Application of wheat metabolites in inducing the synthesis of mycotoxins from Fusarium graminearum

Abstract

The invention belongs to the field of bioengineering technology and discloses the application of wheat metabolites in inducing the synthesis of Fusarium graminearum fungal toxins. The wheat metabolite is theobromine. After theobromine is added to a liquid toxin-producing culture medium containing Fusarium graminearum spores, it can induce the synthesis of deoxynivalenol and 15-acetyldeoxynivalenol. The addition of theobromine can increase the fungal toxin production of Fusarium graminearum. TRI1 Gene, TRI5 Genes and TRI12 The expression of the gene induces the formation of differentiation-related cells and toxin-producing bodies of Fusarium graminearum, thereby promoting the synthesis of DON and 15-ADON. The present invention provides a low-cost inducer for the synthesis of DON and 15-ADON and the improvement of production efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering and relates to the application of wheat metabolites in inducing the synthesis of Fusarium graminearum fungal toxins. Background Art

[0002] Fusarium graminearum Fusarium graminearum ) is a fungal disease that causes wheat fusarium head blight. In addition to reducing wheat yields, it also produces fungal toxins such as deoxynivalenol (DON) during the pathogenic process, which accumulate in large quantities in infected wheat grains. DON, also known as "vomiting toxin", is a type B trichothecenes fungal toxin that has a strong vomiting ability in animals and humans. Wheat and wheat products contaminated by DON will produce poisoning symptoms such as dizziness, vomiting, anorexia, convulsions, and miscarriage when accidentally ingested by humans and animals. 15-AcetylDeoxynivalenol (15-ADON) is one of the acetylated forms of DON and is a fungal toxin that can pose a threat to human and animal health. The toxic effects of 15-ADON include hepatotoxicity, enterotoxicity, nephrotoxicity, and reproductive toxicity.

[0003] The preparation of DON and 15-ADON standards is of great significance to the research and detection of DON and 15-ADON. However, DON and 15-ADON have complex structures, need to rely on biosynthesis, and have high synthesis and preparation costs and are expensive. Finding inducers for the synthesis of DON and 15-ADON and using them for production is an effective way to improve production efficiency and reduce costs. Therefore, it is of great significance to explore an inducer that has an inducing effect on the synthesis of DON and 15-ADON and can improve production efficiency. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides the use of wheat metabolites in inducing the synthesis of Fusarium graminearum fungal toxins. The wheat metabolite is specifically theobromine. After theobromine is added to the liquid toxin-producing culture medium, it can induce the synthesis of deoxynivalenol and 15-acetyldeoxynivalenol of Fusarium graminearum. The present invention provides a low-cost inducer for the synthesis of DON and 15-ADON and the improvement of production efficiency.

[0005] To achieve the technical purpose of the present invention, on the one hand, the present invention provides the use of wheat metabolites in inducing the synthesis of Fusarium graminearum fungal toxins, wherein the wheat metabolite is theobromine, and its final concentration is 5mM; the Fusarium graminearum fungal toxins are deoxynivalenol and / or 15-acetyldeoxynivalenol.

[0006] Specifically, theobromine was added to the liquid toxin-producing culture medium containing Fusarium graminearum spores and cultured at 25°C in the dark for 7 days to promote the synthesis of Fusarium graminearum fungal toxins. Each 1L of liquid toxin-producing culture medium contains 0.3g of plant gel, 30g of sucrose, 1g of KH2PO4, 0.5g of MgSO4·7H2O, 0.5g of KCl, 10mg of FeSO4·7H2O, 871mg of arginine, and 20μL of trace elements, and the pH was adjusted to 5.4-5.6. Each 100mL of trace elements contains 5g of citric acid, 5g of ZnSO4·7H2O, 0.25g of CuSO4·5H2O, 50mg of MnSO4·H2O, 50mg of H3BO3, and 50mg of NaMoO4·2H2O. The final concentration of Fusarium graminearum spores is 1×10 4 Pieces / mL.

[0007] On the other hand, the present invention claims a method for inducing the synthesis of Fusarium graminearum fungal toxins, comprising: adding theobromine to a liquid toxin-producing culture medium containing Fusarium graminearum spores, culturing at 25°C in the dark for 7 days, wherein the final concentration of theobromine is 5 mM and the final concentration of Fusarium graminearum spores is 1×10 4 Pieces / mL.

[0008] Furthermore, in a method for inducing the synthesis of Fusarium graminearum toxin provided by the present invention, the Fusarium graminearum toxin is deoxynivalenol and / or 15-acetyldeoxynivalenol, and each 1L of liquid toxin-producing culture medium contains 0.3g of plant gel, 30g of sucrose, 1g of KH2PO4, 0.5g of MgSO4·7H2O, 0.5g of KCl, 10mg of FeSO4·7H2O, 871mg of arginine, and 20μL of trace elements, and the pH is adjusted to 5.4-5.6. Each 100mL of trace elements contains 5g of citric acid, 5g of ZnSO4·7H2O, 0.25g of CuSO4·5H2O, 50mg of MnSO4·H2O, 50mg of H3BO3, and 50mg of NaMoO4·2H2O.

[0009] On the other hand, the present invention claims the use of the above method for inducing the synthesis of Fusarium graminearum fungal toxins in increasing the yield of deoxynivalenol and / or 15-acetyldeoxynivalenol.

[0010] Furthermore, the present invention found that by exogenously adding 5 mM theobromine to the liquid toxin-producing culture medium, the contents of deoxynivalenol and 15-acetyldeoxynivalenol increased significantly compared with the control group, indicating that theobromine plays an inducing function in the synthesis of DON and 15-ADON.

[0011] On the other hand, the present invention claims the method of inducing the synthesis of Fusarium graminearum fungal toxins in promoting TRI Application in gene expression, TRI Genes include: TRI1 Gene, TRI5 Genes and TRI12 Gene.

[0012] Furthermore, the present invention found that after adding theobromine with a final concentration of 5 mM to the spore liquid of the wild-type strain PH-1 of Fusarium graminearum, TRI1 , TRI5 and TRI12 The relative expression levels of TRI Gene expression.

[0013] On the other hand, the present invention seeks to protect the use of the above-mentioned method of inducing the synthesis of Fusarium graminearum fungal toxins in promoting the differentiation of cells related to the toxin production of Fusarium graminearum.

[0014] Furthermore, the present invention observed the hyphae of Fusarium graminearum through a microscope and found that the hyphae morphology of Fusarium graminearum during the toxin production period changed after theobromine treatment, and the number of bubble-like structures increased, indicating that the addition of theobromine stimulated the differentiation of cells related to toxin production.

[0015] In addition, the present invention seeks to protect the use of the above-mentioned method of inducing the synthesis of Fusarium graminearum fungal toxins in inducing the formation of toxin-producing bodies of Fusarium graminearum.

[0016] Furthermore, the present invention observed the hyphae of Fusarium graminearum through fluorescence microscopy and found that compared with the control group, the number of toxin-producing bodies in the hyphae of Fusarium graminearum in the theobromine-treated group was significantly increased, indicating that theobromine treatment significantly induced the formation of toxin-producing bodies.

[0017] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0018] The present invention exogenously adds theobromine to a liquid toxin-producing culture medium containing Fusarium graminearum spores and finds that theobromine can induce the synthesis of deoxynivalenol and 15-acetyldeoxynivalenol of Fusarium graminearum. The present invention finds through quantitative PCR detection that the addition of theobromine can increase the TRI The relative expression of genes, specifically the addition of theobromine can increase the TRI1 Gene, TRI5 Genes and TRI12 The relative expression of genes, TRI1 , TRI5 and TRI12 The relative expression of theobromine increased by 3.5, 15.1 and 4.0 times respectively.Microscopic observation showed that theobromine can stimulate the formation of toxin-producing related cells and toxin-producing bodies of Fusarium graminearum.

[0019] The invention provides an inducer for the synthesis of deoxynivalenol and 15-acetyldeoxynivalenol, can promote DON and 15-ADON, and provides a low-cost inducer for preparing deoxynivalenol and 15-acetyldeoxynivalenol standard products. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a diagram showing the effect of theobromine on the synthesis of deoxynivalenol and 15-acetyldeoxynivalenol. Figure 1 A in the figure is the effect of theobromine on the content of deoxynivalenol and 15-acetyldeoxynivalenol; Figure 1 B in FIG. 1 is the characteristic ion chromatogram of deoxynivalenol and 15-acetyldeoxynivalenol.

[0021] Figure 2 Flowchart for the detection of theobromine as a wheat metabolite from the metabolomics of Fusarium graminearum-infected wheat.

[0022] Figure 3 Fusarium graminearum TRI Effect diagram of relative gene expression. Figure 3 A in TRI Schematic diagram of the gene cluster; Figure 3 B in the above is theobromine against Fusarium graminearum TRI Effect diagram of relative gene expression.

[0023] Figure 4 This is a diagram showing the effect of theobromine on the differentiation and formation of toxin-producing cells related to Fusarium graminearum.

[0024] Figure 5 The effect of theobromine on the formation of toxigenic bodies of Fusarium graminearum. DIC was observed under bright field conditions. DETAILED DESCRIPTION

[0025] The technical scheme of the present invention is now described in conjunction with the embodiments, but the present invention is not limited to the following embodiments. The experimental methods and detection methods described in the following embodiments are conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0026] Example 1

[0027] This example provides theobromine-induced synthesis of deoxynivalenol (DON) and 15-acetyldeoxynivalenol (15-ADON).

[0028] Toxigenic culture conditions: The wild-type strain of Fusarium graminearum PH-1 (universal Fusarium graminearum strain, preserved in this laboratory) was activated in a culture dish containing PDA medium (purchased from Beijing Aoboxing Biotechnology Co., Ltd.) and cultured in the dark in a constant temperature incubator at 25°C for 3 days. The bacterial block was crushed and placed in CMC liquid medium, and cultured in a shaker at a speed of 175rpm and a temperature of 25°C for 3d. After centrifugation at 3500rpm for 8min, the supernatant was discarded, the spores were collected, and the spores were diluted with sterile water to form spore liquid. Under sterile conditions, 2mL of liquid toxigenic medium was added to a 24-well plate. 1L of CMC liquid medium contains 1g yeast extract (purchased from OXOID), 1g NH4NO3 (purchased from Shanghai Chemical Reagent Factory), 1g KH2PO4 (purchased from Guangdong Guanghua Technology Co., Ltd.), 0.5g MgSO4·7H2O (purchased from Guangdong Guanghua Technology Co., Ltd.), and 15g Carboxymethylcellulose (purchased from Aladdin Biochemical Technology Co., Ltd.). 1 liter of liquid toxin-producing medium contains 0.3g of plant gel, 30g of sucrose, 1g of KH2PO4, 0.5g of MgSO4·7H2O, 0.5g of KCl, 10mg of FeSO4·7H2O, 871mg of arginine, 20μL of trace elements, and the pH is adjusted to 5.4-5.6. Each 100mL of trace elements contains 5g of citric acid, 5g of ZnSO4·7H2O, 0.25g of CuSO4·5H2O, 50mg of MnSO4·H2O, 50mg of H3BO3, and 50mg of NaMoO4·2H2O. All reagents used in the liquid toxin-producing medium are purchased from Sigma.

[0029] Theobromine (purchased from Aladdin Biochemical Technology Co., Ltd.) was dissolved in 6% concentrated hydrochloric acid, and the stock solution concentration was 150 mg / mL. Theobromine was added to the treatment group at a final concentration of 5 mM, and 6% concentrated hydrochloric acid was added to the control group. The pH was adjusted to 5.5, and a final concentration of 1×10 4 The spore liquid of each well was prepared by wrapping the 24-well plate with tin foil, and placed it in a constant temperature incubator at 25°C away from light for 7 days. Then, the bacterial film on the surface of the culture medium in the 24-well plate was quickly placed in liquid nitrogen, freeze-dried for 24 hours and weighed.

[0030] DON toxin extraction: Take 400μL of liquid toxin-producing culture medium after 7 days of culture, add 1600μL of methanol and mix well to obtain an extract, and pass the extract through a C18 SPE solid phase extraction column. Take 800μL of the filtrate, vacuum concentrate and evaporate to dryness, add 50μL of silanization reagent (the volume ratio of trimethylsilyl imidazole to trimethylchlorosilane is 100:1), vortex thoroughly to mix the silanization reagent and the sample thoroughly, and oscillate on an oscillator for 10 minutes. Add 800μL of isooctane, slightly turn upside down to mix thoroughly, then add 800μL of ultrapure water, slightly turn upside down and let stand to separate, and transfer the supernatant to the injection bottle.

[0031] GC-MS detection:

[0032] Chromatographic conditions: Rxi-5MS column (30m×0.25mm×0.25μm); split ratio 50:1; injection port temperature 260℃; carrier gas is helium, flow rate 1mL / min; programmed temperature: initial column temperature 150℃, hold for 1min, increase to 280℃ at 30℃ / min, and hold for 15min.

[0033] Mass spectrometry conditions: mass spectrometer interface temperature 280℃; ion source temperature 250℃; injection volume 1μL; in SIM mode, use m / z 295, 235 and 193 to qualitatively analyze DON, and use m / z 235 to quantitatively analyze DON; use m / z 392, 235 and 193 to qualitatively analyze 15-ADON, and m / z 193 to quantitatively analyze 15-ADON; mass spectrometry acquisition time 5~10min. Effects of theobromine on the synthesis of DON and 15-ADON Figure 1 As shown in A; the characteristic ion chromatograms of DON and 15-ADON produced in the control group are shown in Figure 1 As shown in B. Figure 1 It can be seen that after adding theobromine, the content of mycotoxins deoxynivalenol and 15-acetyldeoxynivalenol synthesized by Fusarium graminearum increased significantly compared with the control group, indicating that theobromine plays an inducing function in the synthesis of DON and 15-ADON.

[0034] Example 2

[0035] This example provides metabolomics data of wheat infected with Fusarium graminearum, and theobromine is detected as a metabolite of wheat.

[0036] Wheat inoculation: Plant the wheat variety Norm (a general wheat variety, preserved in this laboratory) in a plastic pot (20cm×17cm) and culture it in a culture room with a temperature of 25°C, a humidity of 70%, and a light cycle of dark / light (12h / 12h). Activate the wild-type strain PH-1 of Fusarium graminearum in a culture dish containing PDA medium and culture it in the dark in a constant temperature incubator at 25°C for 3 days. Crush the bacterial block and place it in CMC liquid culture medium. Shake it in a shaker at a speed of 175rpm and a temperature of 25°C for 3 days. Filter the CMC liquid culture medium with a filter cloth, and centrifuge the filtrate at 3500rpm for 8min. Collect the spores and adjust the spore concentration to 2×10 5 / mL, 10μL of the adjusted spore solution was inoculated between the inner and outer spores of wheat ears at the flowering stage, and the inoculated wheat ears were sprayed with water and then bagged for moisture retention. The control group was inoculated with 10μL of sterile water. After 24 hours, the wheat ears were cut off, quickly frozen in liquid nitrogen, and stored in a -80℃ refrigerator.

[0037] Compound extraction from inoculated wheat spikes: The wheat spikes inoculated with wild-type Fusarium graminearum strain PH-1 spores and water were freeze-dried in vacuum and ground into powder using a grinder. 100 mg of wheat spike powder was weighed into a 2 mL centrifuge tube, 600 μL of methanol was added, and the mixture was placed in a 4 °C refrigerator overnight, vortexed 6 times during the period. After centrifugation at 10000 g for 10 min, the supernatant was filtered through a 0.22 μm microporous filter into a sample injection bottle and loaded for UPLC-MS / MS analysis.

[0038] UPLC-MS / MS detection of compounds inoculated wheat spikes: The chromatographic column was a Waters C18 column (ACQUITY UPLCHSS T3, 1.8µm×2.1mm×100mm); the mobile phases were A mobile phase (0.04% acetic acid in water) and B mobile phase (0.04% acetic acid in acetonitrile), the initial proportion of B mobile phase was 5%, increased to 95% at 10min and maintained for 1min, and decreased to 5% at 11-11.1min and balanced to 14min; the flow rate was 0.35mL / min, the column temperature was 40℃, and the injection volume was 4μL. The temperature of the electrospray ion source (ESI) was 550℃ and the voltage was 5500V. According to the secondary mass spectrometry information of the detected compounds and the database MWDB constructed by Wuhan Maiwei Metabolic Biotechnology Co., Ltd., a total of 733 compounds were detected, among which theobromine was detected as a metabolite of wheat. The flow chart of the detection of theobromine as a metabolite of wheat from the metabolomics of wheat infected with Fusarium graminearum is shown in Figure 2. Figure 2 shown.

[0039] Example 3

[0040] This example provides the effect of theobromine on Fusarium graminearum TRI Effects on gene expression.

[0041] exist TRI In genes, TRI5 Encodes the first step in the synthesis of DON toxin. TRI1 The encoded protein is localized to the toxin-producing body. TRI12 The encoded transporter protein is involved in the transport process of DON toxin.

[0042] Add 50 mL of liquid toxin-producing medium to a conical flask and add spores of wild-type Fusarium graminearum strain PH-1 to a final spore concentration of 1 × 10 4 / mL. Theobromine was dissolved in 6% concentrated hydrochloric acid, and the concentration of the mother liquor was 150mg / mL. Theobromine was added to the treatment group with a final concentration of 5mM, and 6% concentrated hydrochloric acid was added to the control group, and the pH was adjusted to 5.5. Incubate in the dark at 30℃ and 90r / min for 3 days, collect the mycelium and quickly freeze it in liquid nitrogen. Extract mycelial RNA and measure and record the OD value, followed by DNA digestion and RNA reverse transcription. Design TRI Quantitative PCR was performed using quantitative primers for the gene and the internal reference gene (actin encoding gene) (Table 1), and the data were subsequently analyzed and processed. The results are shown in Figure 3 As shown in B, TRI A schematic diagram of the gene cluster is shown in Figure 3 As shown in A.

[0043] Table 1: Reference genes actin and TRI Gene-specific primers

[0044]

[0045] Depend on Figure 3 It can be seen that TRI1 , TRI5 and TRI12 The relative expression levels of TRI Gene expression.

[0046] Example 4

[0047] This example provides the effect of theobromine on the differentiation and formation of toxin-producing cells associated with Fusarium graminearum.

[0048] Add 50 mL of liquid toxin-producing medium to a conical flask and add spores of wild-type Fusarium graminearum strain PH-1 to a final spore concentration of 1 × 10 4Theobromine was dissolved in 6% concentrated hydrochloric acid, and the concentration of the mother solution was 150 mg / mL. Theobromine was added to the treatment group with a final concentration of 5 mM, and 6% concentrated hydrochloric acid was added to the control group, and the pH was adjusted to 5.5. The culture was shaken in the dark at 30°C and 90 r / min for 3 days. The mycelium was picked and rinsed with sterile water, and the differentiation of toxin-producing related cells was observed under a microscope. The results are as follows Figure 4 shown.

[0049] Compared with the vegetative growth period, Fusarium graminearum undergoes stage-specific cell differentiation during toxin production, which is manifested by the formation of a large number of vesicular structures, which are related to the synthesis of DON toxin. Figure 4 It can be seen that after theobromine treatment, the mycelial morphology of Fusarium graminearum during the toxin production period changed, and the number of bubble-like structures increased, indicating that the addition of theobromine stimulated the differentiation of toxin-related cells.

[0050] Example 5

[0051] This example provides the effect of theobromine on the formation of toxigenic bodies of Fusarium graminearum.

[0052] Toxigenic bodies are considered to be the site of toxin synthesis. Tri1 protein is located on toxigenic bodies and was selected as a marker protein for toxigenic bodies to indicate the formation and dynamic changes of toxigenic bodies. PCR amplification was performed using primers TRI1-GFP-F (5'AGGGAACAAAAGCTGGGTACCGCTATACTCGGCAGTCCTTTGC 3') and TRI1-GFP-R (5'GAACAGCTCCTCGCCCTTGCTCACGGCGTCATTTGGGCTTGAGATAG 3') to amplify the gene of Fusarium graminearum. TRI1 The full-length coding sequence. The pKNTG plasmid was cut with KpnI / HindIII, and the TRI1-GFP fragment was transferred into the cut pKNTG plasmid. PCR verification was performed using pKNTGseq / F (5' CCCCAGGCTTTACACTTTATGCT 3') and TRI1-GFP-R primers, and the plasmid was sent to the company for sequencing. After confirming that there was no mutation, it was introduced into the protoplasm of the wild-type strain PH-1 of Fusarium graminearum (made in the laboratory). PCR detection obtained the TRI1 -GFP transformed strain. TRI1 -GFP transformed strains were cultured in CMC liquid medium for 3 days (25°C, 200 rpm), filtered through filter cloth and centrifuged, and the supernatant was discarded. 50 mL of liquid toxin-producing medium was added to the conical flask. TRI1 -GFP strain spore solution to make the final spore concentration be 1×10 4Theobromine was dissolved in 6% concentrated hydrochloric acid, and the concentration of the stock solution was 150 mg / mL. Theobromine was added to the treatment group with a final concentration of 5 mM, and 6% concentrated hydrochloric acid was added to the control group, and the pH was adjusted to 5.5. The mycelium was picked up and rinsed with sterile water, and the formation of toxin-producing bodies was observed under a fluorescence microscope. The results are as follows Figure 5 shown.

[0053] Depend on Figure 5 It can be seen that compared with the control group, the number of toxin-producing bodies in the hyphae of Fusarium graminearum in the theobromine-treated group increased significantly, indicating that theobromine treatment significantly induced the formation of toxin-producing bodies.

[0054] As described above, the basic principle, main features and advantages of the present invention are well described. The above embodiments and descriptions are only descriptions of the preferred embodiments of the present invention, and the present invention is not limited by the above embodiments. Without departing from the spirit and scope of the present invention, various changes and improvements made by ordinary technicians in this field to the technical solution of the present invention should fall within the protection scope determined by the present invention.

Claims

1. The use of wheat metabolites in inducing the synthesis of Fusarium graminearum fungal toxins, characterized in that: The wheat metabolite is theobromine, and the Fusarium graminearum fungal toxins are deoxynivalenol and 15-acetyldeoxynivalenol; The final concentration of the wheat metabolite was 5 mM; The wheat metabolites promote TRI Gene expression; TRI The genes are: TRI1 Gene, TRI5 Genes and TRI12 Gene; The wheat metabolites induce the formation of toxigenic bodies of Fusarium graminearum.

2. The use according to claim 1, characterized in that: The wheat metabolites are added to a liquid toxin-producing culture medium containing Fusarium graminearum spores, and cultured at 25° C. in the dark for 7 days; Each 1L of the liquid toxin-producing culture medium contains 0.3g of plant gel, 30g of sucrose, 1g of KH2PO4, 0.5g of MgSO4·7H2O, 0.5g of KCl, 10mg of FeSO4·7H2O, 871mg of arginine, and 20μL of trace elements, and the pH is adjusted to 5.4-5.6; Every 100 mL of the trace elements contains 5 g of citric acid, 5 g of ZnSO4·7H2O, 0.25 g of CuSO4·5H2O, 50 mg of MnSO4·H2O, 50 mg of H3BO3, and 50 mg of NaMoO4·2H2O.

3. The use according to claim 2, characterized in that: The final concentration of the Fusarium graminearum spores was 1×10 4 Pieces / mL.

4. A method for inducing the synthesis of Fusarium graminearum fungal toxins, characterized in that: include: Theobromine was added to a liquid toxin-producing culture medium containing Fusarium graminearum spores, and cultured at 25° C. in the dark for 7 days, wherein the final concentration of theobromine was 5 mM; The Fusarium graminearum fungal toxins are deoxynivalenol and 15-acetyldeoxynivalenol.

5. The method for inducing the synthesis of Fusarium graminearum fungal toxin according to claim 4, characterized in that: The final concentration of the Fusarium graminearum spores was 1×10 4 Pieces / mL; Each 1L of the liquid toxin-producing culture medium contains 0.3g of plant gel, 30g of sucrose, 1g of KH2PO4, 0.5g of MgSO4·7H2O, 0.5g of KCl, 10mg of FeSO4·7H2O, 871mg of arginine, and 20μL of trace elements, and the pH is adjusted to 5.4-5.6; Every 100 mL of the trace elements contains 5 g of citric acid, 5 g of ZnSO4·7H2O, 0.25 g of CuSO4·5H2O, 50 mg of MnSO4·H2O, 50 mg of H3BO3, and 50 mg of NaMoO4·2H2O.

6. Use of the method for inducing the synthesis of Fusarium graminearum toxin according to any one of claims 4 to 5 in increasing the yield of deoxynivalenol and 15-acetyldeoxynivalenol.

7. The method for inducing the synthesis of Fusarium graminearum toxin according to any one of claims 4 to 5 is to promote TRI The invention relates to a method for the treatment of a gene expression problem, wherein the method comprises: Said TRI The genes are: TRI1 Gene, TRI5 Genes and TRI12 Gene.

8. Use of the method for inducing the synthesis of Fusarium graminearum fungal toxins according to any one of claims 4 to 5 in inducing the formation of toxin-producing bodies of Fusarium graminearum.

Images