A molecular breeding method for thickening fish by passivating intramuscular spicules

By using CRISPR/Cas9 gene editing technology to target and edit the zebrafish bmp8a gene and microinject it into fish fertilized eggs, the risk of consumption caused by small intermuscular spines was solved, and fish breeding with blunted and thickened intermuscular spines was achieved, resulting in safe new germplasm.

CN119101687BActive Publication Date: 2025-11-11HUAZHONG AGRI UNIV +1
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202411391037.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-30
Publication Date
2025-11-11
Estimated Expiration
2044-09-30

AI Technical Summary

Technical Problem

The small size of the intermuscular spines poses a risk of accidental ingestion during consumption, resulting in throat injuries or other digestive tract damage, a problem that current technologies struggle to effectively address.

Method used

Using CRISPR/Cas9 gene editing technology, the zebrafish bmp8a gene was targeted and edited, and then microinjected into fish fertilized eggs via gRNA and Cas enzyme system to obtain new fish germplasm with blunted and thickened intermuscular spines.

Benefits of technology

A new zebrafish germplasm with normal growth but blunted and thickened intramuscular spines was obtained, which can be stably inherited, reducing the risk of accidentally swallowing fish bones and providing a safe eating experience.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119101687B_ABST
    Figure CN119101687B_ABST
Patent Text Reader

Abstract

This invention provides a molecular breeding method for fish with blunted and thickened intermuscular spines, belonging to the fields of gene editing and aquatic organism breeding technology. This invention utilizes CRISPR / Cas9 gene editing technology to mutate the bmp8a gene in fish, thereby obtaining fish with blunted and thickened intermuscular spines. The method of this invention is simple and easy to implement. Verification has shown that this invention can obtain a large number of stably heritable mutant zebrafish through gene knockout, and also provides an important reference for the precise design breeding of other farmed fish. It can serve as an efficient technical means to obtain new germplasm of fish with blunted and thickened intermuscular spines, possessing significant scientific research and industrial application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene editing and aquatic organism breeding technology, and in particular relates to a molecular breeding method for fish with blunted and thickened intermuscular spines. Background Technology

[0002] Intermuscular bones (IBs) are slender, linear skeletons embedded in muscles, formed by the intramembranous ossification of tendons. They are found only in lower bony fish. However, their small size makes them difficult for humans to spot during consumption, posing a risk of swallowing them and causing throat injuries or other digestive tract damage. Summary of the Invention

[0003] The purpose of this invention is to provide a molecular breeding method for fish with blunted and thickened intermuscular spines, which can obtain fish with blunted and thickened intermuscular spines.

[0004] The present invention provides a gRNA, wherein the nucleotide sequence of the target site of the gRNA is shown in SEQ ID NO.1.

[0005] Preferably, the nucleotide sequence of the gRNA is shown in SEQ ID NO.2.

[0006] The present invention also provides a nucleic acid encoding the gRNA described in the above scheme or a precursor encoding the gRNA described therein.

[0007] The present invention also provides a CRISPR system for targeted editing of the bmp8a gene, comprising the gRNA or the nucleic acid described in the above scheme.

[0008] The present invention also provides a composition for targeted editing of the bmp8a gene, comprising: the CRISPR system and the Cas enzyme system described above; wherein the Cas enzyme system is selected from: Cas enzyme or nucleic acid encoding Cas enzyme.

[0009] The present invention also provides a mutant of the bmp8a gene, which is based on the bmp8a gene but lacks the nucleotide sequence shown in SEQ ID NO.3.

[0010] The present invention also provides reagents or kits for negative regulation of the bmp8a gene fragment, the bmp8a gene, the gRNA described in the above scheme, the nucleic acid, the CRISPR system, the composition, or the application of the bmp8a gene mutant in the breeding of fish with blunted and thickened intermuscular spines; the nucleotide sequence of the bmp8a gene fragment is shown in SEQ ID NO.1.

[0011] The present invention also provides a molecular breeding method for fish with blunted and thickened intermuscular spines, comprising the following steps: microinjecting the composition described above into fish fertilized eggs and incubating them.

[0012] Preferably, after incubation, the fish obtained from incubation are taken as the F0 generation; individuals with mutations are selected from the F0 generation, raised to sexual maturity, and then mated with wild-type fish to obtain the F1 generation; individuals with mutations are selected from the F1 generation, raised to sexual maturity, and then mated to obtain the F2 generation; homozygous mutant individuals are selected from the F2 generation to obtain fish with blunted and thickened intermuscular spines.

[0013] Preferably, the fish includes zebrafish or economically important bony fish.

[0014] This invention provides a gRNA, characterized in that the nucleotide sequence of the target site of the gRNA is shown in SEQ ID NO. 1. The target site of this invention is located in the first exon of the zebrafish bmp8a gene, which is the optimal target site for the bmp8a gene. The gRNA of this invention is used for targeted editing of the zebrafish bmp8a gene using gene editing technology, resulting in new zebrafish germplasm with normal growth and development but blunted and thickened intermuscular spines. This zebrafish with blunted and thickened intermuscular spines can reproduce normally and expand its population, and the trait of blunted and thickened intermuscular spines is stably inherited, solving the problem of swallowing fish bones due to their small size, which can cause throat injuries or other digestive tract damage.

[0015] This invention also provides a molecular breeding method for fish with blunted and thickened intermuscular spines. The method utilizes CRISPR / Cas9 gene editing technology to mutate the bmp8a gene in fish, thereby obtaining fish with blunted and thickened intermuscular spines. The method of this invention is simple and easy to implement. Verification has shown that this invention can obtain a large number of stably heritable mutant zebrafish through gene knockout, and also provides an important reference for the precise design breeding of other farmed fish. It can serve as an efficient technical means to obtain new germplasm of fish with blunted and thickened intermuscular spines, possessing significant scientific research and industrial application value. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0017] Figure 1 A schematic diagram of local alizarin red skeletal staining in wild-type zebrafish (90 days after hatching), with the red arrows indicating the intermuscular spines;

[0018] Figure 2 This is a schematic diagram of local alizarin red skeletal staining in a mutant zebrafish (90 days after hatching). The red arrows indicate the intermuscular spines. Detailed Implementation

[0019] The present invention provides a gRNA, the nucleotide sequence of the target site of the gRNA being shown in SEQ ID NO.1, specifically: 5′-CGGGCGGCCTAGGCCTCA-3′.

[0020] The target site of this invention is located in the first exon of the zebrafish bmp8a gene, which is the optimal target site for the bmp8a gene.

[0021] In this invention, the nucleotide sequence of the gRNA is shown in SEQ ID NO.2, specifically: AATTATACGACTCACTATAGGTGAGGCCTAGGCCGCCCGGTTTTAGAGCTAGAA ATAGC. This invention does not impose any special limitations on the preparation method of the gRNA; conventional methods in the art can be used.

[0022] The present invention also provides a nucleic acid encoding the gRNA described in the above scheme or a precursor encoding the gRNA described therein.

[0023] In this invention, the nucleotide sequence of the nucleic acid is shown in SEQ ID NO.2. This invention does not impose any special limitations on the preparation method of the nucleic acid; conventional methods in the art can be used.

[0024] The present invention also provides a CRISPR system for targeted editing of the bmp8a gene, comprising the gRNA or the nucleic acid described in the above scheme.

[0025] The present invention also provides a composition for targeted editing of the bmp8a gene, comprising the CRISPR system and the Cas enzyme system described above; wherein the Cas enzyme system is selected from: Cas enzyme or nucleic acid encoding Cas enzyme.

[0026] In the specific implementation of this invention, the nucleic acid encoding the Cas enzyme includes zCas9 mRNA.

[0027] In a specific implementation of the present invention, the composition comprises gRNA and zCas9 mRNA; the concentration of the gRNA is 200 ng / μL; and the concentration of the zCas9 mRNA is 500 ng / μL.

[0028] The present invention also provides a mutant of the bmp8a gene, which is based on the bmp8a gene but lacks the nucleotide sequence shown in SEQ ID NO.3, specifically: CCCCGGGCGGCCTAGGCCTC.

[0029] In this invention, the nucleotide sequence shown in SEQ ID NO.3 is located in the first exon of the zebrafish bmp8a gene. Preferably, the mutant is based on the bmp8a gene, with the nucleotide sequence shown in SEQ ID NO.4 mutated to the nucleotide sequence shown in SEQ ID NO.5.

[0030] In this invention, the nucleotide sequence shown in SEQ ID NO.4 is specifically as follows:

[0031] In this invention, the nucleotide sequence shown in SEQ ID NO.5 is specifically as follows:

[0032] The present invention also provides reagents or kits for negative regulation of the bmp8a gene fragment, the bmp8a gene, the gRNA described in the above scheme, the nucleic acid, the CRISPR system, the composition, or the application of the bmp8a gene mutant in the breeding of fish with blunted and thickened intermuscular spines; the nucleotide sequence of the bmp8a gene fragment is shown in SEQ ID NO.1.

[0033] In this invention, the accession number of the bmp8a gene is: Gene ID:561963, see for details; bmp8abonemorphogenetic protein 8a[Danio rerio(zebrafish)].

[0034] In this invention, the negative regulation of the bmp8a gene fragment includes knocking out the bmp8a gene fragment; the reagents or kits for knocking out the bmp8a gene fragment include CRISPR / Cas9 gene editing reagents. In a specific implementation of this invention, the CRISPR / Cas9 gene editing reagents include: the gRNA and Cas enzyme described in the above scheme; or, the gRNA and nucleic acid encoding the Cas enzyme described in the above scheme.

[0035] The present invention also provides a molecular breeding method for fish with blunted and thickened intermuscular spines, comprising the following steps: microinjecting the composition described above into fish fertilized eggs and incubating them.

[0036] In a specific implementation of this invention, a microinjection system is prepared using DEPC water as a solvent; the microinjection system contains gRNA and zCas9 mRNA; the final concentration of the gRNA is 200 ng / μL; and the final concentration of the zCas9 mRNA is 500 ng / μL. Furthermore, the microinjection system also includes an indicator; the indicator includes phenol red; the final volume concentration of the phenol red is 0.2%; and each 5 μL of the microinjection system can inject 1000–2000 fertilized eggs.

[0037] In this invention, the fish fertilized eggs preferably include zebrafish fertilized eggs. In a specific implementation of this invention, the zebrafish fertilized eggs are in the I-cell stage and are laid flat in a culture dish.

[0038] In this invention, the microinjection time is ≤40 min.

[0039] In this invention, the incubation is preferably carried out in oxygenated water; the water temperature of the oxygenated water is preferably 23-28°C. This invention does not have special requirements regarding the oxygen content of the oxygenated water.

[0040] This invention utilizes CRISPR / Cas9 gene editing technology to mutate the bmp8a gene in fish, thereby obtaining fish with blunted and thickened intermuscular spines.

[0041] After incubation, the fish obtained from incubation are used as the F0 generation; individuals with mutations are selected from the F0 generation, bred to sexual maturity, and then mated with wild-type fish to obtain the F1 generation; individuals with mutations are selected from the F1 generation, bred to sexual maturity, and then mated to obtain the F2 generation; homozygous mutant individuals are selected from the F2 generation to obtain fish with blunted and thickened intermuscular spines.

[0042] In this invention, the fish include zebrafish or economically important bony fish.

[0043] In this invention, the zebrafish with blunted and thickened intermuscular spines has the nucleotide sequence shown in SEQ ID NO.3.

[0044] In this invention, when the fish is zebrafish, the screening method for individuals with mutations includes the following steps: extracting zebrafish genomic DNA; performing PCR amplification on the zebrafish genomic DNA using target detection primers to obtain PCR amplification products; performing 2.5% agarose gel electrophoresis on the PCR amplification products, or performing sequencing on the PCR amplification products, and screening for individuals with non-single bands on the electrophoresis or non-single peaks in the sequencing results, which are individuals with mutations.

[0045] In this invention, the target detection primers include nucleotide sequences F1 as shown in SEQ ID NO. 6 and R1 as shown in SEQ ID NO. 7; the PCR amplification product contains the target site and the gene sequence in its vicinity; the nucleotide sequence of the PCR amplification product is shown in SEQ ID NO. 8, specifically:

[0046]

[0047]

[0048] In this invention, the italicized and bolded sequences are target site sequences, and the single underlined sequences are deleted sequences. The PCR amplification reaction system is 20 μL and consists of the following components: PCRMasterMix (Yisheng, Shanghai) 10 μL, forward and reverse primers 0.5 μL each, genomic DNA template 2 μL and sterile water 7 μL; the PCR amplification reaction conditions were: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ final extension for 5 min.

[0049] To further illustrate the present invention, the molecular breeding method for thickened and blunted intermuscular spines provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0050] Example 1

[0051] A molecular breeding method for zebrafish with blunted and thickened intermuscular spines, the steps of which are as follows:

[0052] (1) Design of gRNA target sites

[0053] The optimal target site for the bmp8a gene was designed and screened. In this embodiment, the target site gRNA sequence is located in the first exon of the zebrafish bmp8a gene; the nucleotides of the gRNA target site are shown in SEQ ID NO.1.

[0054] (2) In vitro synthesis of gRNA

[0055] Overlap PCR amplification was performed using a conserved downstream primer Scaffold (5′-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTT TAACTTGCTATTTCTAGCTCTAAAAC-3′, SEQ ID NO. 9) and an upstream primer (5′-AATTAATACGACTCACTATAGGTGAGGCCTAGGCCGCCCGGTTTTAGAGCTAGAA ATAGC-3′, SEQ ID NO. 10) containing a specific target site gRNA sequence with a T7 promoter. The PCR system, in 25 μL volumes, consisted of the following components: 10.5 μL Primer StarMix, 5 μL Scaffold, 5 μL gRNA, and 4.5 μL ddH2O. The PCR reaction conditions were: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 64℃ annealing for 10 s, 72℃ extension for 15 s, for 45 cycles; and a final extension at 72℃ for 5 min. 5 μL of PCR product was subjected to 1.5% agarose gel electrophoresis. After verifying the correct band size, the PCR product was purified and recovered, and the concentration of the recovered product was measured using Nanodrop 2000 (Thermo Scientific, USA).

[0056] According to the instructions of the Transcriptaid T7 highyield transcription kit (Thermo Scientific, USA), gRNA was transcribed in vitro and purified using the lithium chloride precipitation method. The specific steps of the lithium chloride precipitation method were as follows: 1 μL of DNase I was added to the gRNA in vitro transcription system and incubated for 15 min to remove residual DNA. 2 μL of 0.2M EDTA was added to terminate the reaction, followed by 2.5 μL of 4M lithium chloride and 75 μL of pre-chilled anhydrous ethanol. The mixture was precipitated at -20℃ for 16 h. The precipitate was collected by centrifugation, washed with 50 μL of 70% pre-chilled ethanol, centrifuged to remove the ethanol, and then dissolved in 25 μL of DEPC water. 1 μL of the precipitate was used to determine the RNA concentration, and the gRNA quality was assessed by 1.5% agarose gel electrophoresis. The gRNA was then stored at -80℃ for later use.

[0057] (3) In vitro transcription of zCas9 mRNA

[0058] The pT3TS-nCas9n plasmid was linearized using the restriction endonuclease XbaI (NEB, USA). After confirming complete linearization by 1% agarose gel electrophoresis, the plasmid was recovered using a Gel Extraction Kit (Omega, USA). zCas9 mRNA was transcribed in vitro according to the T3mMESSAGE mMACHINE (Invitrogen, USA) instructions. The zCas9 mRNA was purified and recovered using lithium chloride precipitation. After dissolving in enzyme-free water, the concentration was detected using a Nanodrop 2000 (Thermo Scientific, USA). The mRNA quality was assessed by 1.5% agarose gel electrophoresis. After passing the quality test, the mRNA was aliquoted and stored at -80°C for later use.

[0059] (4) Microinjection

[0060] Microinjection was performed on wild-type zebrafish zygotes. An injection system was prepared using a mixture of gRNA and zCas9 mRNA, with a final concentration of 200 ng / μl for gRNA and 500 ng / μl for zCas9 mRNA. Phenol red (0.2% concentration) was added as an indicator. The experimental sample was injected into I-stage zebrafish zygotes plated in culture dishes using a Picoliter Microinjector (Warner, PL-100A, USA). Injection was best completed within 40 minutes of fertilization. Each 5 μl of reagent mixture could be used to inject 1000–2000 zygotes. After injection, the zygotes were incubated in oxygenated water at 23–28°C.

[0061] (5) Screening of F0 generation mutant individuals in zebrafish

[0062] Genomic DNA was extracted from surviving zebrafish individuals in (4) and used for target detection primers:

[0063] F1:5′-ACGAACCCGACTTTTCCCTC-3′, SEQ ID NO.6;

[0064] R1: 5′-GCGTCCCCCTGTCAGATAAG-3′, SEQ ID NO.7.

[0065] Gene sequences at and near the target site were amplified; the PCR reaction system was as follows: PCR MasterMix (Yisheng, Shanghai) 10 μL, forward and reverse primers 0.5 μL each, genomic DNA template 2 μL, sterile water 7 μL. PCR reaction conditions: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ final extension for 5 min. After amplification, 10 μL of PCR product was subjected to 2.5% agarose gel electrophoresis. Individuals with non-single bands on the electrophoresis or non-single peaks in the sequencing results were identified as mutant zebrafish F0 generation individuals.

[0066] (6) Screening of mutant individuals in F1 generation of zebrafish

[0067] After the F0 generation mutant zebrafish reached sexual maturity, they were mated with sexually mature wild-type zebrafish. Genomic DNA was extracted from the progeny, and PCR products were amplified using target detection primers F1 and R1. Individuals exhibiting mutations were screened using 2.5% agarose gel electrophoresis and sequencing (Qingke Biotechnology Co., Ltd., Wuhan) to form the F1 generation mutant population. The bmp8a gene sequence of the F1 generation mutant individuals was compared with the bmp8a gene sequence of wild-type zebrafish to determine the genotype of the F1 generation mutant individuals.

[0068] (7) Obtain F2 generation individuals of mutant zebrafish

[0069] After the F1 generation mutant individuals reach sexual maturity, male and female individuals with the same genotype are selected for mating to obtain F2 generation mutant zebrafish individuals.

[0070] (8) Genotypic and phenotypic analysis of F2 generation individuals of mutant zebrafish

[0071] After extracting genomic DNA from the progeny, PCR products were amplified using target detection primers. Homozygous individuals with the bmp8a mutation were then screened using 2.5% agarose gel electrophoresis and sequencing (Qingke Biotechnology Co., Ltd., Wuhan). A comparison of the target site gene sequences between wild-type zebrafish and F2 generation homozygous mutant zebrafish showed that the wild-type target site sequence, as shown in SEQ ID NO.2, was mutated to the nucleotide sequence shown in SEQ ID NO.3.

[0072] To observe the intramuscular spine phenotype of zebrafish F2 generation mutants, the skeletal phenotype of zebrafish was observed using the Alizarin Red whole-skeleton staining method. The specific steps were as follows: zebrafish 3 months after hatching were fixed in 4% paraformaldehyde for 48 hours, then rinsed overnight in ddH2O water; subsequently, they were bleached in a mixed solution of equal volumes of 3% H2O2 and 1% KOH for 4 hours; rinsed in ddH2O for 30 minutes; treated in 30% saturated borax solution for 12 hours; rinsed in ddH2O for 30 minutes; stained in a mixed solution of 1% Alizarin Red (Sigma) and 1% KOH for 12 hours; excess Alizarin Red staining solution was washed in 1% KOH solution; rinsed in a mixed solution of 1% trypsin (Solarbio) and 2% saturated borax for 3–5 days to remove impurities; and then cleared in 50% and 100% glycerol gradients for storage. The results showed that wild-type zebrafish had normal skeletal development, and their overall and local intramuscular spine phenotypes were as follows: Figure 1 As shown; the intermuscular spines of homozygous bmp8a mutant zebrafish are blunted and thickened, and their intermuscular spine phenotype is as follows. Figure 2 As shown.

[0073] Based on the combined genotypic and phenotypic analysis of the F2 generation individuals, it was found that all F2 individuals with blunted and thickened intermuscular spines had a frameshift mutation, revealing that the bmp8a gene is essential for the development of intermuscular spines in zebrafish, and that disrupting the bmp8a allele can lead to blunted and thickened intermuscular spines in zebrafish.

[0074] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of a gRNA in zebrafish breeding for blunting and thickening of intermuscular spines; the nucleotide sequence of the gRNA is shown in SEQ ID NO.

2.

2. Application of a CRISPR system for targeted editing of the bmp8a gene in zebrafish breeding with blunted and thickened intermuscular spines; The CRISPR system includes gRNA; the nucleotide sequence of the gRNA is shown in SEQ ID NO.

2.

3. Application of a composition for targeted editing of the bmp8a gene in zebrafish breeding with blunting and thickening of intermuscular spines; The composition comprises a CRISPR system and a Cas enzyme system; the CRISPR system comprises gRNA; the nucleotide sequence of the gRNA is shown in SEQ ID NO.

2.

4. A molecular breeding method for zebrafish with blunted and thickened intermuscular spines, characterized in that, Includes the following steps: The composition targeting the bmp8a gene was microinjected into zebrafish fertilized eggs and incubated. The composition includes a CRISPR system and a Cas enzyme system; The CRISPR system includes gRNA; The nucleotide sequence of the gRNA is shown in SEQ ID NO.

2.

5. The molecular breeding method according to claim 4, characterized in that, After incubation, the zebrafish obtained from incubation were used as the F0 generation; Individuals with mutations were selected from the F0 generation, bred to sexual maturity, and then mated with wild-type zebrafish to obtain the F1 generation; Individuals with mutations are selected from the F1 generation, bred to sexual maturity, and then mated to obtain the F2 generation; Homozygous mutant individuals were screened from the F2 generation to obtain zebrafish with blunted and thickened intermuscular spines.

6. The molecular breeding method according to claim 4, characterized in that, The zebrafish fertilized eggs were in the I-cell stage and laid flat in a culture dish.

Citation Information

Cited By

  • Cultivation method for reducing intermuscular thorns of crucian carps

    CN122189106A