Application and method of gene for regulating gamma-aminobutyric acid content in papaya

Abstract

The present invention provides an application and method of a gene for regulating the content of γ-aminobutyric acid in papaya, belonging to the field of biotechnology, wherein the application is to increase the content of GABA in papaya by inactivating the C-terminus of the GAD-like gene of papaya; the method is to plant a papaya strain with an inactivated C-terminus of the GAD-like gene to increase the content of GABA in papaya. The GAD-like gene disclosed in the present invention provides a new method for creating a new variety of papaya rich in GABA, and provides a research basis for the study of GABA synthesis and metabolic pathways in papaya.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, relates to plant transgenic biotechnology breeding, and particularly relates to an application and method of a gene for regulating the gamma-aminobutyric acid content of papaya. Background Art

[0002] papaya( Carica papaya L.) belongs to the dicotyledon class ( Dicotyledons ) Carica papaya Caricaceae ) Carica papaya ( Carica ), native to South America, is now widely distributed in tropical and subtropical areas of America, Asia, Africa and Oceania. It is known as the "three major tropical herbal fruit trees" together with bananas and pineapples. It is one of the important consumer products and exported tropical fruits in China and tropical areas around the world. Papaya has thick flesh, sweet and juicy, and rich in nutrients. It is rich in papain, amino acids, carotene, vitamins and trace elements, etc., and has important edible and medicinal value. Papain is helpful for chronic indigestion and gastritis, and papain has anti-tumor effects and has strong anti-cancer activity against lymphocytic leukemia cells. In recent years, with the improvement of people's living standards, the demand for the nutritional value and health value of papaya fruit has also increased. Therefore, it is necessary to create new papaya varieties with high nutritional or health value to meet the personalized needs of consumers who pursue health.

[0003] γ-aminobutyric acid (GABA) is a natural free-state four-carbon non-protein, functional amino acid, also known as amino acid and 4-aminobutyric acid. It is widely found in animals, plants and microorganisms. GABA was first discovered in potato tubers. As a metabolite and signal molecule, it responds to biological and non-biological stresses, maintains carbon-nitrogen balance to regulate plant growth and development. GABA is also an inhibitory transmitter in the mammalian nerve center, with important physiological functions, including regulating blood pressure, promoting sleep, increasing growth hormone secretion, and strengthening the liver and kidneys. GABA is not only a naturally occurring functional substance, but also a food-grade safe substance. In 2001, Japan included GABA in the food series; in 2008, the United States listed GABA as a recognized safe substance and allowed it to be added to food and beverages (1% to 4%); the Ministry of Health of China also listed GABA as a new resource food in 2009, allowing it to be added to beverages, cocoa products, chocolate and chocolate products, candy, baked goods, and puffed foods other than infant food. Therefore, as a new functional factor, GABA has broad application prospects in food, medicine, agriculture and other industries.

[0004] GABA is widely distributed in plants, but the content is low. The important enzyme for GABA synthesis in plants is glutamate decarboxylase (GAD), which catalyzes the α-decarboxylation reaction of glutamate to become GABA. The C-terminus of GAD in most plants has a calmodulin binding domain (CaMBD) composed of 30 to 50 amino acids. Under physiological cell conditions (pH 7.0), CaMBD also acts as an autoinhibitory domain, inhibiting the activity of GAD by folding its active site. Disrupting the activity of this domain can significantly increase the activity of GAD, thereby increasing the content of its downstream metabolite GABA.

[0005] In 2020, Sanatech Seed in Tokyo, Japan, launched the world's first high-GABA tomato, which has a GABA content 4 to 5 times that of ordinary tomatoes. This tomato uses genome editing technology to knock out the C-terminal CaMBD of tomato GAD, thereby increasing the activity of GAD and increasing the GABA content of tomatoes by 4 to 5 times. This tomato is currently sold on the market in Japan and is not regulated as a genetically modified product. The Bureau of Plant Industry of the Department of Agriculture of the Philippines also issued a certificate for this gene-edited tomato in May 2023 (JDC No. 01 s.2021), identifying the gene-edited tomato as a non-genetically modified crop (GMO).

[0006] Papaya is a tropical fruit widely loved by consumers. If the GABA content in its fruit can be increased, its added value such as nutrition and health care can be improved, which is of certain significance to the development of the papaya industry. At present, there are few studies on the genes related to the synthesis and metabolism of GABA in papaya, and there are no reports on the use of genetic modification technology to change the GABA content of papaya. Summary of the invention

[0007] In view of the above problems, the present invention provides an application and method of a gene for regulating the content of γ-aminobutyric acid in papaya.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is:

[0009] An application of a gene for regulating the content of gamma-aminobutyric acid in papaya, wherein the C-terminus of the papaya GAD-like gene is mutated to inactivate the C-terminus of the papaya GAD-like gene, thereby relieving or reducing its function of inhibiting the GAD enzyme, increasing the enzyme activity of GAD, and increasing the content of its downstream metabolite GABA, thereby increasing the gamma-aminobutyric acid content (i.e., GABA content) in papaya;

[0010] The gene accession number of the GAD-like gene is LOC110825384, and the gene sequence is shown in SEQ ID NO: 1. The gene is 2638 bp in length and contains 5 exons. The CDS coding region is 1176 bp long and encodes 391 amino acids. The amino acid sequence is shown in SEQ ID NO: 3. The 38 amino acids at the C-terminus are presumed autoinhibitory domains, and it is a glutamate decarboxylase-like protein.

[0011] Furthermore, the application is to inactivate the C-terminus of the papaya GAD-like gene using gene editing technology;

[0012] The gene editing site sequence in the GAD-like gene is shown in SEQ ID NO: 2.

[0013] Furthermore, the application is to transform the GAD-like gene, the papaya GAD-like gene editing recombinant vector containing the GAD-like gene, or the recombinant strain containing the GAD-like gene into papaya to inactivate the C-terminus of the papaya GAD-like gene;

[0014] The recombinant strain containing the GAD-like gene is the recombinant strain containing the GAD-like gene editing recombinant vector.

[0015] Furthermore, the application is to use CRISPR / Cas9 technology to construct a papaya GAD-like gene editing recombinant vector that inactivates the C-terminus of the GAD-like gene, and then use the papaya GAD-like gene editing recombinant vector to transform papaya to inactivate the C-terminus of the papaya GAD-like gene.

[0016] Furthermore, the papaya GAD-like gene editing recombinant vector selected three intermediate vectors pMOD_A0101, pMOD_B2301 and pMOD_C3001 of the sgRNA multiplex vector system, and a backbone vector pTRANS_220d, and finally constructed a papaya GAD-like gene editing recombinant vector containing one editing site.

[0017] Furthermore, the application comprises the following steps:

[0018] Construct papaya GAD-like gene editing recombinant vector;

[0019] A recombinant strain containing a GAD-like gene editing recombinant vector was constructed using the papaya GAD-like gene editing recombinant vector;

[0020] Papaya was transformed with a recombinant strain containing a GAD-like gene editing recombinant vector to inactivate the C-terminus of the papaya GAD-like gene.

[0021] Furthermore, the transformation is carried out by using the seedling stem segments of papaya Tainong No. 2 as explants to induce embryonic callus, and then using a recombinant strain containing a GAD-like gene editing recombinant vector for transformation, to obtain a transgenic papaya strain in which the C-terminus of the papaya GAD-like gene is inactivated;

[0022] Furthermore, the specific steps of the conversion are as follows:

[0023] 1) Induction of papaya embryonic callus

[0024] The callus induction medium contained 2.2 g / L MS dry powder, 70.0 g / L sucrose, 0.1 g / L inositol, 1 mL / L MS vitamin (1000x), 0.01 g / L 2,4-dichlorophenoxyacetic acid, and 4.0 g / L phytogels, with a pH of 5.8;

[0025] Papaya seeds were sterilized in sodium hypochlorite solution, rinsed with sterile water, and 3 Shake in the aqueous solution; discard the floating seeds, suspend the remaining seeds in sterile water, and stir at 32°C for about 5 days until the seed coat breaks; sow the germinated seeds on 1% (w / v) water agar and grow under cool white fluorescent light at 24-26°C; seedlings after about 2 weeks of growth can be used as explants, cut the hypocotyls of the seedlings into 2-3 mm long segments, and spread them on callus induction medium, and culture them in the dark at 27°C for 6-8 weeks until embryonic callus can be observed on the hypocotyl segments. Most hypocotyl segments will produce embryonic callus within 2 weeks, and then replace the new callus induction medium every 3 weeks to continue inducing embryonic callus for 3-4 months to obtain papaya embryonic callus;

[0026] 2) Preparation of Agrobacterium culture solution

[0027] LB medium contained 10.0 g / L peptone, 5.0 g / L yeast powder, and 10.0 g / L NaCl;

[0028] Take LB culture medium, add 50.0 μg carbenicillin and 50.0 μg kanamycin per ml to obtain LB plate containing carbenicillin and kanamycin;

[0029] The papaya infection solution contained 2.2 g / L of MS dry powder, 30.0 g / L of sucrose, 0.002 g / L of 2,4-dichlorophenoxyacetic acid, and 0.04 g / L of acetosyringone, with a pH value of 5.8;

[0030] Take out the recombinant bacteria containing the GAD-like gene editing recombinant vector, streak it on an LB plate containing carbenicillin and kanamycin, culture it in the dark at 28°C for 3 days, and isolate a single colony;

[0031] Pick 3 to 5 single colonies and place them in LB culture medium containing 50 μg / mL carbenicillin and 50 μg / mL kanamycin. Culture at 28°C with shaking until the OD value of the bacterial solution reaches 0. 600 The recombinant bacterial solution containing the GAD-like gene editing recombinant vector was centrifuged at 5000 rpm for 10 min, the culture medium was poured off, the bacterial cells were collected, and then the papaya infection solution was added, shaken, and the OD was adjusted. 600 is 0.6, and the 220d-GAD1 / AGL1 bacterial infection solution is obtained;

[0032] 3) Infection and co-culture

[0033] The papaya co-culture medium contained 2.2 g / L MS dry powder, 30.0 g / L sucrose, 0.002 g / L 2,4-dichlorophenoxyacetic acid, 0.04 g / L acetosyringone, and 4.0 g / L phytogels, with a pH value of 5.8;

[0034] The 220d-GAD1 / AGL1 bacterial infection solution was activated and cultured at 24°C and 150 rpm for 2-3 hours to obtain an activated bacterial solution;

[0035] Collect papaya embryonic callus into a 50 mL sterile centrifuge tube, add activated bacterial solution, and infect at 24°C and 150 rpm for 30 minutes. After infection, pour out the bacterial solution, pour the infected papaya callus into a sterile culture dish containing multiple layers of filter paper, spread out to dry the bacterial solution, and then transfer the dried papaya callus to a co-culture medium covered with a layer of sterile filter paper, seal it with a sealing film, and culture it in the dark at 24°C for 2 days to obtain the papaya callus after co-culture;

[0036] 4) Antibacterial and screening

[0037] The papaya screening medium contained 2.2 g / L MS dry powder, 70.0 g / L sucrose, 0.1 g / L inositol, 1 mL / L MS vitamin (1000x), 0.01 g / L 2,4-dichlorophenoxyacetic acid, 0.5 g / L timentin, 0.1 g / L kanamycin, and 4.0 g / L phytogels, with a pH of 5.8;

[0038] Transferring the co-cultivated papaya callus to a papaya screening medium, gently pushing the callus into the papaya screening medium, so that the co-cultivated papaya callus is in good contact with the screening agent in the papaya screening medium; culturing under light at 28°C, subculturing the co-cultivated papaya callus once every 3-4 weeks, and co-cultivating for 3 months to obtain resistant callus;

[0039] 5) Differentiation and rooting

[0040] The papaya differentiation medium contained 4.4 g / L MS dry powder, 30.0 g / L sucrose, 0.002 g / L 6-benzylaminopurine, 0.002 g / L naphthaleneacetic acid, 0.5 g / L timentin, 0.1 g / L kanamycin, and 4.0 g / L phytagel, with a pH of 5.8;

[0041] The papaya rooting medium contained 2.2 g / L MS dry powder, 20.0 g / L sucrose, 0.0005 g / L indolebutyric acid, 0.5 g / L timentin, 0.1 g / L kanamycin, and 4.0 g / L phytagel, with a pH of 5.8;

[0042] The resistant callus was transferred to papaya differentiation medium and cultured at 28°C with 12h / 12h light / dark conditions, and subcultured every 3-4 weeks until buds about 1 cm long were formed, which took about 2 months.

[0043] The buds were separated and transferred to papaya rooting medium for rooting. After one week of dark culture at 28°C, the rooted buds were transferred to vermiculite (50 mL Erlenmeyer flask) and 1 / 2 MS medium containing 0.0005 g / L indolebutyric acid was added. The culture was continued and rooting should be completed in about 1 month.

[0044] The obtained papaya plants with roots are transferred to pots and planted at room temperature to obtain papaya regenerated plants;

[0045] 6) PCR identification of regenerated plants

[0046] The papaya regenerated plants were subjected to gene testing to obtain transgenic papaya strains.

[0047] Furthermore, the recombinant strain adopts Agrobacterium, preferably Agrobacterium AGL1.

[0048] A method for regulating the content of gamma-aminobutyric acid in papaya, the method comprising planting a papaya strain in which the C-terminus of a GAD-like gene is inactivated to increase the content of gamma-aminobutyric acid (i.e., GABA content) in the papaya;

[0049] The gene sequence of the GAD-like gene is shown in SEQ ID NO:1.

[0050] Furthermore, the papaya strain with the C-terminus of the GAD-like gene inactivated is a transgenic papaya strain in which the C-terminus of the papaya GAD-like gene is inactivated by gene editing technology;

[0051] The gene editing site sequence in the GAD-like gene is shown in SEQ ID NO: 2.

[0052] The beneficial effects of the application and method of the gene for regulating the content of γ-aminobutyric acid in papaya of the present invention are:

[0053] The present invention finds that by mutating the C-terminus of the papaya GAD-like gene, the C-terminus of the papaya GAD-like gene is inactivated, the function of inhibiting the GAD enzyme can be released or reduced, the enzyme activity of GAD is increased, and the content of its downstream metabolite GABA is increased, thereby increasing the GABA content in the papaya, providing new insights into the GABA synthesis and metabolic pathways in the papaya, providing new gene resources for the development of papaya with high GABA content, helping to understand the mechanism of the GABA synthesis and metabolic pathways, and providing an effective target for increasing the GABA content of papaya, etc.

[0054] The invention constructs a papaya GAD-like gene editing recombinant vector, obtains a transgenic papaya strain in which the C-terminus of the papaya GAD-like gene is inactivated after genetic transformation, and the GABA content of the leaves thereof is significantly increased, indicating that the C-terminus of the gene can affect the GABA content in the papaya leaves, and has important application value in improving the GABA content of the papaya.

[0055] The GAD-like gene disclosed in the present invention provides a new method for creating a new papaya variety rich in GABA, and provides a research basis for studying the synthesis and metabolic pathways of GABA in papaya. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 It is the gene editing backbone vector pTRANS_220d in Example 1 of the present invention;

[0057] Figure 2 is the PCR identification result of the GAD-like gene-edited papaya regenerated plant in Example 2 of the present invention; wherein, M represents DL2000 Marker, the unit is bp, and the molecular weights are 2000, 1000, 750, 500, 250 and 100 from top to bottom; 1 to 7 represent the corresponding papaya regenerated plant 1 to papaya regenerated plant 7, respectively, K represents a blank control using sterile water, K- represents a negative control using wild-type papaya Tainong No. 2, and K+ represents a positive control using a GAD-like gene-edited recombinant plasmid;

[0058] Figure 3 is the PCR identification result of the GAD-like editing site of the positive regenerated plant of papaya in Example 3 of the present invention; wherein, M represents DL2000 Marker, the unit is bp, and the molecular weight from top to bottom is 2000, 1000, 750, 500, 250 and 100; 1, 3 to 7 represent the corresponding positive regenerated plant 1, positive regenerated plant 3 to positive regenerated plant 7 respectively; K represents a blank control using sterile water, and K- represents a wild type control using wild type papaya Tainong No. 2;

[0059] Figure 4 is the GABA content of the leaves of the positive regenerated plants of papaya in Example 4 of the present invention; wherein WT is the wild-type papaya Tainong No. 2, and plant 1, plant 3 to plant 7 represent the corresponding GAD-like gene-edited papaya positive regenerated plant 1, positive regenerated plant 3 to positive regenerated plant 7, respectively. DETAILED DESCRIPTION

[0060] The technical solutions in the embodiments of the present invention are described clearly and completely below. In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention can also be implemented in other ways different from those described herein, and those skilled in the art can make similar generalizations without violating the connotation of the present invention, so the present invention is not limited by the specific embodiments disclosed below. The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0061] In addition, if no specific techniques or conditions are specified in the specific examples disclosed below, the techniques or conditions described in the literature in this field (for example, refer to "Molecular Cloning Experiment Guide" written by Sambrook et al., translated by Huang Peitang et al., third edition, Science Press) or the product instructions are used. If the manufacturer of the reagents used is not specified, they are all conventional products that can be purchased.

[0062] Example 1 Construction of papaya GAD-like gene editing recombinant vector

[0063] The plant gene editing vector system used in the present invention is a sgRNA multiplex vector system specifically used for plant gene editing obtained from the Voytas Laboratory of the University of Minnesota. The present invention selects three intermediate vectors pMOD_A0101, pMOD_B2301 and pMOD_C3001 of the system, and a backbone vector pTRANS_220d (see Figure 1 ), and finally constructed a plant gene editing vector containing one editing site.

[0064] The specific construction method of the plant gene editing vector is as follows:

[0065] S1. The papaya GAD-like gene was selected. The NCBI gene accession number of the gene is LOC110825384. The gene sequence is shown in SEQ ID NO: 1. The gene is 2638 bp in length, contains 5 exons, and the CDS coding region is 1176 bp long, encoding 391 amino acids. The amino acid sequence is shown in SEQ ID NO: 3. The 38 amino acids at the C-terminus are the presumed autoinhibitory domain, which is a glutamate decarboxylase-like protein. The gene editing site sequence in the GAD-like gene is shown in SEQ ID NO: 2.

[0066] S2. Selection of gene editing targets and primer design. The approximately 200 bp nucleotide sequence at the C-terminus of the gene was analyzed on the gene editing target online design website (http: / / crispor.tefor.net / ). A suitable target was selected based on the target specificity, editing efficiency, off-target rate and location, and the selected target was located upstream of the presumed autoinhibitory domain. The selected target sgRNA1_GAD1 (AGCTTGGCGCTGATCTTGGC) was then input into the online primer design software Multi-gRNA Array Assembly-Primer Design and Map Construction (http: / / cfans-pmorrell.oit.umn.edu / CRISPR_Multiplex / assembly.php), the target vector (pMOD_B2301), promoter system (35S), restriction endonuclease (Esp3Ⅰ), and splicing system (tRNA-Gly) were selected, and the software automatically generated two pairs of primers, as shown in Table 1.

[0067] Table 1 Primers for gene editing targets

[0068]

[0069] Note: The lowercase bases are the target sgRNA1_GAD1 sequence.

[0070] S3. Using the intermediate vector pMOD_B2301 plasmid as a template, perform PCR amplification with the above two pairs of primers, and connect the two amplified fragments obtained by PCR with the pMOD_B2301 plasmid using double restriction enzymes SapⅠ and Esp3Ⅰ and T4 ligase to obtain a ligation product.

[0071] The ligation product was transformed into E. coli DH5α competent cells, and a single clone (i.e., the intermediate vector bacterial solution) was selected for bacterial solution PCR identification (primers for intermediate vector bacterial solution PCR identification are shown in Table 2) and sequencing verification. The verified single clone was used to extract the plasmid pMOD_B2301-GAD1.

[0072] The plasmid pMOD_B2301-GAD1 and the other two intermediate vectors pMOD_A0101 and pMOD_C3001 were digested with AarI and ligated with T4 ligase together with the plasmid of the backbone vector pTRANS_220d. The resulting ligation products were transformed into Escherichia coli DH5α competent cells, and a single clone (i.e., the backbone vector bacterial solution) was selected for bacterial solution PCR identification (the backbone vector bacterial solution PCR identification primers are shown in Table 2). The positive clones were screened and sent to a sequencing company for sequence determination. The positive clones with correct sequencing were saved, and the plasmid was extracted and named 220d-GAD1 plasmid (i.e., GAD-like gene editing recombinant plasmid, that is, papaya GAD-like gene editing recombinant vector). Then, it was transformed into Agrobacterium tumefaciens AGL1 by liquid nitrogen freeze-thaw method to obtain AGL1 bacteria containing the 220d-GAD1 plasmid, which was stored at -80°C with glycerol for later use.

[0073] Table 2 Primers for PCR identification of bacterial liquid

[0074]

[0075] Example 2 Transformation of papaya with recombinant gene editing vector

[0076] The seedling stem segments of papaya Tainong No. 2 were used as explants to induce embryonic callus and transform the recombinant gene editing vector strain, which specifically included the following steps:

[0077] 1) Induction of papaya embryonic callus

[0078] The callus induction medium contained 2.2 g / L MS dry powder, 70.0 g / L sucrose, 0.1 g / L inositol, 1 mL / L MS vitamin (1000x), 0.01 g / L 2,4-dichlorophenoxyacetic acid and 4.0 g / L plant gel, and the pH value was 5.8.

[0079] Papaya seeds were sterilized in 1.1% sodium hypochlorite solution for 1 h, rinsed with sterile water, and then heated in 50 mL of 1 M KNO 3Shake in the aqueous solution for 24 hours. Discard the floating seeds, suspend the remaining seeds in 100mL sterile water, and stir at 32°C for about 5 days until the seed coat breaks. Sow the germinated seeds on 1% (w / v) water agar and grow under cool white fluorescent light at 24~26°C. Seedlings that have grown for about 2 weeks can be used as explants. Cut the hypocotyls of the seedlings into 2~3 mm long segments and spread them on callus induction medium. Culture them in the dark at 27°C for 6~8 weeks until embryonic callus can be observed on the hypocotyl segments. Most hypocotyl segments will produce embryonic callus within 2 weeks. Then replace the new callus induction medium every 3 weeks to continue inducing embryonic callus for 3~4 months to obtain papaya embryonic callus.

[0080] 2) Preparation of Agrobacterium culture solution

[0081] LB medium contains 10.0 g / L peptone, 5.0 g / L yeast powder and 10.0 g / L NaCl.

[0082] Take LB culture medium, add 50.0 μg carbenicillin and 50.0 μg kanamycin per ml to obtain LB plates containing carbenicillin and kanamycin.

[0083] The papaya infection solution contained 2.2 g / L of MS dry powder, 30.0 g / L of sucrose, 0.002 g / L of 2,4-dichlorophenoxyacetic acid and 0.04 g / L of acetosyringone, with a pH value of 5.8.

[0084] The bacterial suspension of AGL1 bacteria containing the 220d-GAD1 plasmid stored at -80°C was taken out, streaked onto an LB plate containing carbenicillin and kanamycin, and cultured in the dark at 28°C for 3 days to isolate a single colony.

[0085] Pick 3 to 5 single colonies and place them in LB culture medium containing 50 μg / mL carbenicillin and 50 μg / mL kanamycin. Culture at 28°C with shaking until the OD value of the bacterial solution reaches 0. 600 The OD value was 0.6, and the obtained 220d GAD1 / AGL1 bacterial solution was centrifuged at 5000rpm for 10min, the culture medium was poured off, the bacterial cells were collected, and then the papaya infection solution was added, shaken, and the OD value was adjusted. 600 is 0.6, and 220d-GAD1 / AGL1 bacterial infection solution is obtained.

[0086] 3) Infection and co-culture

[0087] The papaya co-culture medium contained 2.2 g / L MS dry powder, 30.0 g / L sucrose, 0.002 g / L 2,4-dichlorophenoxyacetic acid, 0.04 g / L acetosyringone and 4.0 g / L plant gel, and the pH value was 5.8.

[0088] The 220d-GAD1 / AGL1 bacterial infection solution was activated and cultured at 24°C and 150 rpm for 2-3 hours to obtain an activated bacterial solution.

[0089] The papaya embryonic callus was collected into a 50 mL sterile centrifuge tube, and the activated bacterial solution was poured into it. The tube was gently shaken at 24°C and 150 rpm for infection for 30 minutes. After the infection, the bacterial solution was discarded, and the infected papaya callus was poured into a sterile culture dish containing multiple layers of filter paper. The bacterial solution was spread out to dry, and then the dried papaya callus was transferred to a co-culture medium covered with a layer of sterile filter paper, sealed with a sealing film, and cultured in the dark at 24°C for 2 days to obtain the papaya callus after the co-culture was completed.

[0090] 4) Antibacterial and screening

[0091] The papaya screening medium contains 2.2 g / L MS dry powder, 70.0 g / L sucrose, 0.1 g / L inositol, 1 mL / L MS vitamin (1000x), 0.01 g / L 2,4-dichlorophenoxyacetic acid, 0.5 g / L timentin, 0.1 g / L kanamycin and 4.0 g / L phytogels, with a pH value of 5.8.

[0092] The co-cultivated papaya callus was transferred to the papaya screening medium, and the callus was gently pushed into the papaya screening medium to make the co-cultivated papaya callus in good contact with the screening agent in the papaya screening medium. The co-cultivated papaya callus was cultured at 28°C under light, and the co-cultivated papaya callus was subcultured once every 3-4 weeks. The co-cultivated papaya callus was cultured for 3 months to obtain resistant callus.

[0093] 5) Differentiation and rooting

[0094] The papaya differentiation medium contains 4.4 g / L MS dry powder, 30.0 g / L sucrose, 0.002 g / L 6-benzylaminopurine, 0.002 g / L naphthaleneacetic acid, 0.5 g / L timentin, 0.1 g / L kanamycin and 4.0 g / L phytagel, and the pH value is 5.8.

[0095] The papaya rooting medium contains 2.2 g / L MS dry powder, 20.0 g / L sucrose, 0.0005 g / L indolebutyric acid, 0.5 g / L timentin, 0.1 g / L kanamycin and 4.0 g / L plant gel, and the pH value is 5.8.

[0096] The resistant callus was transferred to papaya differentiation medium, cultured at 28°C with 12h / 12h light / dark conditions, and subcultured every 3 to 4 weeks until buds about 1 cm long were formed. This process took about 2 months.

[0097] The separated shoots were transferred to papaya rooting medium for rooting. After one week of dark culture at 28°C, the rooted shoots were transferred to vermiculite (50mL Erlenmeyer flask) and 1 / 2MS medium containing 0.0005g / L indolebutyric acid was added. The culture was continued and rooting should be completed in about 1 month.

[0098] The obtained rooted papaya plants are transferred to pots and planted at room temperature to obtain papaya regenerated plants.

[0099] 6) PCR identification of regenerated plants

[0100] Leaves of seven papaya regenerated plants (i.e., samples 1-7) were collected, and their genomic DNA was extracted using the MEGA Plant Genomic DNA Rapid Extraction Kit (D3187-02). The extracted DNA was then used as a template to perform PCR detection of some sequences in the gene-edited final vector of the papaya regenerated plants. The genomic DNA of the wild-type papaya Tainong No. 2 was used as a negative control (marked as K-), sterile water was used as a blank control (marked as K), and the GAD-like gene-edited recombinant plasmid was used as a positive control (marked as K+). The detection primers are shown in Table 3. The enzyme used for PCR detection was Vazyme's 2 x Rapid Taq Master Mix, and the reaction system was: 8.5 μL of sterile water, 1 μL of each primer (10 μM), 12.5 μL of Taq Mix, and 2 μL of DNA template. The PCR amplification program was: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 45 s, and 35 cycles; and finally 72°C extension for 7 min. The PCR amplification products were separated and detected by 2% agarose gel electrophoresis. The electrophoresis diagram of the PCR detection products of the 7 papaya regeneration plants is shown in Figure 2 .

[0101] from Figure 2 It can be seen that except for sample 2, the other 6 samples can amplify a 965bp band, which is consistent with the positive control, while the negative control and blank control do not have this band, indicating that these 6 samples are positive regenerated plants. The 6 positive regenerated plants are sample 1 (i.e. plant 1), sample 3 to sample 7 (i.e. plant 3 to plant 7).

[0102] Table 3 Primers for positive detection of transgenic genes

[0103]

[0104] Example 3 Identification and analysis of mutations at the GAD editing site in positive regenerated plants

[0105] PCR identification primers GAD-F and GAD-R (sequences in Table 4) were designed near the upstream and downstream of the editing site. The GAD-like editing sites of the six positive regenerated plants were identified by PCR and sequencing. The wild-type papaya Tainong No. 2 was used as the wild-type control (marked as K-), and sterile water was used as the blank control (marked as K). The enzyme used in PCR was Vazyme's 2 x RapidTaq Master Mix. The PCR reaction system was: 6 μL of sterile water, 1 μL of each primer (10 μM), 10 μL of Taq Mix, and 2 μL of DNA template. The PCR amplification program was: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 57°C annealing for 30 s, 72°C extension for 30 s, and 35 cycles; finally 72°C extension for 7 min. The PCR amplification products were separated and detected by 2% agarose gel electrophoresis. The electrophoresis diagram of the PCR products of the GAD-like gene editing sites of the six positive regenerated plants is shown in Figure 3 .from Figure 3 It can be seen that these 6 positive regenerated plants and the wild-type control can amplify a 468bp band. The PCR product was sent to the company for sequencing. The editing effect was judged based on the sequencing peak graph and sequencing sequence, and the mutation of the editing site was obtained. If the sequencing peak graph is a single peak and the sequence is different from the wild-type sequence, it means that it is a homozygous mutation; if double peaks or multiple peaks appear in the sequencing peak graph starting from the editing site or its upstream, it means that the positive regenerated plant is a non-homozygous mutation, but the specific mutation form cannot be determined.

[0106] Since the literature reports that the non-homozygous mutation of the C-terminus of the tomato GAD gene can also change the GABA content, Hi-TOM sequencing was performed on papaya samples with non-homozygous mutations to clarify the mutation form of non-homozygous mutations. The specific method is: primers are designed near the upstream and downstream of the editing site, and Hi-TOM adapter primers are added to the 5' ends of the upstream and downstream primers respectively to obtain Hi-TOM sequencing primers Hi-GAD-F and Hi-GAD-R (sequences are shown in Table 4), and Barcode is added between the upstream adapter primer and the GAD-F primer. The primers are used to perform PCR reaction on the sample DNA of non-homozygous mutations (plants 4 to 7). The enzyme used for PCR is Vazyme's 2 x Rapid Tag Master Mix. The PCR reaction system is: 6μL of sterile water, 1μL of primers (10μM), 10μL of TaqMix, and 2μL of DNA template. The PCR amplification program was as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, 35 cycles; and finally 72°C extension for 7 min. The PCR amplification products were separated and detected by 2% agarose gel electrophoresis to confirm the presence of the target band and then sent to Beijing Qingke Biotechnology Co., Ltd. for Hi-TOM sequencing.

[0107] According to the sequence alignment results of homozygous mutations and Hi-TOM sequencing of non-homozygous mutations, the mutation forms of the editing sites of homozygous mutations and non-homozygous mutations and the amino acid sequences after mutation were analyzed, and the results are shown in Table 5. As can be seen from Table 5, the GAD editing sites of plants 1 and 3 are homozygous mutations, with a base missing (A), causing a frameshift mutation in the amino acid sequence of the GAD autoinhibitory domain. The GAD editing site of plant 4 is a biallelic mutation, in which one allele of GAD lacks a base (A), causing a frameshift mutation in the amino acid sequence of the GAD autoinhibitory domain; the other GAD allele lacks 3 bases (AAG), resulting in a loss of an amino acid (K) at the editing site of GAD, which does not affect the GAD autoinhibitory domain. The GAD editing sites of plants 5, 6 and 7 were all mosaic mutations, containing 3 to 5 different mutation forms, including 1 base deletion, 2 base deletions, 3 base deletions, 4 base deletions, 6 base deletions and 1 base insertion. Among them, the mutations of 3 base deletions and 6 base deletions did not affect the autoinhibitory domain of GAD, the mutations of 1 base deletion and 4 base deletions caused frameshift mutations in the amino acid sequence of the autoinhibitory domain of GAD, and the mutations of 2 base deletions and 1 base insertion caused GAD to terminate translation prematurely at the editing site.

[0108] Table 4 Primers for editing site identification

[0109]

[0110] Note: Adapter primers are in bold.

[0111] Table 5 Base site mutation results

[0112]

[0113] Note: WT is the wild-type control; "*" is the stop codon; the bolded sequence is consistent with the wild-type sequence; the bolded and underlined sequence is the putative autoinhibitory domain; the italicized sequence is the gene editing site; the sequence not bolded is the sequence that is inconsistent with the wild-type after editing mutation.

[0114] Example 4 Determination of GABA content in GAD-like gene-edited papaya leaves

[0115] 0.1 g of leaves were collected from GAD-like gene-edited papaya plants 1, 3, 4, 5, 6, 7 and wild-type papaya Tainong No. 2 (marked as WT), and after grinding with liquid nitrogen, the GABA content in the leaves of GAD-like gene-edited papaya plants and wild-type papaya Tainong No. 2 was determined using a GABA colorimetric test kit (Puint Bioengineering Co., Ltd.). Each sample was biologically replicated three times, and the measured data were analyzed by one-way ANOVA using DPS V15.10 software. Duncan's new multiple range method was used to detect significant differences and annotated. The measurement results are shown in Tables 6 and Figure 4 As shown, the GABA content in the leaves of GAD-like gene-edited papaya plants 1, 3, 4, 5, 6 and 7 was significantly higher than that of the wild-type papaya Tainong No. 2.

[0116] Table 6 GABA content in GAD-like gene-edited papaya

[0117]

[0118] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, rather than all the embodiments. A person skilled in the art can also obtain other embodiments based on the embodiments without inventiveness, and these embodiments all belong to the protection scope of the present invention.

Claims

1. An application of a gene for regulating the content of γ-aminobutyric acid in papaya, characterized in that: The application is to use gene editing technology to inactivate the C-terminus of the papaya GAD-like gene to increase the content of γ-aminobutyric acid in papaya; The gene sequence of the GAD-like gene is shown in SEQ ID NO: 1; The gene editing site sequence in the GAD-like gene is shown in SEQ ID NO:

2.

2. The use of the gene for regulating the content of γ-aminobutyric acid in papaya according to claim 1, characterized in that: The application is to transform the GAD-like gene, the papaya GAD-like gene editing recombinant vector containing the GAD-like gene, or the recombinant strain containing the GAD-like gene into papaya to inactivate the C-terminus of the papaya GAD-like gene.

3. The use of the gene for regulating the content of γ-aminobutyric acid in papaya according to claim 1, characterized in that: The application is to construct a papaya GAD-like gene editing recombinant vector that inactivates the C-terminus of the GAD-like gene, and then use the papaya GAD-like gene editing recombinant vector to transform the papaya to inactivate the C-terminus of the papaya GAD-like gene.

4. The use of the gene for regulating the content of γ-aminobutyric acid in papaya according to claim 3, characterized in that: The papaya GAD-like gene editing recombinant vector selected three intermediate vectors pMOD_A0101, pMOD_B2301 and pMOD_C3001 of the sgRNA multiplex vector system, and a backbone vector pTRANS_220d, and finally constructed a papaya GAD-like gene editing recombinant vector containing one editing site.

5. The use of the gene for regulating the content of γ-aminobutyric acid in papaya according to claim 1 or 4, characterized in that: The application comprises the following steps: Construct papaya GAD-like gene editing recombinant vector; A recombinant strain containing a GAD-like gene editing recombinant vector was constructed using the papaya GAD-like gene editing recombinant vector; Papaya was transformed with a recombinant strain containing a GAD-like gene editing recombinant vector to inactivate the C-terminus of the papaya GAD-like gene.

6. The use of the gene for regulating the content of γ-aminobutyric acid in papaya according to claim 5, characterized in that: The papaya transformation is carried out by using the seedling stem segments of papaya Tainong No. 2 as explants to induce embryonic callus, and then using a recombinant strain containing a GAD-like gene editing recombinant vector for transformation, so as to obtain a transgenic papaya strain in which the C-terminus of the papaya GAD-like gene is inactivated.

7. The use of the gene for regulating the content of γ-aminobutyric acid in papaya according to claim 5, characterized in that: The recombinant strain adopts Agrobacterium.

8. A method for regulating the content of γ-aminobutyric acid in papaya, characterized in that: The method comprises planting a papaya strain in which the C-terminus of the GAD-like gene is inactivated to increase the content of gamma-aminobutyric acid in the papaya; The gene sequence of the GAD-like gene is shown in SEQ ID NO: 1; The papaya strain with inactivated C-terminus of GAD-like gene is a transgenic papaya strain in which the C-terminus of GAD-like gene of papaya is inactivated by gene editing technology; The gene editing site sequence in the GAD-like gene is shown in SEQ ID NO: 2.

Images