Application of an SNP genetic marker affecting chicken shank circumference in chicken genetic breeding

By using the SNP genetic marker SC_tag4 in chicken genetic breeding for early selection of tibial traits, the problem of osteoporosis in mild and high-yield laying hens was solved, and the effect of improving tibial circumference and reducing the risk of osteoporosis was achieved.

CN119082317BActive Publication Date: 2025-06-13JIANGSU INST OF POULTRY SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411372130.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-29
Publication Date
2025-06-13
Estimated Expiration
2044-09-29

AI Technical Summary

Technical Problem

Light and high-yield laying hens are prone to osteoporosis, resulting in fractures, reduced egg laying performance and animal welfare problems. The existing technology is difficult to effectively improve the tibial circumference of laying hens to reduce the risk of osteoporosis.

Method used

The genetic marker of SNP SC_tag4 was used for genotype detection, and the tibial trait was improved through early selection methods, thereby genetically improving the tibial circumference of laying hens for 40 weeks.

Benefits of technology

By increasing the tibial circumference, reducing the frequency of osteoporosis, obtaining a laying hen with stronger legs and better uniformity in the body ruler, and improving the quality of the laying hen.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119082317B_ABST
    Figure CN119082317B_ABST
Patent Text Reader

Abstract

The present invention provides an application of an SNP genetic marker affecting the shank circumference of chickens in chicken genetic breeding, belonging to the fields of chicken genetic breeding and biotechnology. The SNP genetic marker affecting the shank circumference of chickens includes SC_tag4, and the SC_tag4 corresponds to the physical position of the 75,909,527th site on chromosome 4 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, belonging to the 8th intron sequence of the gene LDB2, where the base is T or C. This SNP genetic marker helps to genetically improve the shank circumference. Applying it to chicken genetic breeding is beneficial to improving the shank circumference of laying hens and reducing the incidence frequency of osteoporosis, thereby obtaining high-quality laying hen breeds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the fields of chicken genetic breeding and biotechnology, and particularly relates to the application of an SNP genetic marker affecting chicken shank circumference in chicken genetic breeding. Background Art

[0002] Shank circumference is a commonly used index in the breeding of laying hens, which can be used to evaluate bone development and measure body size uniformity. Bone is the main source of calcium for eggshells. According to the statistics of Muir et al., the calcium deposited in the eggshell by a commercial laying hen during its lifetime is approximately equal to its body weight. Light laying hens, including Leghorns and green-shelled laying hens, often face the problem of osteoporosis near the end of the laying period, mainly because the dynamic balance between structural bone and medullary bone is lost, resulting in the loss of integrity of the structural bone. The harm of osteoporosis to laying hens' production is mainly reflected in three aspects: one is that it causes fractures, paralysis and even death of laying hens; the second is the decline in egg production performance; the third is the animal welfare problems caused by fractures and long-term illnesses. In order to reduce the harm of osteoporosis to light high-yield laying hens, it is necessary to improve the bone quality of laying hens, including the selection of shank circumference. The shank circumference trait is regulated by minor polygenes, and it is difficult to make effective progress genetically by conventional breeding methods. Only by clarifying the genetic structure of shank circumference and improving the breeding accuracy through genomic selection can the purpose of genetically increasing the shank circumference size be achieved. Summary of the Invention

[0003] In order to meet the needs of the laying hen industry to reduce the harm of osteoporosis and breed the shank circumference trait, the present invention provides the application of an SNP genetic marker affecting chicken shank circumference in chicken genetic breeding. The SNP genetic marker affecting chicken shank circumference includes SC_tag4. This SNP genetic marker helps to genetically increase the shank circumference. Applying it to chicken genetic breeding is beneficial to improving the shank circumference of laying hens and reducing the incidence of osteoporosis, thereby obtaining high-quality laying hen breeds.

[0004] The present invention is achieved through the following technical solutions:

[0005] The present invention provides the application of an SNP genetic marker affecting chicken shank circumference in chicken genetic breeding. The SNP genetic marker affecting chicken shank circumference includes SC_tag4. The SC_tag4 corresponds to the physical position of the 4th chromosome at the 75,909,527th position in the sequence information of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version published in NCBI, and belongs to the 8th intron sequence of the gene LDB2, where the base is T or C.

[0006] Based on the same inventive concept, the present invention provides an early selection method for chicken shank circumference traits. The early selection method includes early selection of chicken shank circumference traits based on the genotype of the SNP genetic marker SC_tag4;

[0007] The SC_tag4 corresponds to the physical position at the 75909527th site on chromosome 4 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, belonging to the 8th intron sequence of the gene LDB2, and the base here is T or C.

[0008] Further, the early selection method specifically includes:

[0009] Detect the genotype of the SC_tag4 genetic marker in the genome of the chicken to be tested;

[0010] Based on the genotype of the SC_tag4, perform early selection on the shank circumference trait of the chicken to be tested;

[0011] Among them, the shank circumference of the individuals with the TT genotype of the SC_tag4 is greater than that of the individuals with the CC and CT genotypes.

[0012] Further, the detection of the genotype of the SC_tag4 genetic marker in the genome of the chicken to be tested specifically includes:

[0013] Using Pr_sc4f and Pr_sc4r as primers, perform PCR amplification on the genomic DNA of the chicken to be tested;

[0014] Sequence the PCR amplification product to obtain the genotype at the 75909527th site on the sense strand of chromosome 4 of the chicken to be tested;

[0015] Among them, the nucleotide sequence of Pr_sc4f is as shown in SEQ ID NO.1, and the nucleotide sequence of Pr_sc4r is as shown in SEQ ID NO.2.

[0016] Preferably, the breeds of the chickens to be tested include Dongxiang Green-shelled Layer and / or White Leghorn.

[0017] Based on the same inventive concept, the present invention provides primers for detecting the SNP genetic marker SC_tag4. The SC_tag4 corresponds to the physical position at the 75909527th site on chromosome 4 of the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, belonging to the 8th intron sequence of the gene LDB2, and the base here is T or C;

[0018] The primers include Pr_sc4f and Pr_sc4r. The nucleotide sequence of Pr_sc4f is as shown in SEQ ID NO.1, and the nucleotide sequence of Pr_sc4r is as shown in SEQ ID NO.2.

[0019] Based on the same inventive concept, the present invention provides the application of primers for detecting the SNP genetic marker SC_tag4 in chicken genetic breeding.

[0020] Based on the same inventive concept, the present invention provides a kit for detecting the SNP genetic marker SC_tag4, and the kit contains the above primers for detecting the SNP genetic marker SC_tag4.

[0021] Based on the same inventive concept, the present invention provides the application of the kit for detecting the SNP genetic marker SC_tag4 in chicken genetic breeding.

[0022] Based on the same inventive concept, the present invention also provides the application of the SNP genetic marker SC_tag4 in predicting the shank circumference of chickens at 40 weeks of age. The SC_tag4 corresponds to the physical position of the 4th chromosome at the 75,909,527th position in the chicken reference genome bGalGal1.mat.broiler.GRCg7b version sequence information published in NCBI, belongs to the 8th intron sequence of the gene LDB2, and the base here is T or C.

[0023] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0024] The present invention relates to the application of an SNP genetic marker affecting the shank circumference of chickens in chicken genetic breeding. The SNP genetic marker affecting the shank circumference of chickens includes SC_tag4. The shank circumference of individuals with the beneficial genotype (TT) of SC_tag4 is higher. Applying it to chicken genetic breeding helps to genetically improve the shank circumference of laying hens at 40 weeks of age, and then obtain laying hens with stronger legs and better body size uniformity, which is beneficial to reducing the incidence of osteoporosis, and thus obtain high-quality laying hen breeds. Description of the Drawings

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0026] Figure 1 It is the Manhattan plot of the GWAS analysis of the shank circumference of the resource population in Example 2 of the present invention;

[0027] Figure 2 It is the QQ plot of the GWAS analysis of the shank circumference of the resource population in Example 2 of the present invention;

[0028] Figure 3 It is the box plot of the shank circumference of individuals with different genotypes in Example 3 of the present invention, and the average shank circumference is used to replace the median in the figure. Detailed Embodiments

[0029] The present invention will be specifically described below in combination with specific embodiments and examples, and the advantages and various effects of the present invention will be presented more clearly therefrom. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the present invention, rather than to limit the present invention.

[0030] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as the general understanding of those skilled in the art to which the present invention pertains. In case of any contradiction, this specification shall prevail.

[0031] Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchases or can be prepared by existing methods.

[0032] The following will specifically describe the application of a SNP genetic marker affecting chicken shank circumference in chicken genetic breeding of the present application in combination with examples and experimental data.

[0033] Example 1

[0034] Construction of Resource Population

[0035] According to F 2 Design and construct a laying hen resource population. Using Dongxiang green-shell laying hens and White Leghorns as parents respectively, the F 1 generation is obtained through reciprocal crosses, and then the F 1 is used as the parent to breed the F 2 generation. The experimental chickens are individually marked with wing numbers and raised in single cages in a fully enclosed chicken house. During the laying period, artificial supplementary lighting is provided for 16 hours, and the temperature is reduced by fans and wet curtains. Routine immunization is carried out according to the immunization program formulated by the Jiangsu Institute of Poultry Sciences. The feed comes from COFCO. The feed components for laying hens include 16.5% crude protein and 11511 kJ / kg feed metabolic energy. During the laying period, the chickens are allowed to eat freely, supplied with water through nipple drinkers, fed with a traveling feeder, and the chicken manure is removed by a chicken manure conveyor belt. The shank circumference, that is, the circumference in the middle of the shank, is measured at 40 weeks of age.

[0036] The shank circumference data is preliminarily screened. After removing the obviously incorrect and duplicate data, the outliers are removed and organized into an excel table form. After data cleaning, the shank circumference data set of the F 2 generation of the resource population remains 1512 records. Using IBM SPSS 21.0 software, through QQ plot observation, kurtosis and skewness statistics, and Kolmogorov-Smirnov test, it is determined that the distribution of the shank circumference data is basically not skewed and can be used for the next GWAS analysis and to analyze its genetic structure.

[0037] Example 2

[0038] GWAS Analysis of Tibial Circumference at 40 Weeks of Age

[0039] The experimental chickens were adult hens of the F generation of the laying hen resource population constructed in Example 1. About 0.5 ml of blood samples were collected from the wing veins of the experimental chickens and placed into BD anticoagulant tubes (BD Biosciences, Suzhou), and stored at -70°C. Genomic DNA was extracted and detected by 0.8% agarose gel electrophoresis and ultraviolet spectrophotometry. After passing the detection, the DNA sample was diluted to 50±5 ng / μl for gene chip genotyping. 2 Genotyping was performed using the Affymetrix 600K Chicken Genotyping Array. Refer to the chip instruction manual for data quality control, which mainly includes: performing quality control before genotyping using APT software; performing quality control using PLINK, removing SNPs with a detection rate lower than 0.97 and removing SNP markers that deviate from the Hardy-Weinberg equilibrium; screening SNPs using metrics.R, SNP_filter.R and SNP, CR, FLD information analysis; performing genotype imputation using BEAGLE. After quality control, 435,867 autosomal SNPs remained for subsequent analysis.

[0040] Using the Affymetrix gene chip 600K Chicken Genotyping Array for genotyping. Refer to the chip instruction manual for data quality control, mainly including: performing quality control before genotyping using APT software; performing quality control using PLINK, removing SNPs with a detection rate lower than 0.97 and removing SNP markers that deviate from the Hardy-Weinberg equilibrium; screening SNPs using metrics.R, SNP_filter.R and SNP, CR, FLD information analysis; performing genotype imputation using BEAGLE. After quality control, 435,867 autosomal SNPs remained for subsequent analysis.

[0041] Before performing the genome-wide association analysis, multi-dimensional principal component analysis was first performed to eliminate false positives and population structure. The first five principal components were used as covariate parameters and added to the genetic model, and the chicken house effect was placed into the fixed effect of the model. The "simpleM" method in the R script was used to calculate the independent test estimates of each SNPs locus, and 59,308 independent markers were obtained. Using multiple corrections, the genome-wide significant threshold was 8.43×10 -7 , and the genome-wide suggestive threshold was 1.69×10 -5 . The mixed linear model was used to analyze the tibial circumference at 40 weeks of age of the eggs, and the significance test P values of each SNPs marker were obtained. The matrix expression of the linear model is

[0042] y = Wα + xβ + Gu + ε

[0043] where y represents the vector of sample phenotypic values; W represents the covariance matrix; α is the intercept vector; x is the genotype vector of the marker, β is the effect value of the marker; G is the genetic relationship matrix constructed based on the chip, u is the random effect vector (here it is the breeding value); ε is the residual.

[0044] After GWAS screening, SC_tag4 associated with the tibial circumference at 40 weeks of age was obtained (Table 1). Genome-wide association analysis was performed on the tibial circumference at 40 weeks of age of 1512 chickens, and the results are as Figure 1 , Figure 2 shown. As shown by Figure 1(Manhattan plot) shows that there are genomic significant level markers on chicken chromosome 4, and there are 29 SNPs exceeding the genomic significant level and 24 SNPs exceeding the genomic suggested level around it, which can be used as evidence to support SC_tag4. The QQ plot further verifies the reliability of the GWAS results. From Figure 2 (QQ plot), it can be seen that the vast majority of SNPs that do not deviate from the diagonal line are affected by genetic drift, and the SNPs located at the tail of the QQ plot are affected by artificial selection. After calculation, the inflation coefficient is 0.989, indicating that there is no obvious population stratification in the shank circumference trait of the resource population. Using the pedigree genetic relationship matrix to analyze genetic parameters, the heritability of shank circumference at 40 weeks of age is 0.24 ± 0.035, and the SC_tag4 genetic marker can explain 3.33% of the phenotypic variance.

[0045] Table 1 SC_tag4 genetic markers related to shank circumference

[0046]

[0047] Among them: The physical position of the marked chromosome refers to the chicken whole genome (bGalGal1.mat.broiler.GRCg7b). T (minor) indicates that the T allele frequency is in the minor position.

[0048] Example 3

[0049] Detection and verification of genetic markers

[0050] The above SNP genetic markers were used to perform candidate gene association analysis on the Dongxiang blue-shelled chicken - White Leghorn chicken resource population. The specific operation steps are as follows:

[0051] 1) PCR primers: Download the DNA template sequence information from the NCBI website, and design PCR

[0052] amplification primers with the primer premier 6.0 software. The primer information is shown in Table 2. The PCR primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0053] Table 2 Amplification primers used to detect genetic markers of chicken shank circumference at 40 weeks of age

[0054]

[0055] 2) Genomic DNA extraction: Extract genomic DNA from 1512 blood samples by the phenol-chloroform method. After being detected by an ultraviolet spectrophotometer and qualified by agarose gel electrophoresis, PCR amplification was carried out.

[0056] 3) PCR amplification process:

[0057] ① Reaction system: The 10 μl system includes 50 ng of the identification material DNA template, 10 ng each of the forward and reverse primers, 5 μL of 2×power Taq MasterMix, and the remaining volume is made up with ultrapure water.

[0058] ② Reaction procedure: First, denature at 94°C for 30 s, anneal at 52.5°C for 30 s, extend at 72°C for 30 s, for a total of 5 cycles; then denature at 94°C for 30 s, anneal at 52.5°C for 30 s, extend at 72°C for 30 s, for a total of 30 cycles; extend at 72°C for 5 min and store at 4°C.

[0059] 4) The amplified product is sent to a sequencing company for sequence polymorphism detection.

[0060] The sequence of the amplified fragment is as follows:

[0061] >SC_tag4

[0062] GAGGACTATGATGAGATGTGA AAGATAACCATTTTCCTCTAGAAGGTGTTTACTCTGAAACCTAATTAAAATGTCAGTTCTGTTTCTACAGATCATTTCAACACAAATGGCAGTCTGATGTTTTTGTCTTGGAGGTAGTGACCATTACTGTGGAGGGCAACAGTGGGGCTCTAAGTAATTAATATTTTTTTGTGGCAAGGAGTTACAAAGCCAATTATTAAAATAATCACCACTAACACTACAAAAGTAAGGAGGAGATACCTTTCTTCTTTTGCCTTGGCACTTACAGATGTGCTGGCTGCTAAAACTTGTGCAACTTTCAGTC[C / T]TTGGAGTGTGAGGCTTGTTTAAAACGTCTACTTGACAGTTTCAGGTGTTTTTAGTT ATCTCAGGCTTGTGAAGCACTGTTTGTGTACTTCTGAGGACTGTGACACCTGAGCTGGATTACATATTAACAAAGCAAATTAACAACAAAGCAAAACGAAATAGCAAAGCAAAGATGGCAGGCATTGGCATGGGGAATTTTACATTGCTCACTGTTTTTTG TAACCTCCAGATAGCAGTAAG

[0063] In the sequence, the sites marked [] are the mutation sites, and the alleles in the brackets are the allelic variations. The primer sequences are shown in bold and underlined at the beginning and end of the sequence.

[0064] 5) Association analysis: Each subject individual has a genotype and a tibial circumference at 40 weeks of age, and then a significance test is performed. The analysis results are as follows: Figure 3 As shown, the tibial circumference of individuals with the CC genotype at 40 weeks of age is 3.42 ± 0.14 cm, the tibial circumference of individuals with the CT genotype at 40 weeks of age is 3.46 ± 0.18 cm, and the tibial circumference of individuals with the TT genotype at 40 weeks of age is 3.56 ± 0.21 cm. By using genotyping technology to increase the frequency of the TT genotype, the tibial circumference of laying hens can be significantly improved.

[0065] Finally, it should also be noted that the term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device comprising a series of elements not only includes those elements but also includes other elements not expressly listed, or further includes elements inherent to such process, method, article or device.

[0066] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be construed as including the preferred embodiments as well as all changes and modifications falling within the scope of the present invention.

[0067] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. Application of a detection primer for a SNP genetic marker affecting chicken shank circumference in chicken genetic breeding, characterized in that: The SNP genetic marker affecting chicken shank circumference is SC_tag4, which corresponds to the physical position 75909527 of chromosome 4 of the chicken reference genome bGalGal 1.mat.broiler.GRCg7b version sequence information published in NCBI, and belongs to the 8th intron sequence of gene LDB2, where the base is T or C; The tibial circumference of the TT genotype individual of SC_tag4 is greater than that of the CC and CT genotype individuals; The breeds of the chickens are Dongxiang green-shell laying hens and / or white Leghorn chickens.

2. The use according to claim 1, characterized in that: The detection primers include Pr_sc4f and Pr_sc4r, the nucleotide sequence of Pr_sc4f is shown in SEQ ID NO.1, and the nucleotide sequence of Pr_sc4r is shown in SEQ ID NO.

2.

3. An early selection method for chicken shank girth traits, characterized in that: The early selection method comprises performing early selection on the chicken shank girth trait based on the genotype of the SNP genetic marker SC_tag4; The SC_tag4 corresponds to the physical position 75909527 of chromosome 4 of the chicken reference genome bGalGal 1.mat.broiler.GRCg7b version sequence information published in NCBI, belonging to the 8th intron sequence of gene LDB2, where the base is T or C; The early selection method specifically includes: Detecting the genotype of the SC_tag4 genetic marker in the chicken genome to be tested; Perform early selection on the chicken shank girth trait to be tested based on the genotype of the SC_tag4; The tibial circumference of the TT genotype individual of SC_tag4 is greater than that of the CC and CT genotype individuals; The breeds of the chickens to be tested are Dongxiang green-shell laying hens and / or white Leghorn chickens.

4. The early selection method for chicken shank girth traits according to claim 3, characterized in that: The genotype of the SC_tag4 genetic marker in the chicken genome to be tested is specifically detected by: The genomic DNA of the chicken to be tested was amplified by PCR using Pr_sc4f and Pr_sc4r as primers; The PCR amplification product was sequenced to obtain the genotype of position 75909527 of the positive strand of the tested chicken chromosome 4; Among them, the nucleotide sequence of the Pr_sc4f is shown as SEQ ID NO.1, and the nucleotide sequence of the Pr_sc4r is shown as SEQ ID NO.2.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker related to chicken growth and slaughter traits, detection primer, kit and breeding method

    CN114150070A