Application of Spodoptera litura SlTl-2 gene in pest control

By targeting the dsRNA inhibitor of the Spodoptera litura SlTl-2 gene and reducing its expression level, the problems of Spodoptera litura resistance to insecticides and environmental pollution were solved, and the pest control effect of increasing the sensitivity of Spodoptera litura to Bt toxin was achieved.

CN119040320BActive Publication Date: 2025-09-26SOUTH CHINA NORMAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410960569.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-17
Publication Date
2025-09-26
Estimated Expiration
2044-07-17

AI Technical Summary

Technical Problem

The Spodoptera litura has developed resistance to traditional insecticides such as Bt toxin, resulting in reduced insecticidal effectiveness. Chemical pesticides also cause environmental pollution and food safety problems. Existing technologies make it difficult to effectively control the Spodoptera litura and increase its sensitivity to insecticides.

Method used

Targeting the SlTl-2 gene of Spodoptera litura, designing specific dsRNA inhibitors, and increasing the pest's sensitivity to pesticides by reducing the expression level of SlTl-2. The specific method includes synthesizing dsRNA targeting SlTl-2 and expressing it in a vector, which is then introduced into the pest's body, for example, by feeding or injection.

Benefits of technology

It significantly improves the sensitivity of Spodoptera litura to Bt toxins, increases its mortality rate, and avoids the development of resistance. At the same time, it does not pollute the environment or harm humans and animals, providing a new method for pest control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119040320B_ABST
    Figure CN119040320B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of pest control technology, discloses the application of the Spodoptera litura SlTl-2 gene in pest control, and specifically discloses the application of an SlTl-2 inhibitor in pest control or the preparation of a product for pest control, wherein the nucleotide sequence of the SlTl-2 is shown in SEQ ID NO: 1. The present invention discloses for the first time a method for achieving the purpose of controlling Spodoptera litura by targeting the SlTl-2 gene of Spodoptera litura, targeting downregulating SlTl-2 (inhibiting SlTl-2 expression), degrading SlTl-2, and inhibiting SlTl-2 activity by the SlTl-2 inhibitor, thereby increasing the sensitivity of Spodoptera litura to its insecticide (such as Bt toxin), thereby achieving the purpose of controlling Spodoptera litura, and in the control process, does not produce drug resistance, is harmless to humans and animals, and does not pollute the environment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of pest control, and specifically relates to the field of Spodoptera litura SlTl-2 The application of genes in pest control. Background Art

[0002] Spodoptera litura ( Spodoptera litura Spodoptera litura (Spodoptera litura), a member of the Noctuidae family of the order Lepidoptera, is a widespread omnivorous agricultural pest found in tropical, subtropical, and temperate regions. Its larvae feed on over 300 crops, including corn, rice, wheat, cotton, and potatoes, causing significant economic losses and agricultural damage. With climate warming and pest invasions over the past two decades, the Spodoptera litura has become increasingly devastating in southern China, particularly in Fujian and Yunnan, where it has become a major agricultural pest. The Spodoptera litura's short generation cycle, high egg production, long migratory distances, and voracious appetite have led to its widespread devastation worldwide.

[0003] Double-stranded RNA (dsRNA) is an RNA molecule with two strands of complementary base sequences. RNA interference (RNAi) is a conservative biological response to double-stranded RNA (dsRNA) that targets and degrades mRNA, inducing sequence-specific gene silencing and thus preventing protein translation. RNAi is used in the agricultural field to improve crop quality, increase yields, and resist pests and diseases. Due to the widespread use of chemical agriculture, environmental pollution, food safety, and drug resistance have arisen. As an important biological control method, RNAi has become a widely studied pest control and integrated pest management technology. Bt toxin ( Bacillus thuringiensis toxin is a Bacillus thuringiensis ) produces protein toxins with insecticidal activity against insects. With the use of Bts insecticides, pests have developed resistance, reducing their effectiveness. Therefore, research combining RNAi with Bt toxins has important practical applications.

[0004] Toll gene is an important immune-related gene, originally found in Drosophila ( Drosophila melanogaster). The Toll protein, encoded by the Toll gene, is a transmembrane protein that plays a key role in regulating immune responses in fruit flies and other insects. Initially thought to be primarily involved in embryonic axis formation during embryonic development, studies have subsequently revealed that it also plays a crucial role in immune responses. The discovery of Toll in fruit fly immunity and development was recognized twice, earning Nobel Prizes. When fruit flies are infected or invaded, Toll protein is activated, initiating a series of signaling pathways that promote the production of immune-related molecules such as antimicrobial peptides, thereby enhancing the fly's resistance. In addition to research in fruit flies, Toll genes and their homologs have been extensively studied in other organisms, including mammals and plants. In mammals, Toll genes are also involved in immune responses, regulating inflammatory responses and immune cell activation. In plants, Toll genes are associated with disease resistance. In summary, Toll genes and the receptors they encode play important regulatory roles in the immune system, helping organisms resist invasion by foreign pathogens and maintain homeostasis and health. However, whether Toll genes play similar roles in Spodoptera litura remains unknown. Summary of the Invention

[0005] The first aspect of the present invention aims to provide SlTl-2 Use of inhibitors in controlling pests or preparing products for controlling pests.

[0006] The second aspect of the present invention is to provide SlTl-2 Use of an inhibitor in promoting the sensitivity of pests to pesticides or in preparing a product for promoting the sensitivity of pests to pesticides.

[0007] The third aspect of the present invention is to provide a dsRNA.

[0008] The fourth aspect of the present invention aims to provide biological materials related to the dsRNA of the third aspect of the present invention.

[0009] The fifth aspect of the present invention aims to provide a product.

[0010] The sixth aspect of the present invention aims to provide the use of the dsRNA of the third aspect of the present invention, the biological material of the fourth aspect of the present invention and / or the product of the fifth aspect of the present invention in promoting the sensitivity of pests to pesticides or in preparing products that promote the sensitivity of pests to pesticides.

[0011] A seventh object of the present invention is to provide a method for controlling pests or a method for increasing the sensitivity of pests to pesticides.

[0012] In order to achieve the above object, the technical solution adopted by the present invention is:

[0013] The first aspect of the present invention provides SlTl-2 Use of an inhibitor in controlling pests or preparing a product for controlling pests, the SlTl-2 The nucleotide sequence is shown in SEQ ID NO: 1.

[0014] In some embodiments of the present invention, the SlTl-2 Inhibitors SlTl-2 Active substances, degradation SlTl-2 substances or reduce SlTl-2 At least one of the substances expressing SlTl-2 Expression levels of substances.

[0015] In some embodiments of the present invention, the reduction SlTl-2 The substance with the expression level is at least one of (1) to (3):

[0016] (1) Targeting SlTl-2 siRNA, dsRNA, miRNA, ribozyme or shRNA;

[0017] (2) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, ribozyme or shRNA targeting SlTl-2 described in (1);

[0018] (3) An expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (2).

[0019] In some embodiments of the present invention, the SlTl-2 The inhibitor is at least one of (4) to (6):

[0020] (4) Targeting SlTl-2 dsRNA;

[0021] (5) Encoding the target described in (4) SlTl-2 a nucleic acid molecule containing a dsRNA;

[0022] (6) An expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (5).

[0023] In some embodiments of the present invention, the dsRNA comprises a double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID NO: 2 and the nucleotide sequence shown in its reverse complementary sequence.

[0024] In some embodiments of the present invention, the pests include insects of the order Lepidoptera.

[0025] In some embodiments of the present invention, the pest is one or more of Spodoptera litura, Manduca sexta, Cotton bollworm, Plutella xylostella, Spodoptera exigua and Spodoptera frugiperda.

[0026] The second aspect of the present invention provides SlTl-2 Use of an inhibitor in promoting the sensitivity of pests to pesticides or in preparing a product promoting the sensitivity of pests to pesticides, wherein the inhibitor is SlTl-2 The nucleotide sequence is shown in SEQ ID NO: 1.

[0027] In some embodiments of the present invention, the SlTl-2 Inhibitors SlTl-2 Active substances, degradation SlTl-2 substances or reduce SlTl-2 At least one of the substances expressing SlTl-2 Expression levels of substances.

[0028] In some embodiments of the present invention, the reduction SlTl-2 The substance with the expression level is at least one of (1) to (3):

[0029] (1) Targeting SlTl-2 siRNA, dsRNA, miRNA, ribozyme or shRNA;

[0030] (2) a nucleic acid molecule encoding the siRNA, dsRNA, miRNA, ribozyme or shRNA targeting SlTl-2 described in (1);

[0031] (3) An expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (2).

[0032] In some embodiments of the present invention, the SlTl-2 The inhibitor is at least one of (4) to (6):

[0033] (4) Targeting SlTl-2 dsRNA;

[0034] (5) Encoding the target described in (4) SlTl-2 a nucleic acid molecule containing a dsRNA;

[0035] (6) An expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (5).

[0036] In some embodiments of the present invention, the dsRNA comprises a double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID NO: 2 and the nucleotide sequence shown in its reverse complementary sequence.

[0037] In some embodiments of the present invention, the pests include insects of the order Lepidoptera.

[0038] In some embodiments of the present invention, the pest is one or more of Spodoptera litura, Manduca sexta, Cotton bollworm, Plutella xylostella, Spodoptera exigua and Spodoptera frugiperda.

[0039] In some embodiments of the present invention, the pesticides include but are not limited to toxins that are toxic to pests (such as Bt toxins, Cry toxins, and neristoxins), compounds (such as flurella, tetrazobactam, methoxyfenozide, thiamethoxam, acetofenapyr, and cyclosporin A), drugs (such as Polygonum villosa roots and Portulaca oleracea extracts) or proteins (such as WBY-7.06 protein).

[0040] The third aspect of the present invention provides a dsRNA, wherein the dsRNA comprises a double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID NO: 2 and the nucleotide sequence shown in its reverse complementary sequence.

[0041] The fourth aspect of the present invention provides a biological material related to the dsRNA of the third aspect of the present invention, wherein the biological material comprises any one of 1) to 12):

[0042] 1) a nucleic acid molecule encoding the dsRNA according to the third aspect of the present invention;

[0043] 2) an expression cassette comprising the nucleic acid molecule described in 1);

[0044] 3) a vector comprising the nucleic acid molecule described in 1);

[0045] 4) a vector comprising the expression cassette described in 2);

[0046] 5) A transgenic cell line comprising the nucleic acid molecule described in 1);

[0047] 6) a transgenic cell line comprising the expression cassette described in 2);

[0048] 7) A transgenic cell line comprising the vector described in 3);

[0049] 8) A transgenic cell line comprising the vector described in 4);

[0050] 9) A recombinant microorganism containing the nucleic acid molecule described in 1);

[0051] 10) a recombinant microorganism containing the expression cassette described in 2);

[0052] 11) A recombinant microorganism containing the vector described in 3);

[0053] 12) Recombinant microorganism containing the vector described in 4)

[0054] In some embodiments of the invention, the transgenic cell line does not contain reproductive material.

[0055] In some embodiments of the present invention, the vector is a plasmid vector, a phagemid, a viral vector, a cell vector, a phage, a cosmid, a F cosmid, or an artificial chromosome. The plasmid vector may be any plasmid, the viral vector may be any virus, and the cell vector does not include propagation material.

[0056] The fifth aspect of the present invention provides a product, wherein the product comprises the dsRNA according to the third aspect of the present invention and / or the biological material according to the fourth aspect of the present invention.

[0057] In some embodiments of the present invention, the product is used to increase the sensitivity of pests to pesticides or to control pests.

[0058] In some embodiments of the present invention, the product comprises at least one of a reagent, a medicine, and a pesticide.

[0059] In some embodiments of the present invention, the product further comprises a pharmaceutically acceptable carrier, including but not limited to: a diluent, a buffer, a suspension, an emulsion, a granule, an encapsulation agent, an excipient, a filler, an adhesive, a spray, a transdermal absorbent, a wetting agent, a disintegrant, an absorption enhancer, a surfactant, a colorant, a flavoring agent or an adsorption carrier.

[0060] In some embodiments of the present invention, the pests include insects of the order Lepidoptera.

[0061] In some embodiments of the present invention, the pest is one or more of Spodoptera litura, Manduca sexta, Cotton bollworm, Plutella xylostella, Spodoptera exigua and Spodoptera frugiperda.

[0062] In some embodiments of the present invention, the pesticides include but are not limited to toxins that are toxic to pests (such as Bt toxins, Cry toxins, and neristoxins), compounds (such as flurella, tetrazobactam, methoxyfenozide, thiamethoxam, acetofenapyr, and cyclosporin A), drugs (such as Polygonum villosa roots and Portulaca oleracea extracts) or proteins (such as WBY-7.06 protein).

[0063] The sixth aspect of the present invention provides the use of the dsRNA of the third aspect of the present invention, the biological material of the fourth aspect of the present invention and / or the product of the fifth aspect of the present invention in promoting the sensitivity of pests to pesticides or in preparing products that promote the sensitivity of pests to pesticides.

[0064] In some embodiments of the present invention, the pests include insects of the order Lepidoptera.

[0065] In some embodiments of the present invention, the pest is one or more of Spodoptera litura, Manduca sexta, Cotton bollworm, Plutella xylostella, Spodoptera exigua and Spodoptera frugiperda.

[0066] In some embodiments of the present invention, the pesticides include but are not limited to toxins that are toxic to pests (such as Bt toxins, Cry toxins, and neristoxins), compounds (such as flurella, tetrazobactam, methoxyfenozide, thiamethoxam, acetofenapyr, and cyclosporin A), drugs (such as Polygonum villosa roots and Portulaca oleracea extracts) or proteins (such as WBY-7.06 protein).

[0067] The seventh aspect of the present invention provides a method for controlling pests or a method for increasing the sensitivity of pests to pesticides, comprising: reducing the SlTl-2 The step of increasing the expression level and / or activity of

[0068] In some embodiments of the present invention, the SlTl-2 The nucleotide sequence is shown in SEQ ID NO: 1.

[0069] In some embodiments of the present invention, the reduction of pests SlTl-2 The step of increasing the expression level and / or activity of the dsRNA of the third aspect of the present invention, the biological material of the fourth aspect of the present invention, or the product of the fifth aspect of the present invention is introduced into the body of the pest.

[0070] In some embodiments of the present invention, the introduction method includes oral feeding or injection.

[0071] In some embodiments of the present invention, the oral feeding comprises pre-application, spraying, or atomization of food, a pest habitat (soil, area, material, or environment where the pest is growing or can grow, or materials to be protected from attack or infestation by pests, cultivated plants, plant propagation materials (such as seeds), soil, surface, or space), or water containing the dsRNA of the third aspect of the present invention, the biological material of the fourth aspect of the present invention, and / or the product of the fifth aspect of the present invention.

[0072] In some embodiments of the present invention, the pests include insects of the order Lepidoptera.

[0073] In some preferred embodiments of the present invention, the pests are one or more of Spodoptera litura, Manduca sexta, Helicoverpa armigera, Plutella xylostella, Spodoptera exigua and Spodoptera frugiperda.

[0074] In some more preferred embodiments of the present invention, the pest is Spodoptera litura.

[0075] In some embodiments of the present invention, the pesticides include but are not limited to toxins that are toxic to pests (such as Bt toxins, Cry toxins, and neristoxins), compounds (such as flurella, tetrazobactam, methoxyfenozide, thiamethoxam, acetofenapyr, and cyclosporin A), drugs (such as Polygonum villosa roots and Portulaca oleracea extracts) or proteins (such as WBY-7.06 protein).

[0076] The beneficial effects of the present invention are:

[0077] The present invention discloses for the first time a method for targeting Spodoptera litura SlTl-2 Genes can achieve the purpose of controlling Spodoptera litura by SlTl-2 Inhibitor targeted downregulation SlTl-2 (inhibition SlTl-2 expression), degradation SlTl-2 ,inhibition SlTl-2 activity, increasing the sensitivity of Spodoptera litura to its insecticides (such as Bt toxins) to achieve the purpose of preventing and controlling Spodoptera litura, and in the process of prevention and control, it will not produce drug resistance, will not harm humans and animals, and will not pollute the environment.

[0078] Spodoptera litura SlTl-2 The researchers designed a specific dsRNA that can effectively increase the sensitivity of Spodoptera litura to its insecticides (such as Bt toxins). SlTl-2 After feeding dsRNA to Spodoptera litura, SlTl-2 The gene's expression was suppressed. Once this gene was suppressed, feeding Bt toxin significantly accelerated the death of Spodoptera litura larvae. This research provides targets and techniques for improving the insecticidal efficiency of insecticides such as Bt toxin. BRIEF DESCRIPTION OF THE DRAWINGS

[0079] Figure 1 This is the L4440 vector map and multiple cloning site.

[0080] Figure 2 This is the survival curve of Spodoptera litura larvae after being fed dsRNA and Bt toxin.

[0081] Figure 3 qRT-PCR was used to detect the interference effect of feeding dsRNA.

[0082] Figure 4 qRT-PCR detection of antimicrobial peptide genes fed dsRNA Acttacin (A) Cecropin (B) Gloverin (C) Lebocin (D) and Virescein (E) impact. DETAILED DESCRIPTION

[0083] The present invention is further described in detail below through specific examples.

[0084] It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0085] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0086] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0087] Example 1 Double-stranded RNA (dsRNA) synthesis and expression

[0088] In this example, a method for reducing the incidence of Spodoptera litura was synthesized. SlTl-2 The dsRNA of the gene was expressed in Escherichia coli.

[0089] (1) Spodoptera litura SlTl-2 Design of dsRNA for genes

[0090] Toll gene is an important gene family with abundant homologous genes in species. The inventors identified a Toll homologous gene in Spodoptera litura and named it SlTl-2 By comparing and searching the genes of Spodoptera litura in the National Center for Biotechnology Information Database (NCBI), we obtained the SlTl-2 The complete sequence of the gene, the RNA sequence is shown in SEQ ID NO: 1.

[0091]

[0092] Spodoptera litura SlTl-2 The gene exon region is processed and the dsRNA targeting sequence is designed to finally obtain the optimal dsRNA targeting sequence.

[0093] The dsRNA targeting sequence is:

[0094] AGCATACGATATTTTCGTTTCCTACGCCCACCAAGATCAAAAATACGTCGACAAGTTACTGCCCAAACTAGAAAACGACTTCAAATTGAAAGTCTGTGTCCACTACCGAGACTGGGAAGTCGGTGATTTCATCCCCGATCAAATTCATCGGTCGGTATCGAATTCTCGGAAAACTATTATTTTATTATCGAATCATTTTCTCGATTCGA CGTTTGCGAATATGGAGTTTAGGACGGCTCATAACTTGGCTTTGAAGGAAGGTCGGGAAAGAGTGATTTTGATCCTTCTGGAAGACGTAAGTAAGCATGAGAAGTTGTCTGAAGAGTTGAAATATCATATGAAGATGAATACGTACCTGACTTGGGATGACATTCGCTTCGATGATAAATTAAAACGTCGTACGATCCCGCAAAAA (SEQ ID NO:2).

[0095] Among them, for SlTl-2 The primers designed for the dsRNA targeting sequences are:

[0096] Upstream primer L4440-dsTl-2-F: 5′-GCTCTAGAGCATACGATATTTTCGTTT-3′ (SEQ ID NO: 3);

[0097] Downstream primer L4440-dsTl-2-R: 5′-CGCTGCAGTTTTTGCGGGATCGTACGA-3′ (SEQ ID NO: 4).

[0098] Green fluorescent protein (GFP) gene was silenced by synthesizing dsRNA primers targeting the GFP gene as a control.

[0099] The primers designed for the dsRNA targeting sequence of GFP are:

[0100] Upstream primer L4440-dsGFP-F: 5′-CGAGCTCAAGTTCAGCGTGTCCG-3′ (SEQ ID NO: 5);

[0101] Downstream primer L4440-dsGFP-F: 5′-GCTGCAGCACCTTGATGCCGTTC-3′ (SEQ ID NO: 6).

[0102] (2) Construction of recombinant vector expressing dsRNA in Escherichia coli

[0103] After obtaining specific primers related to RNAi experiments, the specific region was obtained by PCR, and then digested and ligated to the L4440 plasmid, which is a plasmid that can efficiently express dsRNA (see the plasmid map). Figure 1 ), and the ligation product was transformed into Escherichia coli HT115 In the DE3 competent state, the plasmids of the correctly identified positive bacteria were extracted and digested with double enzymes for identification. The sequencing was commissioned to Qingke Biotechnology Company, and the DNA sequence was compared and analyzed using SnapGene software. The specific steps are as follows:

[0104] Step 1: Preparation of cDNA from Spodoptera litura samples

[0105] 1) Place Spodoptera litura larvae in a centrifuge tube, add two small steel balls and 500 μL of Tritol (Takara) reagent to each tube, and grind in a grinder.

[0106] 2) Add 200 μL of a mixture of chloroform and isoamyl alcohol (volume ratio: 24:1) to each centrifuge tube, shake vigorously, and place on ice for 5 min.

[0107] 3) Place the sample symmetrically in a centrifuge and centrifuge. Pipette approximately 500 μL of the supernatant into a freshly pre-chilled centrifuge tube.

[0108] 4) Add 400-500 μL of isopropanol, mix well, and place in a -20°C refrigerator for 4 h;

[0109] 5) Centrifuge the tube, discard the supernatant, and finally add 1 mL of 75% ethanol;

[0110] 6) After centrifugation, repeat step 7. Remove the supernatant and air-dry for 5–10 minutes. Finally, add an appropriate amount of DEPC-ddH2O to dissolve the RNA.

[0111] 7) Prepare the RNA sample according to the instructions of the reverse transcription kit (purchased from Nanjing Novezan Co., Ltd.).

[0112] 8) Combine the reagent mix and enzyme with the RNA in a reaction tube, vortex to mix, centrifuge, and place in a PCR instrument set to 50°C for 15 minutes, followed by 85°C for 5 seconds. After the reaction, store the cDNA in a -20°C refrigerator.

[0113] Step 2: Construction of recombinant vector for Spodoptera litura dsRNA

[0114] 1) Using the cDNA synthesized in step 1 as a template, PCR clone the Spodoptera litura SlTl-2 The cDNA sequence was obtained, the reaction system was as shown in Table 1, and the PCR reaction program was as shown in Table 2. PCR products were detected by electrophoresis on a 1% agarose gel using a DL2000 DNA marker, at 110 V for 30 min, and visualized using a DNA gel imager.

[0115] Table 1 PCR reaction system

[0116]

[0117] Table 2 PCR reaction procedure

[0118]

[0119] 2) DNA gel recovery

[0120] Cut the gel strip at the correct position and recover the DNA using the Gel-DNA Recovery Kit (Omega Bio-tek) for gel purification, following the instructions for the Omega Bio-tek Gel ExtracTlon Kit (Catalog No. D2500).

[0121] 3) Double enzyme digestion reaction

[0122] The L4440 plasmid was subjected to double enzyme digestion reaction. The double enzyme digestion reaction system was based on the method of Thermo Fisher Scientific, and the reaction system is shown in Table 3. The reaction solution was placed in a 37°C water bath for 3 hours.

[0123] Table 3 Double enzyme digestion reaction system

[0124]

[0125] 4) Ligation of target fragment and vector

[0126] The digested vectors were analyzed by agarose gel electrophoresis, with undigested plasmids used as controls. The digested vectors were gel-purified using a Gel-DNA recovery kit (Omega Bio-tek) according to the instructions for the Omega Bio-tek Gel ExtracTlon Kit (Catalog No. D2500).

[0127] The recovered vector and fragment were ligated at a molar ratio of 1:3 according to the instructions for Takara's T4 DNA Ligase (Catalog No. 2011A). The prepared reaction mixture was incubated at 16°C overnight.

[0128] 5) Transformation of ligation products

[0129] The above ligation product was added to Escherichia coli HT115 (DE3) competent cells, ice bath for 30 min; heat shock the above mixture at 42℃ for 90 s and quickly place on ice for 5 min; add 700 μL LB liquid medium, place in a shaker at 37℃, 200 rpm for 1 h; centrifuge (5000 rpm, 5 min), discard about 600 μL of the upper supernatant, resuspend the pellet, spread the bacterial suspension on an LB plate containing ampicillin (Amp) in a clean bench, and incubate inverted at 37℃ overnight; finally, send to a sequencing company for sequencing.

[0130] (3) Preparation of dsRNA

[0131] The sequenced L4440-dsRNA HT115 A single colony of (DE3) was inoculated into LB liquid medium (containing 50 μg / mL Amp and 12.5 μg / mL Tet), incubated on a shaker at 37°C for 15 h, and then inoculated into approximately 500 mL of fresh LB liquid medium (containing 50 μg / mL Amp and 12.5 μg / mL Tet, inoculum size 1:100). When OD600 reached 0.4, 0.1 mM / L isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to induce dsRNA expression.

[0132] Example 2 Bioassay of Spodoptera litura larvae

[0133] (1) Determination of the survival rate of Spodoptera litura larvae

[0134] The cells containing L4440-dsRNA HTI15After the expansion of the culture of (DE3) bacteria (prepared in Example 1), the cells were centrifuged at 5000 rpm for 10 min and then resuspended in 0.05 M PBS (pH 7.4) at a ratio of 20:1 (20× concentration). The concentration of the expressed dsRNA was approximately 0.5 μg / μL. 3 Artificial diet, the surface of which is covered with L4440-dsRNA expressing HT115 (DE3) bacterial suspension (ie ds SlTl-2 ) and dsGFP (control group), etc. Second-instar larvae were placed on artificial diets in each treatment group. For each treatment, 60 larvae were used. Each treatment was repeated three times. Fresh diet was replaced and bacterial solution was added every 24 hours. After 48 hours of continuous feeding, several whole larvae were collected from each group as a portion, and three replicates were performed. Larvae were placed in each treatment group and fed for 48 hours. Bt crude extract was added to the artificial diet (30μg Bt crude extract was added to 0.5cm 3 Artificial diet (the formula consisted of 100 g soybean flour, 80 g wheat germ, 26 g yeast powder, 8 g casein, 8 g vitamin C, 1 g choline chloride, 2 g sorbic acid, 0.2 g cholesterol, 0.2 g inositol, and 26 g agar powder, dissolved in 1000 mL ultrapure water) was used. Survival rates were calculated every 12 hours.

[0135] Sequence of dsGFP:

[0136] caagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccc tcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccagg agcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgact tcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccaacgtctatatcatggccgacaagcagaagaacggcatcaaggtg (seq ID NO:7).

[0137] The results are as follows Figure 2As shown, it shows that feeding ds SlTl-2 When the larvae were then fed Bt toxin, their mortality rate increased significantly.

[0138] (2) Spodoptera litura SlTl-2 Detection of gene RNAi silencing efficiency

[0139] The larvae of Spodoptera litura were treated according to the experimental procedure in (1), and 6 larvae of Spodoptera litura were collected from each group and fed with ds SlTl-2 Total RNA was extracted from the whole insects of Spodoptera litura after 48 hours of incubation with dsGFP and reverse transcribed into cDNA. qRT-PCR was used to detect the target genes ( SlTl-2 ) and the internal reference gene (RP49). Three biological replicates were set up for each group, with three nymphs in each biological replicate.

[0140] The specific process is as follows:

[0141] Step 1: Extraction and reverse transcription of total RNA from tissues were the same as in Example 1.

[0142] Step 2: Real-time quantitative PCR (qRT-PCR)

[0143] Designed on the NCBI website SlTl-2 Quantitative PCR primers for the RP49 gene of Spodoptera litura were synthesized by Beijing Qingke Company, using the RP49 gene of Spodoptera litura as an internal control. The primers used are listed in Table 4. Real-time fluorescence quantitative PCR (qRT-PCR) was performed using reverse-transcribed cDNA (diluted 5-fold) as a template and RP49 as an internal reference gene. The instrument program and system settings were based on the qRT-PCR instructions from Nanjing NoviZan. Three replicates were used for each sample. The quantification system is shown in Table 5. A two-step protocol was used for amplification curves, with the program settings shown in Table 6.

[0144] Table 4 Primer sequences

[0145]

[0146] Table 5 qRT-PCR reaction system

[0147]

[0148] Table 6 qRT-PCR reaction procedure

[0149]

[0150] Step 3: qRT-PCR data processing

[0151] The relative expression of target genes was calculated using the 2-ΔΔCt method, with RP49 as the internal reference. T-tests were used in GraphPadPrism 8 software to analyze the expression differences of target genes among different samples. p ≤ 0.05 is indicated by *, p ≤0.01 is indicated by **, p ≤ 0.001 is indicated by ***.

[0152] The results are as follows Figure 3 As shown, fed larvae expressing ds SlTl-2 coli 48 h later, SlTl-2 The expression level of the gene was significantly downregulated, indicating that feeding ds SlTl-2 Can be successfully knocked down SlTl-2 Gene expression ( Figure 3 ).

[0153] Example 3 Spodoptera litura SlTl-2 Effects of RNAi Silencing on Antimicrobial Peptide Genes

[0154] Antimicrobial peptides (AMPs) are a class of polypeptides with antimicrobial activity that are induced in vivo. Also known as host defense peptides, they are widely present in most organisms and protect the host from pathogens. They possess broad-spectrum antimicrobial and immunomodulatory activities against infectious bacteria (Gram-positive and Gram-negative), viruses, and fungi.

[0155] In this example, RNAi silencing SlTl-2 Gene expression and found SlTl-2 The knockdown of Cry toxins will accelerate the death of Spodoptera litura. SlTl-2 After measuring the expression level of the gene, the insects were treated with Cry1Ca toxin to detect the expression changes of antimicrobial peptide genes downstream of the immune pathway. SlTl-2 Total RNA was extracted from the whole insects of Spodoptera litura after 48 hours of treatment with dsGFP and reverse transcribed into cDNA. qRT-PCR was used to detect the antimicrobial peptide genes ( Acttacin, Cecropin, Gloverin, Lebocin and Virescein ) and the relative expression levels of the internal reference gene (RP49). The primer sequences are shown in Table 4. The detection process is the same as in Example 2.

[0156] The results are as follows Figure 4 As shown, knockdown SlTl-2 After the expression of the gene, Cry1Ca toxin induced Acttacin, Cecropin, Lebocin and Virescein The expression of four antimicrobial peptide genes was significantly inhibited, whileGloverin Although the expression of genes is significantly suppressed, there is a downward trend. This shows that SlTl-2 is involved in the response of Spodoptera litura to Cry1Ca, and [[ID=J2]]SlTl-2 Knockdown of Cry1Ca will reduce the expression of antimicrobial peptides in Spodoptera litura under Cry1Ca stress, thereby promoting the pest's sensitivity to toxins and achieving the effect of pest control.

[0157] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.

Claims

1. SlTl-2 Use of an inhibitor in promoting the sensitivity of pests to pesticides or in preparing a product promoting the sensitivity of pests to pesticides, wherein the inhibitor is SlTl-2 The nucleotide sequence is shown in SEQ ID NO: 1; The SlTl-2 inhibitor is at least one of (1) to (3): (1) dsRNA targeting SlTl-2; (2) a nucleic acid molecule encoding the dsRNA targeting SlTl-2 described in (1); (3) an expression cassette, vector or transgenic cell line comprising the nucleic acid molecule described in (2); The dsRNA is a double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID NO: 2 and the nucleotide sequence shown in its reverse complementary sequence; The pest is Spodoptera litura; The insecticide is Bt toxin or Cry1Ca toxin.

2. A dsRNA, which is a double-stranded RNA consisting of the nucleotide sequence shown in SEQ ID NO: 2 and the nucleotide sequence shown in its reverse complementary sequence.

3. A biological material related to the dsRNA according to claim 2, comprising any one of 1) to 12): 1) A nucleic acid molecule encoding the dsRNA according to claim 2; 2) an expression cassette comprising the nucleic acid molecule described in 1); 3) a vector comprising the nucleic acid molecule described in 1); 4) a vector comprising the expression cassette described in 2); 5) A transgenic cell line comprising the nucleic acid molecule described in 1); 6) a transgenic cell line comprising the expression cassette described in 2); 7) A transgenic cell line comprising the vector described in 3); 8) A transgenic cell line comprising the vector described in 4); 9) A recombinant microorganism containing the nucleic acid molecule described in 1); 10) a recombinant microorganism containing the expression cassette described in 2); 11) A recombinant microorganism containing the vector described in 3); 12) A recombinant microorganism containing the vector described in 4).

4. A product, characterized in that The product comprises the dsRNA of claim 2 and / or the biological material of claim 3.

5. The product according to claim 4, characterized in that The product is used for promoting the sensitivity of pests to insecticides. The pests are Spodoptera litura, and the insecticides are Bt toxins or Cry1Ca toxins.

6. Use of the dsRNA according to claim 2, the biomaterial according to claim 3, or the product according to claim 4 or 5 in promoting the sensitivity of pests to insecticides or in preparing products for promoting the sensitivity of pests to insecticides, wherein the pest is Spodoptera litura, and the insecticide is Bt toxin or Cry1Ca toxin.

7. A method for increasing the sensitivity of pests to pesticides, comprising: reducing SlTl-2 the step of increasing the expression level and / or activity of described SlTl-2 The nucleotide sequence is shown in SEQ ID NO: 1; The reduction of pests SlTl-2 The step of increasing the expression level and / or activity of the dsRNA according to claim 2, the biological material according to claim 3, or the product according to claim 4 or 5 is introduced into the body of the pest; The method of introduction is oral feeding; The pest is Spodoptera litura; The insecticide is Bt toxin or Cry1Ca toxin.

Citation Information

Patent Citations

  • Rnai approach for crop pest protection

    CN110914429A

  • Method for preventing and treating noctuidae agricultural pests and insecticide

    CN113615456A