Double-AAV vector system as well as construction method and application thereof
Through the dual AAV vector system, the synergistic effect of epegRNA and nCas9 is used to solve the problem of insufficient load capacity of AAV vectors, efficient gene editing and protein expression recovery are achieved, and visual function of RP animal models is significantly improved.
Patent Information
- Application Number
- CN202411234614.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-04
- Publication Date
- 2024-12-10
AI Technical Summary
The existing AAV viral vectors have limited load capacity and are difficult to effectively deliver large genes, which leads to limited application of gene therapy in the treatment of some hereditary diseases, especially the in vivo editing efficiency and difficulty in controlling it, and often has antagonistic effects. .
Using a dual AAV vector system, including AAV2-PE-N vector and AAV2-PE-C vector, the vector contains epegRNA and nCas9 sequences targeting the PDE6B mutation site. The 3' end of epegRNA is added to the pseudo-junction structure and reverse transcriptase truncation. The body lacks the RnH functional domain, synergistically to improve gene editing efficiency.
In the RP animal model, efficient repair of pathogenic mutations was achieved, with in vivo editing efficiency reaching 31.55%, and about 39% of protein expression was restored, significantly inhibiting retinal degeneration and improving visual function.
Smart Images
Figure CN119101708A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a dual AAV vector system and a construction method and application thereof, belonging to the technical field of gene editing. Background Art
[0002] Gene editing is the process of modifying specific targets in the genome of an organism. Common gene editing technologies include zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR / Cas9). The CRISPR / Cas9 system is mainly composed of Cas9 protein and single-stranded guide RNA (sgRNA). Under the guidance of sgRNA, Cas9 protein can cut different target sites through the principle of base complementary pairing to achieve double-strand breaks in DNA. This technology can destroy, insert or delete DNA fragments through non-homologous end joining (NHEJ), or cause genomic changes through homology-directed repair (HDR). However, since most genetic diseases are caused by point mutations, the above methods are inefficient in correcting point mutations and may often lead to random insertions and deletions at the target locus.
[0003] Adeno-associated virus (AAV)-mediated gene therapy has become the treatment of choice for certain genetic diseases. In 2012, the European Union approved the first AAV-based drug Glybera for the treatment of protein lipase deficiency, and in 2018, the United States approved the first AAV drug for the treatment of congenital blindness (hereditary retinal dystrophy). Although AAV viral vectors may be the most effective gene therapy vectors, their limited loading capacity greatly limits their application. The DNA sequence carried by AAV viral vectors does not exceed 5kb in length, and this also includes some regulatory elements. Therefore, AAV viral vectors are powerless for some larger genes, which also limits the application of gene therapy in the delivery of large genes.
[0004] To overcome this limitation, a variety of strategies have been explored, including splitting the large transgene and transporting it to the target via 2 or 3 AAVs. Specifically, the oversized gene expression cassette can be split into two or three parts, which are then carried by two or three separate AAV vectors. After simultaneous delivery to the target cell, the entire large gene expression cassette is recombined in the cell to express a complete large protein. Depending on the recombination mechanism, the methods for splitting the expression cassette can be divided into: trans-splicing, overlapping, hybridization, and triple AAV vectors.
[0005] However, a large number of experiments have shown that the transgenic expression efficiency achieved by multiple AAV vectors is much lower than that achieved by using a single AAV vector. In other words, the editing efficiency of multiple AAV vectors in vivo is uncontrollable. In particular, in vivo editing efficiency often results in antagonism between multiple AAV vectors.
[0006] Retinitis Pigmentosa (RP) is a common hereditary retinal degenerative disease with an incidence of about 1 in 4000. RP patients initially present with night blindness, which can progress to blindness, and there is no effective treatment available clinically. Summary of the invention
[0007] The present invention provides a dual AAV vector system with high editing efficiency. The dual AAV vector system can repair the pathogenic mutation PDE6B in the RP animal model (rd1 mouse), provide theoretical support for preclinical research on RP gene therapy, and enable personalized treatment and precision medicine.
[0008] To achieve this object, the present invention provides the following technical solutions:
[0009] In a first aspect of the present invention, a dual AAV vector system is provided, comprising an AAV2-PE-N vector and an AAV2-PE-C vector.
[0010] The AAV-PE-N vector comprises a DNA sequence encoding epegRNA, nsgRNA and the amino front terminus of nCas9;
[0011] The AAV-PE-C vector comprises a DNA sequence encoding the carboxyl end of nCas9 and a reverse transcriptase truncation;
[0012] The epegRNA can recognize the mutation site of PDE6B;
[0013] The epegRNA is a pegRNA with a pseudoknot-like structure added to the 3' end;
[0014] The AAV2-PE-N vector and the AAV2-PE-C vector are used in combination to treat retinitis pigmentosa.
[0015] In the present invention, epegRNA is designed for the exon 7 sequence of PDE6B: 5'-cacacccccg gctgatcactgggccctggc cagtggcctt ccaacctac(a)g tagcagaaagtggcttt-3' (CA nonsense mutation results in TAA stop codon).
[0016] In the present invention, the AAV-PE-N vector and the AAV-PE-C vector work synergistically to overcome the capacity limitation of a single vector, and in vivo experiments have also proven their effectiveness.
[0017] Preferably, the amino front end of the nCas9 refers to a DNA sequence encoding amino acids 1-713, and the carboxyl rear end of the nCas9 refers to a DNA sequence encoding amino acids 714-1368.
[0018] Preferably, the sequence of the pseudoknot-like structure is SEQ ID NO.1.
[0019] The sequence of SEQ ID NO.1 is: (5'-CGCGGUUCUAUCUAGUUACGCGUUAAACCAACUAG AA-3').
[0020] In the present invention, the pseudoknot-like structure SEQ ID NO.1 is added to the 3' end of the pegRNA to inhibit the degradation of the pegRNA, which is also the reason why the dual-vector system of the present invention can have a higher in vivo editing efficiency.
[0021] Preferably, the reverse transcriptase truncation is a reverse transcriptase truncation lacking the RnH functional domain.
[0022] In the present invention, the reverse transcriptase truncation lacking the RnH functional domain does not affect the enzyme function, but makes the dual AAV vector system more compact, which is also the reason why the dual vector system of the present invention can have a higher in vivo editing efficiency.
[0023] Preferably, the AAV is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-DJ, AAV-DJ8, AAV-DJ9, AAVrh8, AAVrh8R and AAVrh10; further preferably, AAV is selected from AAV2.
[0024] The second aspect of the present invention provides the use of the dual AAV vector system of the present invention in the preparation of gene drugs for treating retinitis pigmentosa.
[0025] Preferably, the retinitis pigmentosa is PDE6B mutant retinitis pigmentosa.
[0026] Preferably, the dual AAV vector system comprises an AAV2-PE-N vector and an AAV2-PE-C vector, and the effective dose of the AAV2-PE-N vector and the AAV2-PE-C vector is not less than 1×10 10vg, the AAV2-PE-N vector and AAV2-PE-C vector are administered by injection.
[0027] Preferably, the dual AAV vector system includes an AAV2-PE-N vector and an AAV2-PE-C vector.
[0028] The AAV-PE-N vector comprises a DNA sequence encoding epegRNA, nsgRNA and the amino front terminus of nCas9;
[0029] The AAV-PE-C vector comprises a DNA sequence encoding the carboxyl end of nCas9 and a reverse transcriptase truncation;
[0030] The epegRNA can recognize the mutation site of PDE6B;
[0031] The epegRNA is a pegRNA with a pseudoknot-like structure added to the 3' end;
[0032] The AAV2-PE-N vector and the AAV2-PE-C vector are used in combination to treat retinitis pigmentosa.
[0033] Preferably, the amino front end of the nCas9 refers to a DNA sequence encoding amino acids 1-713, and the carboxyl rear end of the nCas9 refers to a DNA sequence encoding amino acids 714-1368.
[0034] Preferably, the sequence of the pseudoknot-like structure of the epegRNA is SEQ ID NO.1.
[0035] Preferably, the reverse transcriptase truncation is a reverse transcriptase truncation lacking the RnH functional domain.
[0036] Preferably, the AAV is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-DJ, AAV-DJ8, AAV-DJ9, AAVrh8, AAVrh8R and AAVrh10.
[0037] A third aspect of the present invention provides a method for constructing a dual AAV vector system, comprising the following steps:
[0038] S1, prepare the trans-splicing PE plasmid, PCR amplify the sequence encoding the PE-N terminus and the splicing donor, and clone it into the px601 plasmid using a DNA assembly kit;
[0039] S2. PCR amplify the splice acceptor, the sequence encoding the PE-C terminus and the WPRE sequence, and clone them into the pX601 plasmid.
[0040] S3. Co-transfect the plasmids prepared in steps S1 and S2, the AAV capsid plasmid, and the helper plasmid into mammalian cells.
[0041] S4. After transfection, the cells were lysed; then the dual AAV vector system was obtained by iodixanol gradient ultrapurification.
[0042] Preferably, the mammalian cells are HEK 293T cells.
[0043] Compared with the prior art, the beneficial effects and significant improvements of the technical solution of the present invention are:
[0044] 1. The present invention conducts in vivo gene editing experiments in the rd1 mouse model of RP induced by PDE6B Y347 mutation. For the first time, a dual AAV vector system with high editing efficiency and low off-target rate for this mutation target was screened, and the vector was efficiently and specifically delivered to achieve the goal of repairing the key pathogenic PDE6B mutation of RP.
[0045] 2. The dual AAV vector system of the present invention adds a pseudoknot-like structure to the 3' end of pegRNA to inhibit the degradation of pegRNA, and uses a reverse transcriptase truncation lacking the RnH functional domain without affecting the enzyme function, making the system more compact.
[0046] 3. The AAV-PE-N vector and AAV-PE-C vector in the dual AAV vector system of the present invention work synergistically, resulting in an average in vivo editing efficiency of 31.55%, and approximately 39% of protein expression is restored after editing. BRIEF DESCRIPTION OF THE DRAWINGS
[0047] In order to more clearly illustrate the technical solution of the present invention, the drawings used in the embodiments of the present invention are briefly introduced below.
[0048] Figure 1 Schematic diagram of the dual AAV vector system structure of Example 1.
[0049] Figure 2 Schematic diagram of the in vivo PE editing timeline of the dual AAV vector system of Example 1.
[0050] Figure 3 This is the in vivo PE editing deep sequencing and protein blotting of the dual AAV vector system of Example 2, wherein: (A) in vivo PE editing efficiency, one-way ANOVA with Tukey's multiple comparison test, n=3, *p<0.05***p<0.001; (B) protein blotting analysis of PDE6B expression in mouse eye lysate.
[0051] Figure 4The dual AAV vector system of Example 3 inhibits retinal degeneration by in vivo PE editing, wherein, (A) retinal immunofluorescence staining, rhodopsin antibody labels rod cells; (B) statistical graph of retinal photoreceptor cell thickness of WT, rd1 and PE-edited mice, compared by one-way ANOVA with Tukey's multiple comparison test, n=3, **P<0.01***p<0.001; (C) H&E staining of mouse retinal sections; (D) statistics of mouse retinal outer nuclear layer thickness, compared by one-way ANOVA with Tukey's multiple comparison test, ***p<0.001, ONL, outer nuclear layer; INL, inner nuclear layer; OS, photoreceptor cell layer; GCL: ganglion cell layer.
[0052] Figure 5 The in vivo PE editing of Example 4 improves the visual function of mice, wherein, (A) infrared photos of pupils of WT, rd1 and PE-treated mice; (B) statistics of mouse pupil contraction ratio, compared using one-way ANOVA with Tukey's multiple comparison test, n=6, **p<0.01***p<0.001; (C) schematic diagram of light and dark boxes; (D) statistics of mouse activity time in the dark box, compared using one-way ANOVA with Tukey's multiple comparison test, n=6, *p<0.05**p<0.01***p<0.001; (E) schematic diagram of visual cliff; (F) trajectory map and heat map of mice on the platform; (G) statistics of mouse activity time in the visual cliff area, compared using one-way ANOVA with Tukey's multiple comparison test, n=6, *p<0.05***p<0.001. DETAILED DESCRIPTION
[0053] To make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually based on conventional conditions or the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are weight percentages and weight parts. The experimental materials and reagents used in the following examples can be obtained from commercial channels unless otherwise specified.
[0054] Unless otherwise specified, the technical and scientific terms used herein have the same meaning as commonly understood by ordinary technicians in the technical field to which the application belongs. It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments of the present application.
[0055] In order to more fully understand the present invention, the professional terms in the present invention are explained below.
[0056] pegRNA, Prime Editing Guide RNA, pegRNA has dual functions. It can not only guide the editing protein to the target site, but also contains the editing template sequence.
[0057] NsgRNA, nicking sgRNA, is used to guide the nCas9 protein to add a nick in the non-editing chain away from the mutation site, promoting the replacement of the entire segment of the newly synthesized chain and improving the editing efficiency.
[0058] AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12. Currently, there are 13 serotypes of AAV (i.e., AAV1-13). Different serotypes have different affinities for tissues or organs. Among them, AAV2, AAV3, and AAV9 originate from humans themselves.
[0059] The AAV-DJ, AAV-DJ8, AAV-DJ9, and AAV-DJ systems offer a hybrid capsid created by DNA shuffling technology that combines eight different natural serotypes: AAV-2, AAV-4, AAV-5, AAV-8, AAV-9, avian AAV, bovine AAV, and goat AAV. The result is a highly infectious vector that can transduce a variety of cells and tissues at higher rates than AAV-2.
[0060] Reverse transcriptase, also known as RNA-dependent DNA polymerase. In 1970, Temin et al. discovered a special DNA polymerase in oncogenic RNA viruses. The enzyme uses RNA as a template, dNTP as a substrate, and tRNA (mainly tryptophan tRNA) as a primer. At the 3'-OH end of tRNA, according to the principle of base pairing, it synthesizes a single-stranded DNA complementary to the RNA template in the 5'-3' direction. This single-stranded DNA is called complementary DNA (CDNA).
[0061] Mutation refers to a change in the nucleotide sequence of the genome of an organism, virus or extrachromosomal DNA. Mutations are caused by errors in DNA replication (especially meiosis) or incorrect repair after DNA damage (such as exposure to radiation or carcinogens).
[0062] The emergence of gene-based medicine is closely related to the development of genetic engineering technology, which is the main body of modern biotechnology. It is mainly used in molecular genetics, biology, medicine, pharmacy and other disciplines. It has high selectivity. One gene medicine is not suitable for all races. There are many differences in the genes of different races. Gene medicine has developed with the development of genetic engineering technology and has roughly gone through three stages: bacterial genetic engineering, cell genetic engineering, transgenic animals and synthetic biology.
[0063] Example 1 Dual AAV vector system in vivo PE editing demonstrated effective editing at both the DNA and protein levels
[0064] Experimental methods
[0065] 1.1. Preparation of dual AAV vector system
[0066] First, the trans-splicing PE plasmid was prepared, and the sequences encoding the PE-N terminus (Addgene #132775) and the splicing donor (Addgene #112734) were PCR amplified and cloned into the px601 plasmid using the NEBuilder HiFi DNA Assembly Kit (NEB). Similarly, the splicing acceptor (Addgene #112876), the sequence encoding the PE-C terminus (Addgene #132775), and the WPRE sequence (Addgene #52962) were PCR amplified and cloned into the pX601 plasmid. Subsequently, the above plasmids were co-transfected with the AAV2 capsid plasmid (Rep / Cap (2 / 2)) and the helper plasmid (Helper) into HEK 293T cells. After 72 hours of transfection, the cells were lysed; then, the advanced AAV was obtained by iodixanol (Optiprep, Sigma; D1556) gradient ultrapurification.
[0067] The dual AAV vector system was prepared as Figure 1 As shown, the dual AAV vector system includes AAV2-PE-N vector and AAV2-PE-C vector. The AAV-PE-N vector contains a DNA sequence encoding epegRNA, nsgRNA and the amino front end of nCas9; the AAV-PE-C vector contains a DNA sequence encoding the carboxyl rear end of nCas9 and a reverse transcriptase truncation; epegRNA can recognize the mutation site of PDE6B.
[0068] 1.2. AAV2-PE-N (1×10 10 Viral genome (vg)) and AAV2-PE-C (1×10 10vg) were mixed in a total volume of 2 μl.
[0069] 1.3, such as Figure 2 The virus was concentrated in phosphate-buffered saline using Centricon tubes (Vivaspin 20, Sartorius) to a final titer of 1 × 10 13 vg / ml. AAV was then injected subretinaly in Rd1 mice using a sterile beveled 30-gauge needle to make an incision in the flat part of the nasal side of the eyeball. Next, a microsyringe equipped with a 32-gauge blunt-end needle (Hamilton) was inserted into the inner eye through the incision and penetrated the retina to achieve subretinal injection.
[0070] 1.4. Behavioral experiments were performed 3 weeks after the injection, and the mice were killed 4 weeks after the injection for subsequent molecular and biochemical experiments.
[0071] Experimental Results
[0072] The results are as follows Figure 3 As shown, Rd1 mice were killed 4 weeks after injection and their eyeballs were ground. Tissue DNA was extracted and the in vivo editing efficiency was detected to be 31.55% on average through specific amplification and deep sequencing (see Appendix Figure 3 A), and approximately 39% protein expression was restored after editing (Appendix Figure 3 B) to achieve the change of protein from nothing to something.
[0073] It is worth noting that the inventors of this application spent a lot of time screening the dual AAV vector system. Indeed, as reported in the prior art, there may be antagonism between multiple vectors, and the editing efficiency of multiple vectors is lower than that of a single vector. Especially in in vivo editing, the editing efficiency of multiple vectors is difficult to control. In the end, the inventors of this application screened a dual vector system with an editing efficiency of 31.55% from a large number of multi-vector combinations.
[0074] Example 2 Dual AAV vector system in vivo PE editing significantly inhibits retinal degeneration
[0075] Retinal section staining was performed 4 weeks after PE editing in mice in Example 1.
[0076] Normal rd1 mice show obvious retinal degeneration about three weeks after birth, characterized by extreme thinning of the outer nuclear layer and photoreceptor cell layer.
[0077] Retinal sections of rd1 mice were stained after PE treatment for 4 weeks, and rhodopsin antibody was used to label rod photoreceptors. It was found that PE editing significantly inhibited rod photoreceptor degeneration, and the thickness of the photoreceptor layer where rod photoreceptors are located was significantly higher than that of the untreated group (see Appendix). Figure 4AB), HE staining also showed that the thickness of the outer nuclear layer was significantly thicker than that of the untreated rd1 mouse group and there was a statistical difference (Appendix Figure 4 CD).
[0078] Example 3 Dual AAV vector system in vivo PE editing significantly improves visual function in rd1 mice
[0079] Three weeks after PE editing in mice in Example 1, rd1 mice underwent a series of behavioral experimental tests.
[0080] The pupil light response experiment was to give each group the same intensity of light stimulation after 2 hours of dark adaptation, and the infrared camera captured the changes in pupil size. The results showed that the wild-type mice had obvious pupil constriction after light stimulation, while the pupil size of the rd1 mice had almost no significant change. The PE-edited rd1 mice recovered some of their pupil light reflex ability (see Appendix Figure 5 AB).
[0081] The light-dark box experiment is to connect a light box and a dark box of equal size through a small passage, and mice can enter and exit freely (see Appendix). Figure 5 C), after the mice were placed in the light and dark box for 2 minutes, the time they spent in the dark box was counted. Wild-type mice were more inclined to stay in the dark box, and the results showed that the PE-edited mice spent more time in the dark box, close to that of wild-type mice (see Appendix Figure 5 D).
[0082] The visual cliff experiment is to place half of the transparent acrylic box on the experimental table and the other half suspended in the air. The bottom of the box and the ground are covered with checkerboards to create a visual cliff effect (see attached). Figure 5 E). Wild-type mice prefer to move on the safe side of the experimental platform, while rd1 mice spend similar amounts of time in both areas, showing no preference. The trajectory map shows the activity trajectories of mice, and the heat map shows the cumulative time of mice at specific locations. The results show that the PE-treated mice spend less time on the visual cliff side and have fewer trajectories than the untreated rd1 mice, suggesting that visual function has recovered to a certain extent (Appendix Figure 5 FG).
[0083] The applicant declares that, in the description of the above specification:
[0084] The descriptions of the terms "this embodiment", "an embodiment of the present invention", "as shown in...", "further", "a further improved technical sub-scheme", etc., mean that the specific features, structures, materials or characteristics described in the embodiment or example are included in at least one embodiment or example of the present invention; in this specification, the schematic expressions of the above terms are not necessarily for the same embodiment or example, and the specific features, structures, materials or characteristics described may be combined or combined in a suitable manner in any one or more embodiments or examples; in addition, a person of ordinary skill in the art may combine or combine the different embodiments or examples and the features of the different embodiments or examples described in this specification without causing any contradiction.
[0085] Finally, it should be noted that:
[0086] The above embodiments are only used to illustrate the technical solutions of the present invention, but not to limit them.
[0087] Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some or all of the technical features therein, and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention. The non-essential improvements, adjustments or replacements made by those skilled in the art based on the contents of this specification are all within the scope of protection required by the present invention.
Claims
1. A dual AAV vector system, characterized in that: Including AAV2-PE-N vector and AAV2-PE-C vector, The AAV-PE-N vector comprises a DNA sequence encoding epegRNA, nsgRNA and the amino front terminus of nCas9; The AAV-PE-C vector comprises a DNA sequence encoding the carboxyl end of nCas9 and a reverse transcriptase truncation; The epegRNA can recognize the mutation site of PDE6B; The epegRNA is a pegRNA with a pseudoknot-like structure added to the 3' end; The AAV2-PE-N vector and the AAV2-PE-C vector are used in combination to treat retinitis pigmentosa.
2. The dual AAV vector system according to claim 1, wherein The amino front end of the nCas9 refers to a DNA sequence encoding amino acids 1-713, and the carboxyl rear end of the nCas9 refers to a DNA sequence encoding amino acids 714-1368.
3. The dual AAV vector system of claim 1, wherein: The sequence of the pseudoknot-like structure of the epegRNA is SEQ ID NO.
1.
4. The dual AAV vector system of claim 1, wherein: The reverse transcriptase truncation is a reverse transcriptase truncation lacking the RnH functional domain.
5. The dual AAV vector system of claim 1, wherein: The AAV is selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV-DJ, AAV-DJ8, AAV-DJ9, AAVrh8, AAVrh8R and AAVrh10.
6. Use of the dual AAV vector system according to any one of claims 1 to 5 in the preparation of gene drugs for treating retinitis pigmentosa.
7. The use according to claim 6, characterized in that The retinitis pigmentosa is PDE6B mutant retinitis pigmentosa.
8. The use according to claim 6, characterized in that The dual AAV vector system comprises an AAV2-PE-N vector and an AAV2-PE-C vector, and the effective dose of the AAV2-PE-N vector and the AAV2-PE-C vector is not less than 1×10 10 vg, the AAV2-PE-N vector and AAV2-PE-C vector are administered by injection.
9. A method for constructing a dual AAV vector system, characterized in that: The following steps are involved: S1, prepare the trans-splicing PE plasmid, PCR amplify the sequence encoding the PE-N terminus and the splicing donor, and clone it into the px601 plasmid using a DNA assembly kit; S2. PCR amplify the splice acceptor, the sequence encoding the PE-C terminus and the WPRE sequence, and clone them into the pX601 plasmid. S3. Co-transfect the plasmids prepared in steps S1 and S2, the AAV capsid plasmid, and the helper plasmid into mammalian cells. S4. After transfection, the cells were lysed; then the dual AAV vector system was obtained by iodixanol gradient ultrapurification.
10. The method for constructing a dual AAV vector system according to claim 9, characterized in that: The mammalian cells are HEK 293T cells.