SgRNA combination for accurately editing dairy cow BLG gene, primer and application

Abstract

The invention relates to the technical field of gene engineering and cell engineering, in particular to an sgRNA combination for precisely editing a dairy cow BLG gene, a primer and application. The sgRNA combination comprises: sgRNA1, the sequence of which is as shown in SEQ ID NO. 1; the sequence of the sgRNA2 is as shown in SEQ ID NO. 2; the sequence of the sgRNA3 is as shown in SEQ ID NO. 3; and the sequence of the sgRNA4 is as shown in SEQ ID NO. 4. The BLG gene edited mammary epithelial cells and the BLG gene single base edited dairy cow can be successfully obtained, and the method has a wide application prospect in the aspect of dairy cow breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering and cell engineering, and in particular to a sgRNA combination, primers and applications for accurately editing the BLG gene of dairy cows. Background Art

[0002] Milk is one of the most common allergens for food allergies. Milk allergy is common in infants and young children, and the incidence rate is on the rise. About 2% to 7% of infants and children have milk allergies, which seriously affects the absorption and utilization of dairy nutrition. The β-lactoglobulin encoded by the BLG gene is one of the main components of milk protein and the main allergen that causes allergies. Therefore, removing β-lactoglobulin from milk can effectively reduce its allergenicity. Using biotechnology, the BLG gene of dairy cows is knocked out through gene editing, so that it cannot be expressed normally. The milk produced does not contain lactoglobulin, creating a low-allergen dairy cow population, and fundamentally solving the problem of milk BLG protein allergy.

[0003] The protein encoded by the BLG gene is β-lactoglobulin, which consists of 162 amino acid residues and 18kDa in size. β-lactoglobulin consists of two subunits, each of which contains a free sulfhydryl group (Cys121) and two disulfide bonds (Cys106-Cys119 and Cys160-Cys66). This structure gives β-lactoglobulin a compact spherical structure, and the N-terminus of the protein is not easily destroyed. This structure makes β-lactoglobulin highly allergenic. The immunoglobulin E (IgE) antigen epitopes of β-lactoglobulin are located at 47-60aa, 67-78aa, 75-86aa, 127-144aa, 141-152aa, etc. of the peptide segment.

[0004] CRISPR / Cas9 technology is the third generation of gene editing technology, which is more efficient, simple and economical. This technology is widely used in livestock breeding. CRISPR / Cas9 technology can produce insertion and deletion mutations in the coding region of the target gene under the guidance of specific sgRNA, destroy the normal coding of the gene, and achieve the purpose of gene knockout. The antigenic epitope of the BLG gene is located after 40aa. The sgRNA designed for the first and second exons of the BLG gene of dairy cows can effectively achieve the purpose of knocking out the BLG gene. However, the efficiency of frameshift mutation mediated by a single sgRNA is low, and the gene knockout effect is not obvious. In the gene editing of livestock, the gene editing efficiency determines the preparation cost of gene-edited animals, so it is crucial to improve the gene editing efficiency. Summary of the invention

[0005] The purpose of the present invention is to provide a sgRNA combination, primers and applications for accurately editing the BLG gene of dairy cows to solve the above-mentioned problems. The present invention can successfully obtain BLG gene-edited mammary epithelial cells and BLG gene single-base edited dairy cows.

[0006] The technical solution adopted by the present invention to achieve the technical purpose is: The present invention provides a sgRNA combination for accurately editing the BLG gene of dairy cows, comprising: sgRNA1: 5'-CATTGTCACCCAGACCATGA AGG -3', as shown in SEQ ID NO.1; sgRNA2: 5'-ATCCAGGCCCTTCATGGTCT GGG -3', as shown in SEQ ID NO.2; sgRNA3: 5'-GGAGATGTCGCTGGCCGCCA TGG -3', as shown in SEQ ID NO.3; sgRNA4: 5'-gatcctgctgcagaaatggt ggg -3', as shown in SEQ ID NO.4.

[0007] The present invention also provides a primer for amplifying the above-mentioned sgRNA combination, comprising: sgRNA1-F: ACCGcattgtcacccagaccatga, as shown in SEQ ID NO.5; sgRNA1-R: AAACtcatggtctgggtgacaatg, as shown in SEQ ID NO.6; sgRNA2-F: ACCGATCCAGGCCCTTCATGGTCT, as shown in SEQ ID NO. 7; sgRNA2-R: AAACAGACCATGAAGGGCCTGGAT, as shown in SEQ ID NO.8; sgRNA3-F: ACCGGGAGATGTCGCTGGCCGCCA, as shown in SEQ ID NO.9; sgRNA3-R: AAACTGGCCAAGGAGTACCAAGTC, as shown in SEQ ID NO.10; sgRNA4-F: ACCGGATCCTGCTGCAGAAATGGT, as shown in SEQ ID NO.11; sgRNA4-R:AAACACCATTTCTGCAGCAGGATC, as shown in SEQ ID NO.12.

[0008] The present invention further provides a recombinant expression vector comprising the above sgRNA combination.

[0009] Preferably, the recombinant expression vector is obtained by connecting each sgRNA to the pGL3-U6-sgRNA-mCherry-puromycin vector. pGL3-U6-sgRNA-mCherry-puromycin is transformed from pGL3-U6-sgRNA-EGFP (addgene: 107721) by a public method (Yao Liu, Xiangyang Li, Siting He, Shuhong Huang, Chao Li, Yulin Chen, Zhen Liu, Xingxu Huang, Xiaolong Wang. Efficient Generation of Mouse Models With the Prime Editing System. Cell Discov. 2020Apr 28;6:27.) and can express cherry red fluorescent protein.

[0010] The present invention further provides the use of the above-mentioned sgRNA combination in editing the BLG gene of dairy cows.

[0011] Preferably, the application includes the application in obtaining BLG gene-edited mammary epithelial cells and BLG gene single-base edited cows.

[0012] Preferably, the method for obtaining BLG gene-edited mammary epithelial cells comprises: culturing a bovine mammary epithelial cell line in vitro, inoculating, and when the cells grow to a confluence of 70-80%, co-transfecting the cells with a Cas9 expression plasmid and one or more sgRNA expression plasmids, and screening the transfected cells with puromycin and blasticidin 48 hours after transfection, replacing the ordinary culture medium after 7 days, and continuing to culture to obtain a monoclonal cell line.

[0013] More preferably, the Cas9 expression plasmid is pST1374-NLS-flag-linker-Cas9 plasmid; the sgRNA expression plasmid is pGL3-U6-sgRNA-mCherry-puromycin plasmid; and the working concentration of puromycin is 1.8-2.0 μg•mL -1 The working concentration of blasticidin is 6~8 μg•mL -1 .

[0014] Preferably, the method for obtaining a cow with single-base editing of the BLG gene comprises: culturing mature oocytes in vitro through in vitro fertilization or parthenogenetic activation of pronuclear embryos, performing cytoplasmic microinjection, mixing one or more sgRNAs in the sgRNA combination with Cas9 mRNA or Cas9 protein to obtain a microinjection mixture, injecting 3 to 6 pL of the mixture into each embryo, and culturing the embryos to the morula to blastocyst stage.

[0015] Preferably, in the microinjection mixture, the final concentration of each sgRNA is 50-80 ng / μL, and the final concentration of Cas9 mRNA or Cas9 protein is 100-150 ng / μL.

[0016] The beneficial effects of the present invention are: The present invention designs multiple sgRNAs to jointly target a gene, which can effectively improve the efficiency of gene editing and can be used to accurately edit the BLG gene of dairy cows. Ultimately, BLG gene-edited mammary epithelial cells and BLG gene single-base edited dairy cows can be successfully obtained, which has broad application prospects in dairy cow breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 sgRNA sequence information in the embodiments of the present invention.

[0018] Figure 2 Detection of sgRNA in vitro cutting efficiency in the embodiments of the present invention.

[0019] Figure 3 The blastocyst-stage bovine embryo obtained in the embodiment of the present invention.

[0020] Figure 4 In the embodiment of the present invention, the embryo PCR amplification results are edited.

[0021] Figure 5 The editing application of the BLG gene at sgRNA2 in the embodiment of the present invention.

[0022] Figure 6 Screening of monoclonal cell lines in the examples of the present invention.

[0023] Figure 7 Sequencing results of the BLG gene sgRNA2-edited cell line in the embodiment of the present invention.

[0024] Figure 8 WB analysis of BLG knockout in the present invention, Note: The control group is unedited cells, 1-3 BLG chimeric cells, 4. BLG Knockout cells. DETAILED DESCRIPTION

[0025] The present invention is described in detail below in conjunction with specific implementation methods. The following specific embodiments are helpful for those skilled in the art to further understand the present invention, but do not limit the present invention in any form.

[0026] Example

[0027] The present invention is mainly achieved by the following steps: 1. sgRNA design Combination Figure 1 As shown, the present invention designs 4 sgRNAs on the first and second exons according to the bovine BLG gene sequence (NC_037338), wherein: Design sgRNA 1 for the first exon: 5'- CATTGTCACCCAGACCATGA AGG -3' and sgRNA2: 5'-ATCCAGGCCCTTCATGGTCT GGG -3'; Design sgRNA3 for the second exon: 5'-GGAGATGTCGCTGGCCGCCA TGG -3' and sgRNA4: 5'-gatcctgctgcagaaatggt ggg -3'.

[0028] First, the annealing primer sequences of each sgRNA were designed according to the sgRNA expression vector pGL3-U6-sgRNA-mCherry-puromycin. According to the insertion site information of the sgRNA expression vector, ACCG was added before the forward primer of the sgRNA and AAAC was added before the reverse primer to form sticky ends. The primers were synthesized by Qingke Biotechnology Co., Ltd.

[0029] The specific sgRNA primer sequences are shown in Table 1: Table 1. Different sgRNA sequences and corresponding annealing primer sequences

[0030] 2. sgRNA annealing and vector construction The synthesized single-stranded primers were annealed to form double-stranded DNA fragments according to the following annealing procedure: the upstream and downstream primers of sgRNA were diluted to 100 μmol / L with enzyme-free water, 5 μL of each upstream and downstream were mixed, denatured at 98 °C for 10 min, and then cooled to room temperature for annealing.

[0031] sgRNA expression vector pGL3-U6-sgRNA-mCherry-puromycin with restriction enzymes BnS-HF®v2 (NEB: R3733V) was linearized and ligated with the annealed sgRNA using T4 ligase to obtain the recombinant expression vectors of each sgRNA.

[0032] Linearization procedure: sgRNA expression vector BnS -HF®v2 enzyme digestion system, add sgRNA expression vector pGL3-U6-sgRNA-mCherry-puromycin 1μg, BnS 1μL 、 1× rCutSmart™ buffer (NEB: R3733V) 5 μL, incubate in a 37°C water bath for 60 min, and recover the linearized product.

[0033] Ligation procedure: 50 ng of linearized vector, 1 μL of sgRNA annealing product, 1 μL of T4 ligase, 1 μL of 10× ligation buffer, make up to 10 μL with enzyme-free water, and place in a metal bath at 16°C for 12 h.

[0034] 3. In vitro transcription of sgRNA Primer sgRNA-F and downstream primer sgRNA-R with T7 promoter were designed and synthesized. The amplified sgRNA was transcribed in vitro by template PCR and then purified by gel recovery. TM The sgRNA was transcribed in vitro according to the T7 Transcription Kit instruction manual, and the quality was checked by gel electrophoresis and Nanodrop.

[0035] 4. Verification of in vitro cleavage efficiency The target fragment of BLG gene amplification was used as the substrate template, Cas9 protein (GenCrispr NLS-Cas9-NLSNuclease, GenScript: Z03469) and sgRNA were added, and the in vitro cutting system was Cas9 protein 20ng / μL, 10×Reactionbuffer 2μL (GenScript: Z03469), sgRNA 50ng / μL, BLG DNA 20 ng / μL, water was added to 20μL, and incubated at 37℃ for 3h. After the reaction, all products were verified by gel electrophoresis. Grayscale analysis was performed using ImageJ software to compare the grayscale values ​​of the cut band and the control band to obtain the editing efficiency of sgRNA, such as Figure 2 shown.

[0036] 5. Application of sgRNA in bovine embryos Obtain bovine ovaries from slaughterhouses, culture mature oocytes in vitro, and perform cytoplasmic microinjection on pronuclear embryos after in vitro fertilization or parthenogenetic activation. Mix one or more of the verified sgRNAs sgRNA2 and sgRNA4 and Cas9 mRNA or Cas9 protein to obtain a microinjection mixture. In this mixture, the final concentration of each sgRNA is 50 ng / μL, and the final concentration of Cas9 mRNA or Cas9 protein is 100 ng / μL. Each embryo is injected with 5 pL of the mixture. Embryos are cultured to the morula to blastocyst stage ( Figure 3 ).

[0037] 6. Detection of edited embryos The above morulae or blastocysts were collected into enzyme-free PCR tubes, with one embryo placed in each tube. Whole genome amplification of a single embryo was performed using the instructions of the single cell whole genome DNA amplification kit (Discover-sc Single Cell WGA Kit, N603, Nanjing Novozymes).

[0038] 7. PCR testing Randomly select the above 20 embryonic single-cell whole genome DNA amplification products, take 0.5~1μL as PCR template, and amplify with the following primers: F: tcctcgtagaggaagcaaccc, R: ataagcagccttgggtgga; the amplification product can cover all sgRNA sites; the amplification product is subjected to electrophoresis ( Figure 4 ) and sequencing verification, a total of 17 were successfully amplified and sequenced, and the editing status of sgRNA2 was detected ( Figure 5 ).

[0039] 8. Application of sgRNA in cells Bovine mammary epithelial cell lines (bMECs) were cultured in vitro and seeded in 6-well plates. When the cells grew to a confluence of 70-80%, the Cas9 expression plasmid pST1374-NLS-flag-linker-Cas9 (addgene: 44758) and one or more sgRNA expression plasmids pGL3-U6-sgRNA-mCherry-puromycin were co-transfected into the cells. After 48 hours of transfection, the transfected cells were screened at a working concentration of 1.8 μg / mL puromycin and 6 μg / mL blasticidin. After 7 days, the normal culture medium was replaced and the monoclonal cell line was obtained by continuous culture. Figure 6 As shown. Monoclonal cell lines were collected to extract cell DNA and protein for verification of gene editing effects.

[0040] 9. Verification of gene-edited cell lines The sequence of the target position was amplified by PCR, and the obtained cell line was confirmed to be a bovine mammary epithelial cell line edited by BLG gene through sequencing analysis. Several BLG knockout cell lines were obtained through Sanger sequencing analysis ( Figure 7 ).

[0041] 10. Verification of protein expression in knockout BLG cells Single cell clone cell lines were lysed with RIPA lysis buffer (Biyuntian) to obtain protein lysate, and total cell protein was separated using 15% SDS-PAGE gel. BLG protein was verified by immunoblotting using primary antibody (anti-BLG, 1:2000, Abmart: PK02325) and horseradish peroxidase-labeled goat anti-rabbit secondary antibody (1:5000), and GAPDH (1:3000, Proteintech: 10494-1-AP) was used as an internal reference to analyze the relative expression level of BLG protein. Immunoblotting procedure: SDS-PAGE gel electrophoresis total protein loading amount 20 μg, electrophoresis 110v 60min, PVDF membrane transfer 260 mA 30 min, 5% skim milk powder blocking at room temperature for 1h, primary antibody incubation at 4°C overnight, secondary antibody incubation for 1h, ECL chemiluminescence detection.

[0042] like Figure 8 As shown, BLG knockout cells were successfully obtained.

[0043] Obviously, the above embodiments of the present invention are merely examples to more clearly illustrate the present invention, and are not limitations on the implementation methods of the present invention. For ordinary technicians in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is impossible to list all the implementation methods here. All obvious changes or modifications derived from the technical solution of the present invention are still within the protection scope of the present invention.

Claims

1. A sgRNA combination for precise editing of the BLG gene in dairy cows, characterized in that: include: sgRNA1: 5'-CATTGTCACCCAGACCATGA AGG -3', as shown in SEQ ID NO.1; sgRNA2: 5'-ATCCAGGCCCTTCATGGTCT GGG -3', as shown in SEQ ID NO.2; sgRNA3: 5'-GGAGATGTCGCTGGCCGCCA TGG -3', as shown in SEQ ID NO.3; sgRNA4: 5'-gatcctgctgcagaaatggt ggg -3', as shown in SEQ ID NO.

4.

2. A primer for amplifying the sgRNA combination according to claim 1, characterized in that: include: sgRNA1-F: ACCGcattgtcacccagaccatga, as shown in SEQ ID NO.5; sgRNA1-R: AAACtcatggtctgggtgacaatg, as shown in SEQ ID NO.6; sgRNA2-F: ACCGATCCAGGCCCTTCATGGTCT, as shown in SEQ ID NO. 7; sgRNA2-R: AAACAGACCATGAAGGGCCTGGAT, as shown in SEQ ID NO.8; sgRNA3-F: ACCGGGAGATGTCGCTGGCCGCCA, as shown in SEQ ID NO.9; sgRNA3-R: AAACTGGCCAAGGAGTACCAAGTC, as shown in SEQ ID NO.10; sgRNA4-F: ACCGGATCCTGCTGCAGAAATGGT, as shown in SEQ ID NO.11; sgRNA4-R:AAACACCATTTCTGCAGCAGGATC, as shown in SEQ ID NO.

12.

3. A recombinant expression vector comprising the sgRNA combination of claim 1.

4. The recombinant expression vector according to claim 3, characterized in that The recombinant expression vector is obtained by connecting each sgRNA to the pGL3-hU6-sgRNA-mCherry-puromycin vector.

5. Use of the sgRNA combination described in claim 1 in obtaining BLG gene-edited mammary epithelial cells and BLG gene single-base edited cows.

6. The use according to claim 5, characterized in that: The method for obtaining BLG gene-edited mammary epithelial cells includes: culturing a bovine mammary epithelial cell line in vitro, inoculating, and when the cells grow to a confluence of 70-80%, co-transfecting the cells with a Cas9 expression plasmid and one or more sgRNA expression plasmids, screening the transfected cells with puromycin and blasticidin 48 hours after transfection, replacing the ordinary culture medium after 7 days, and continuously culturing to obtain a monoclonal cell line.

7. The use according to claim 6, characterized in that: The Cas9 expression plasmid uses pST1374-NLS-flag-linker-Cas9 plasmid; the sgRNA expression plasmid uses pGL3-U6-sgRNA-mCherry-puromycin plasmid; the working concentration of puromycin is 1.8~2.0 μg•mL -1 The working concentration of blasticidin is 6~8 μg•mL -1 .

8. The use according to claim 5, characterized in that: The method for obtaining a BLG gene single-base edited dairy cow comprises: culturing mature oocytes in vitro, fertilizing pronuclear embryos in vitro or parthenogenetically activated, performing cytoplasmic microinjection, mixing one or more sgRNAs in the sgRNA combination with Cas9 mRNA or Cas9 protein to obtain a microinjection mixture, injecting 3 to 6 pL of the mixture into each embryo, and culturing the embryos to the morula to blastocyst stage.

9. The use according to claim 8, characterized in that: In the microinjection mixture, the final concentration of each sgRNA is 50-80 ng / μL, and the final concentration of Cas9 mRNA or Cas9 protein is 100-150 ng / μL.

Images