.5 kV voltage using 2 mm electroporation cup; the histidine-deficient MD plate is MD solid culture medium sterilized at 121 ℃ for 20 min, the MD solid culture medium includes 1.34% (w / v) YNB, 2% (w / v) glucose, 4×10 -5 Figure 3 Figure 4
[0037] The primers in PCR identification are 3'ACAACTAATTATTCGAAGGATCCAAACGAT and 5'GTGCCTGACTGCGTTAGCAATTTAACT.
[0038] Example 2
[0039] The chaperone gene BIP is constructed in plasmid pGAPZB, and the specific embodiment is as follows:
[0040] (1) 0.5 μL of GS115 genomic DNA is used as an amplification template, chaperone gene BIP amplification primers are added, Primer Star Max high-fidelity enzyme is used for amplification, the amplification product is detected and confirmed to be correct in size by agarose gel electrophoresis, then gel recovery is carried out, and EcoRI and Xho I enzymes are used for cutting; the chaperone gene BIP nucleic acid sequence is shown as SEQ ID NO. 3, and the amino acid sequence is shown as SEQ ID NO. 4; the PCR amplification system and amplification conditions are shown in Table 1-1;
[0041] The amplification primers are:
[0042] BIP-F: GAATTCATGCTGTCGTTAAAACCA;
[0043] BIP-R: CTCGAGCTACAACTCATCATGA;
[0044] SEQ ID NO. 3:
[0045]
[0046] SEQ ID NO. 4:
[0047] MLSLKPSWLTLAALMYAMLLVVVPFAKPVRADDVESYGTVIGIDLGTTYSCVGVMKSGRVEILANDQGNRITPSYVSFTEDERLVGDAAKNLAASNPKNTIFDIKRLIGMKYDAPEVQRDLKRLPYTVKSKNGQPVVSVEYKGEEKSFTPEEISAMVLGKMKLIAEDYLGKKVTHAVVTVPAYFNDAQRQATKDAGLIAGLTVLRIVNEPTAAALAYGLDKTGEERQIIVYDLGGGTFDVSLLSIEGGAFEVLATAGDTHLGGEDFDYRVVRHFVKIFKKKHNIDISNNDKALGKLKREVEKAKRTLSSQMTTRIEIDSFVDGIDFSEQLSRAKFEEINIELFKKTLKPVEQVLKDAGVKKSEIDDIVLVGGSTRIPKVQQLLEDYFDGKKASKGINPDEAVAYGAAVQAGVLSGEEGVDDIVLLDVNPLTLGIETTGGVMTTLINRNTAIPTKKSQIFSTAADNQPTVLIQVYEGERALAKDNNLLGKFELTGIPPAPRGTPQVEVTFVLDANGILKVSATDKGTGKSESITINNDRGRLSKEEVDRMVEEAEKYAAEDAALREKIEARNALENYAHSLRNQVTDDSETGLGSKLDEDDKETLTDAIKDTLEFLEDNFDTATKEELDEQREKLSKIAYPITSKLYGAPEGGTPPGGQGFDDDDGDFDYDYDYDHDEL
[0048] (2) Plasmid pGAPZB was digested with EcoRI and Xho I, column-recovered, and the amplified product was ligated under the GAP promoter to construct the chaperone constitutive expression plasmid pGAPZB-BIP; the amplified product is located after the EcoRI enzyme cutting site; the plasmid map of the chaperone constitutive expression plasmid pGAPZB-BIP is shown in Figure 2
[0049] (3) the chaperone constitutive expression plasmid is linearized by Avr II single enzyme digestion, and the linearized recombinant plasmid is purified by alcohol precipitation and then electroporated into the GS115-pPIC9K-F0630 to obtain a recombinant strain capable of producing the anti-tumor ginseng peptide; the mass of the chaperone constitutive expression plasmid is 10 μg.
[0050] Table 1-1 PCR amplification system
[0051]
[0052] The chaperone protein BIP can effectively strengthen the BIP level in the endoplasmic reticulum and improve the protein folding ability and secretion efficiency.
[0053] Example 3: Shake flask fermentation for producing the anti-tumor ginseng peptide
[0054] (1) the recombinant strain capable of producing the anti-tumor ginseng peptide obtained in Example 2 is streaked on a YPD medium to obtain single colonies; the YPD medium is a YPD medium obtained by sterilizing a YPD solid medium at 115°C for 20 min, and the YPD solid medium comprises 1% (w / v) yeast extract, 2% (w / v) peptone, 2% (w / v) glucose and 2% (w / v) agar powder;
[0055] (2) the single colonies are picked and transferred into 10 mL of BMGY shake flask medium, and cultured at 30°C and a rotation speed of 200 rpm until the initial OD 600 = 10-15, and centrifuged at 8000 rpm in a centrifuge at 4°C for 10 min to remove the supernatant and collect the bacterial cells; the BMGY shake flask medium comprises 1% (w / v) yeast extract, 2% (w / v) peptone, 10% (w / v) phosphate buffer with a concentration of 1M and a pH of 6.0, 1.34% (w / v) YNB and 1% (w / v) glycerol; wherein the phosphate buffer with a concentration of 1M and a pH of 6.0 is prepared by mixing 11.484 g of K2HPO4 and 59.024 g of KH2PO4 with water and then diluting to 500 mL;
[0056] (3) the initial OD 600The bacteria are resuspended in BMMY flask culture medium containing 1% (w / v) methanol, and are induced to ferment at 28°C and a rotation speed of 200 rpm. The methanol is added to the BMMY culture medium to obtain the BMMY flask culture medium containing 1% (w / v) methanol, and the content of the methanol is 1% (w / v). The BMMY culture medium comprises 1% (w / v) yeast extract, 2% (w / v) peptone, 10% (w / v) phosphate buffer with a concentration of 1M and a pH of 6.0, and 1.34% (w / v) YNB. The bacteria are induced to ferment for 72 hours, and then are centrifuged in a centrifuge at 8000 rpm and 4°C for 5 minutes. The supernatant is collected and subjected to SDS-PAGE protein electrophoresis to confirm the band, and the ginseng peptide is collected. In the present application, the suitable temperature for the induction of fermentation is 28-30°C, and the temperature in the present embodiment is 28°C. The BMMY flask culture medium containing 1% (w / v) methanol is obtained by adding methanol to the BMMY culture medium, and the content of the methanol is 1% (w / v). The BMMY culture medium comprises 1% (w / v) yeast extract, 2% (w / v) peptone, 10% (w / v) phosphate buffer with a concentration of 1M and a pH of 6.0, and 1.34% (w / v) YNB.
[0057] As shown in Figure 5 , the SDS-PAGE protein electrophoresis result shows that an obvious specific band appears, indicating that the ginseng peptide is successfully obtained by the method of the present application.
[0058] Example 4: Anti-tumor ginseng peptide inhibits tumor cells
[0059] The CT26 cells are inoculated into a 96-well plate at a cell amount of 1x10 4 per well and 100 μL, and are cultured in a CO2 incubator overnight, and then are added with drugs and continuously cultured for 48 hours. Subsequently, 10 μL of MTT reagent with a concentration of 5 mg / ml is added to each well, and is incubated for 4 hours. Then, 100 μL of DMSO is added, and the absorbance at 570 nm is detected by an enzyme-labeled instrument. The culture conditions for overnight culture are as follows: saturated humidity, 37°C, and 5% CO2. The blank group is normal cell culture solution, and the experimental group is the ginseng peptide with different concentrations. The concentration and the corresponding experimental results are shown in Figure 6 . The (FKEHGY)30 is the anti-tumor ginseng peptide of the present application, and the FKEHGY is the original ginseng hexapeptide without fragment repetition, which is purchased from Shengong Biotech.
[0060] Inhibition rate (%) = (OD value of the control group - OD value of the experimental group) / OD value of the control group
[0061] As shown in Figure 6 , the recombinant ginseng peptide F0630 of the present application has a significant inhibitory effect on the CT26 cells.
[0062] The above description is only a preferred embodiment of the present application, and does not limit the present application in any way. Any simple modification, change, and equivalent structural change made according to the technical essence of the present application to the above embodiment are still within the protection scope of the technical solution of the present application.
Claims
1. A recombinant engineering bacteria co-expressing BIP for producing anti-tumor ginseng peptides, characterized in that, The engineering bacteria are Pichia pastoris, deposited in the China General Microbiological Culture Collection Center on January 29, 2024, with the accession number CGMCC NO: 29804; the host bacteria of the recombinant engineering bacteria are Pichia pastoris GS115, and the host bacteria have the recombinant plasmid pPIC9K-F0630 linearized by SalI enzyme and the recombinant plasmid pGAPZB-BIP linearized by Avr II enzyme; the recombinant plasmid pPIC9K-F0630 is a recombinant plasmid pPIC9K-F0630 obtained by inserting the gene encoding the anti-tumor ginseng peptide into the pPIC9K plasmid, the nucleic acid sequence of the anti-tumor ginseng peptide F0630 is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2; the recombinant plasmid pGAPZB-BIP is a recombinant plasmid pGAPZB-BIP obtained by inserting the gene encoding the chaperone protein BIP into the pGAPZB plasmid; the nucleic acid sequence of the chaperone protein BIP is shown as SEQ ID NO. 3, and the amino acid sequence is shown as SEQ ID NO.
4.
2. A method for producing an anti-tumor ginseng peptide, characterized by, The recombinant engineering bacteria of claim 1 are subjected to fermentation induction; the fermentation induction comprises: streaking culture of the recombinant engineering bacteria on YPD medium to obtain single colonies, picking the single colonies and transferring them into BMGY flask culture medium for culture until OD600 = 10-15, obtaining bacterial bodies, resuspending the bacterial bodies in BMMY flask culture medium containing methanol, and performing 72h of induction fermentation culture at 28-30℃ and 200rpm rotation speed, wherein methanol is added every 24h during the induction fermentation culture process, centrifugation is performed, and the anti-tumor ginseng peptide is obtained; the amount of methanol added every 24h during the induction fermentation culture process is 1% (w / v) of the final concentration of the system; the OD600 of the bacterial bodies resuspended in the BMMY flask culture medium containing methanol is 1. The recombinant engineering bacteria of claim 1 are subjected to fermentation induction; the fermentation induction comprises: streaking culture of the recombinant engineering bacteria on YPD medium to obtain single colonies, picking the single colonies and transferring them into BMGY flask culture medium for culture until OD600 = 10-15, obtaining bacterial bodies, resuspending the bacterial bodies in BMMY flask culture medium containing methanol, and performing 72h of induction fermentation culture at 28-30℃ and 200rpm rotation speed, wherein methanol is added every 24h during the induction fermentation culture process, centrifugation is performed, and the anti-tumor ginseng peptide is obtained; the amount of methanol added every 24h during the induction fermentation culture process is 1% (w / v) of the final concentration of the system; the OD600 of the bacterial bodies resuspended in the BMMY flask culture medium containing methanol is 1.
Citation Information
Patent Citations
Method for improving expression amount of secretory foreign protein in pichia pastoris
CN104152484A
Method for high-efficiency expression of carboxypeptidase Y derived from actinomucor elegans
CN107828673A
Pichia pastoris, construction method thereof and application of pichia pastoris in synthesis of osteopontin
CN116004701A
Recombinant anti-tumor ginseng peptide and application thereof
CN117720663A
Heterologous recombinant pichia pastoris engineering bacterium for producing anti-tumor ginseng peptide and application of heterologous recombinant pichia pastoris engineering bacterium
CN119040162A