Application of herba siegesbeckiae composition in preparation of product for improving heart mitochondrial dysfunction

Abstract

The invention relates to the field of biological medicines, in particular to an application of a siegestistilbene composition in preparation of a product for improving heart mitochondrial dysfunction. According to the application, various experimental technologies such as pharmacodynamic evaluation, systematic biology, molecular biology and the like are applied, the pharmacodynamic effect and the regulation mechanism of XJQ for preventing and treating chronic heart failure are systematically discussed from the animal level, the cell level and the molecular level, and it is clear that XJQ can significantly enhance the heart function of a chronic heart failure mouse induced by pressure load, relieve myocardial damage and inhibit myocardial hypertrophy; the XJQ has the advantages that the XJQ can be used for relieving myocardial fibrosis, so that chronic heart failure is relieved, which is related to up-regulation of PGC-1alpha, activation of a PPARalpha / PGC-1alpha pathway, up-regulation of NRF1, TFAM and Mfn2, down-regulation of Drp1, promotion of mitochondrial biogenesis, inhibition of mitochondrial division, promotion of mitochondrial fusion, improvement of mitochondrial dysfunction and enhancement of myocardial energy metabolism, and the application range of the XJQ is expanded.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to an application of a Siegesbeckia scoparia composition in preparing a product for improving cardiac mitochondrial dysfunction. Background Art

[0002] Chronic heart failure (CHF) is a complex clinical syndrome caused by various cardiac structural or functional diseases that result in impaired ventricular filling and / or ejection capacity. It is also the terminal stage of the development of various cardiovascular diseases. It is characterized by high morbidity, low survival rate, and high rehospitalization rate. Its 5-year survival rate is less than 50%, and the rehospitalization rate is as high as 30%. With the acceleration of population aging and the increase of risk factors such as hypertension, diabetes, and hyperlipidemia, the incidence of cardiovascular diseases has increased year by year, and the incidence of chronic heart failure has also shown a significant upward trend. As the last battlefield for the prevention and control of cardiovascular diseases, chronic heart failure has risen to a major global public health issue. In recent years, modern medicine has made great progress in the prevention and treatment of chronic heart failure, but the mortality rate and rehospitalization rate of chronic heart failure remain high, and the overall prognosis is still poor. The effective prevention and treatment of chronic heart failure still faces huge challenges.

[0003] Aiming at the core pathogenesis of chronic heart failure, namely qi deficiency, blood stasis and water retention, researchers have developed an effective empirical prescription for treating chronic heart failure, Xijiaqi (XJQ), after long-term clinical practice. XJQ is composed of three Chinese herbs: Astragalus (40g), Herba Siegesbeckiae (10g) and Herba Cyperi (2.5g). Astragalus replenishes vital energy, warms yang and transforms water retention, so as to replenish the root of qi and yang deficiency; Herba Siegesbeckiae clears the meridians and detoxifies, dispels wind and dampness, so as to clear the symptoms of blood stasis; Herba Cyperi is pungent, warms and promotes yang, promotes diuresis and reduces swelling, so as to eliminate overflowing water. The combination of these herbs can replenish heart qi and benefit the heart body, clear the diseased meridians and eliminate blood stasis, warm yang qi and transform water retention, and has a good clinical effect on patients with chronic heart failure of qi deficiency and blood stasis type.

[0004] However, the functional targets and pharmacodynamic mechanisms of Xijiaqi prescription are still not fully understood, and its scope of application is limited. Summary of the invention

[0005] Based on this, the present invention provides the use of a Siegesbeckia composition in the preparation of a product for improving cardiac mitochondrial dysfunction, wherein the Siegesbeckia composition is prepared from 38 to 42 parts by mass of Astragalus, 8 to 12 parts by mass of Siegesbeckia herb and 2 to 3 parts by mass of Perennial Herb.

[0006] In one embodiment, the improvement of cardiac mitochondrial dysfunction includes promoting mitochondrial biogenesis, inhibiting mitochondrial fission, and promoting mitochondrial fusion.

[0007] In one embodiment, the Siegesbeckia composition is prepared from 40 parts by weight of Astragalus, 10 parts by weight of Siegesbeckia herb and 2.5 parts by weight of Perennial Herb.

[0008] The present invention also provides the use of the Siegesbeckia sieboldii composition in preparing a product for improving the expression level of cardiac mitochondrial function-related genes, wherein the mitochondrial function-related genes are one or more of NRF1, TFAM and Mfn2.

[0009] In one embodiment, the Siegesbeckia sieboldii composition increases the expression level of the mitochondrial function-related gene by increasing the expression level of cardiac PPARα or PGC-1α.

[0010] The present invention also provides the use of the Siegesbeckia scoparia composition in preparing a product for reducing the expression level of cardiac Drp1 gene.

[0011] In one embodiment, the Siegesbeckia sieboldii composition reduces the expression level of the Drp1 gene by increasing the expression level of cardiac PPARα or PGC-1α.

[0012] In one embodiment, the product is a pharmaceutical preparation.

[0013] In one embodiment, the pharmaceutical preparation comprises a pharmaceutically acceptable excipient.

[0014] In one embodiment, the dosage form of the pharmaceutical preparation is tablets, capsules, granules, oral solution or injection.

[0015] The beneficial effects of the present invention are:

[0016] The present invention uses a variety of experimental techniques such as pharmacodynamic evaluation, system biology, molecular biology, etc., and systematically explores the pharmacodynamic effects and regulatory mechanisms of XJQ in preventing and treating chronic heart failure from the animal level, cellular level, and molecular level, and clarifies that XJQ can significantly enhance the cardiac function of mice with chronic heart failure induced by pressure load, reduce myocardial damage, inhibit myocardial hypertrophy, and reduce myocardial fibrosis, thereby alleviating chronic heart failure. This is related to upregulating PGC-1α, activating the PPARα / PGC-1α pathway, upregulating NRF1, TFAM, and Mfn2, downregulating Drp1, promoting mitochondrial biogenesis, inhibiting mitochondrial fission, promoting mitochondrial fusion, improving mitochondrial dysfunction, and then enhancing myocardial energy metabolism, thereby expanding the application scope of XJQ. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 The experimental results of the effect of XJQ on the PPARα / PGC-1α signaling pathway in myocardial tissue in Example 1 of the present invention are as follows; wherein, A is the relative expression of PPARα mRNA in myocardial tissue of each group of mice (n=6); B is the relative expression of PGC-1α mRNA in myocardial tissue of each group of mice (n=6); C is a representative Western blot of PPARα protein in myocardial tissue of each group of mice; D is the relative expression of PPARα protein in myocardial tissue of each group of mice (n=4); E is a representative Western blot of PGC-1α protein in myocardial tissue of each group of mice; F is the relative expression of PGC-1α protein in myocardial tissue of each group of mice (n=5); compared with the Sham group, * P<0.05; compared with TAC group, # P < 0.05;

[0019] Figure 2 The electron microscopic images of the ultrastructure of mitochondria in myocardial cells of each group of mice in Example 1 of the present invention;

[0020] Figure 3 The experimental results of the effect of XJQ on mitochondrial function of myocardial tissue in Example 1 of the present invention are as follows; wherein A is a representative Western blot of NRF1 and TFAM proteins in myocardial tissue of each group of mice; B is the relative expression of NRF1 protein in myocardial tissue of each group of mice (n=4); C is the relative expression of TFAM protein in myocardial tissue of each group of mice (n=4); D is a representative Western blot of Drp1 protein in myocardial tissue of each group of mice; E is the relative expression of Drp1 protein in myocardial tissue of each group of mice (n=3); F is a representative Western blot of Mfn2 protein in myocardial tissue of each group of mice; G is the relative expression of Mfn2 protein in myocardial tissue of each group of mice (n=4); compared with the Sham group, * P<0.05; compared with TAC group, # P < 0.05;

[0021] Figure 4The experimental results of the effect of XJQ on the PPARα / PGC-1α signaling pathway in myocardial cells in Example 2 of the present invention are as follows; wherein, A is the relative expression of PPARα mRNA in myocardial cells of each group (n=6); B is the relative expression of PGC-1α mRNA in myocardial cells of each group (n=6); C is a representative Western blot of PPARα and PGC-1α proteins in myocardial cells of each group; D is the relative expression of PPARα protein in myocardial cells of each group (n=4); E is the relative expression of PGC-1α protein in myocardial cells of each group (n=4); compared with the Control group, * P<0.05; compared with AngⅡ group, # P < 0.05;

[0022] Figure 5 The results of the experiment on the effect of XJQ on the mitochondrial function of cardiomyocytes in Example 2 of the present invention are shown in Figure 2; wherein A is a representative Western blot of NRF1, TFAM and Mfn2 proteins in each group of cardiomyocytes; B is the relative expression of NRF1 protein in each group of cardiomyocytes (n=3); C is the relative expression of TFAM protein in each group of cardiomyocytes (n=4); D is the relative expression of Mfn2 protein in each group of cardiomyocytes (n=4); compared with the Control group, * P<0.05; compared with AngⅡ group, # P < 0.05;

[0023] Figure 6 The experimental results of the expression of PGC-1α in myocardial cells after PGC-1α lentivirus infection in Example 3 of the present invention are as follows; wherein A is the relative expression of PGC-1α mRNA in myocardial cells of each group (n=6); B is a representative Western blot of PGC-1α protein in myocardial cells of each group; C is the relative expression of PGC-1α protein in myocardial cells of each group (n=3); compared with the sh-NC group, * P<0.0;

[0024] Figure 7 The experimental results of the effect of XJQ on sh-PGC-1α cardiomyocyte injury in Example 3 of the present invention are as follows; wherein A is the relative expression of ANP mRNA in cardiomyocytes of each group (n=4); B is the relative expression of BNP mRNA in cardiomyocytes of each group (n=4); C is the relative expression of β-MHC mRNA in cardiomyocytes of each group (n=4); compared with the sh-NC group, * P<0.05; compared with sh-NC+AngⅡ group, # P<0.05; compared with sh-NC+XJQH+AngⅡ group, & P<0.05; compared with the sh-PGC-1α group, δP < 0.05;

[0025] Figure 8 The experimental results of the effect of XJQ on the NRF1 / TFAM signaling pathway of sh-PGC-1α cardiomyocytes in Example 3 of the present invention are shown in Figure 1; wherein, A is a representative Western blot of NRF1 and TFAM proteins in each group of cardiomyocytes; B is the relative expression of NRF1 protein in each group of cardiomyocytes (n=4); C is the relative expression of TFAM protein in each group of cardiomyocytes (n=4); compared with the sh-NC group, * P<0.05; compared with sh-NC+AngⅡ group, # P<0.05; compared with sh-NC+XJQH+AngⅡ group, & P<0.05; compared with the sh-PGC-1α group, δ P < 0.05;

[0026] Fig. 9 The experimental results of the effect of XJQ on mitochondrial fission and fusion of sh-PGC-1α cardiomyocytes in Example 3 of the present invention are as follows; wherein A is a representative Western blot of Drp1 and Mfn2 proteins in cardiomyocytes of each group; B is the relative expression of Drp1 protein in cardiomyocytes of each group (n=4); C is the relative expression of Mfn2 protein in cardiomyocytes of each group (n=4); compared with the sh-NC group, * P<0.05; compared with sh-NC+AngⅡ group, # P<0.05; compared with sh-NC+XJQH+AngⅡ group, & P<0.05; compared with the sh-PGC-1α group, δ P<0.05. DETAILED DESCRIPTION

[0027] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0028] Therefore, it is intended that the present invention covers such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present invention are disclosed in or are obvious from the following detailed description. Those of ordinary skill in the art will appreciate that this discussion is only a description of exemplary embodiments and is not intended to limit the broader aspects of the present invention.

[0029] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any form. For those skilled in the art, any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention should all be equivalent replacement methods and are included in the protection scope of the present invention.

[0030] Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0031] The inventor first found through myocardial tissue transcriptomics and serum non-targeted metabolomics analysis that XJQ may have an important effect on the fatty acid metabolism and PPAR signaling pathway of the failing heart, thereby regulating myocardial energy metabolism disorders and preventing and treating chronic heart failure. The energy metabolism of myocardial cells is closely related to the structure and functional state of mitochondria. Therefore, the embodiment will use transmission electron microscopy to observe the mitochondrial ultrastructure of myocardial cells in each group of mice, and use RT-qPCR and Western blot to detect the key regulatory factors PPARα and PGC-1α of the PPAR signaling pathway, mitochondrial function-related proteins nuclear respiratory factor 1 (NRF1), mitochondrial transcription factor A (TFAM), mitochondrial fission dynamin-related protein 1 (Drp1) and mitochondrial fusion protein 2 (Mfn2) expression, to explore the effect of XJQ on mitochondrial dysfunction in chronic heart failure.

[0032] Example 1

[0033] 1 Experimental Materials

[0034] 1.1 Experimental animals

[0035] Healthy 8-10 week old C57BL / 6J mice, male, ordered from Beijing Weitonglihua Experimental Animal Technology Co., Ltd., experimental animal production license number: SYXK (Beijing) 2022-0052. The mice were housed in the SPF barrier environment experimental animal center of Dongzhimen Hospital of Beijing University of Chinese Medicine, with a temperature of 24±2℃, a humidity of 55±5%, a 12h / 12h light-dark alternating light cycle every day, and free access to food and water. This experiment was reviewed by the Animal Experiment Ethics Committee of Dongzhimen Hospital and met the relevant experimental ethics requirements and was approved, with the ethics review number: 22-47. The animal experiment operation process strictly abides by the various provisions of experimental animal welfare and ethics, minimizes the number of experimental animals used, and reduces the pain during the operation.

[0036] 1.2 Main Reagents

[0037] The main reagents are shown in the table below, and other required reagents are also conventional commercially available products.

[0038]

[0039]

[0040] 2 Experimental methods

[0041] 2.1 XJQ drug preparation

[0042] XJQ is composed of 40g of Astragalus, 10g of Siegesbeckia, and 2.5g of Perennial Cortex, which was purchased from Dongzhimen Hospital of Beijing University of Chinese Medicine. XJQ crude drug was soaked in 10 times the volume of ultrapure water for 30min, boiled over high heat, then simmered for 30min, and the first decoction was filtered out. 8 times the volume of ultrapure water was added to the residue again, boiled over high heat, then simmered for 30min, and the second decoction was collected by filtration. The two collected decoctions were combined and continued to heat and boil, and concentrated into a high-dose decoction of XJQ (4 times the clinical dose) of 3.185g / mL (4 times the clinical dose), which was stored at 4°C.

[0043] 2.2 Preparation of aortic arch constriction (TAC) model

[0044] The pressure-loaded chronic heart failure model in mice was prepared by modified minimally invasive TAC surgery. The mice were adaptively fed for 3 days before surgery, and were fasted but not watered for 12 hours before modeling.

[0045] (1) Anesthesia and fixation: After weighing the mice, 0.5% sodium pentobarbital (10 μL / g) was injected intraperitoneally for anesthesia, and the mice were fixed in a supine position on the operating table with medical tape.

[0046] (2) Skin preparation and disinfection: Apply depilatory cream evenly on the neck and chest of the mouse. After 3 minutes, gently shave the hair with a depilatory board to fully expose the skin. Wipe the local skin with a medical iodine cotton ball for disinfection.

[0047] (3) Chest opening and expansion: Cut the skin from the neck to the middle of the chest of the mouse longitudinally, use ophthalmic forceps to bluntly separate the subcutaneous connective tissue and the muscles on both sides of the trachea, use forceps to clamp one side of the sternocleidomastoid muscle, cut the sternum along the suprasternal fossa to the upper edge of the second rib on the right side of the sternum, and cut the sternum horizontally at the upper edge of the second rib. Use ophthalmic forceps to gently separate the thymus tissue from the middle, fix it on the left and right sides with a chest expander, and expose the aortic arch.

[0048] (4) Threading: Use ophthalmic forceps to gently separate the tissues around the aortic arch. Insert a homemade curved hook with 5-0 non-absorbable sterile cotton thread vertically from below the aortic arch between the innominate artery and the left common carotid artery. When the hook is inserted about 2 mm, rotate 90° clockwise with the aortic arch as the center to expose the thread end. Pull out the thread end with forceps and slowly withdraw the curved hook to complete threading.

[0049] (5) Ligation: Grind the needle tip flat and bend a 27G needle into a 90° angle in the middle to make a cushion needle and place it above the aortic arch. Use forceps to tie a double knot above the aortic arch and the cushion needle for ligation. Gently lift the knot and slowly withdraw the cushion needle to narrow the aortic arch to the same diameter as the cushion needle, 0.4 mm. After ligation, a significant increase in the pulsation of the right common carotid artery can be observed.

[0050] (6) Suturing: After checking that the mice had no active bleeding, the upper edge of the sternum was sutured using the "8" method, the chest was closed layer by layer, the skin was sutured, and the mice were placed on a 37°C constant temperature heating pad until they woke up. The sham operation group did not undergo ligation, and the rest of the operations were the same.

[0051] 2.3 Experimental Grouping

[0052] One week after modeling, Doppler ultrasound was used to detect the blood flow velocity at the aortic arch stenosis, and animals with loose or tight ligation during model preparation were screened out. The innominate artery blood flow / left common carotid artery blood flow (RC / LC) = 5-10 was used as the criterion for the success of TAC surgery. The mice with successful modeling were randomly divided into a model group (TAC) and a high-dose XJQ group (XJQH+TAC) according to the random number table method. A sham operation group (Sham) was also set up.

[0053] 2.4 Medication intervention

[0054] After randomization, the XJQ group was given corresponding doses of drugs by gavage: the XJQH+TAC group was given 31.85 g / (kg·d) of XJQ by gavage. The Sham group and TAC group were given an equal amount of ultrapure water by gavage, with a gavage volume of 10 μL / g, once a day for 8 consecutive weeks.

[0055] 2.5 Collection of materials

[0056] After the mouse is deeply anesthetized, trim one side of the beard, press the skin around the eye on the same side to make the eyeball congested and protruding, clamp and quickly remove the eyeball with curved forceps, quickly turn the eye socket downward, let the blood drip into a 1.5mL EP tube, and gently press the mouse heart with the middle finger of the left hand to accelerate the heart to pump blood. Let it stand at room temperature for 4 hours, centrifuge at 4℃, 3000rpm, 15min after balancing, separate the serum, and freeze it at -80℃ for use in serum non-targeted metabolomics and heart failure markers.

[0057] After blood collection, the mouse was fixed in a supine position, the skin of the chest area was disinfected with alcohol, the chest cavity was opened, the heart was removed, and placed in a saline solution without DNA / RNA enzymes. The blood in the heart cavity was pumped out, and the water on the surface and in the heart cavity was dried with absorbent paper, and the whole heart weight was weighed. After weighing, the heart was placed on a scale plate and photographed for preservation. Then the heart was placed in a cryovial and frozen at -80°C for myocardial transcriptomics sequencing and molecular biology experiments. Alternatively, it was immersed in 4% paraformaldehyde, fixed for 24-48 hours, and paraffin sections were prepared for pathological experiments.

[0058] 2.6 RT-qPCR of myocardial tissue

[0059] (1) RNA extraction from myocardial tissue

[0060] (2) RNA concentration and purity detection

[0061] The extracted RNA solution was added dropwise to the UV spectrophotometer to detect its concentration and purity.

[0062] (3) RNA reverse transcription

[0063] 1) Take out the All-in-One First-Strand SuperMix Kit, thaw it on ice, vortex it, and centrifuge it briefly for later use.

[0064] 2) Prepare the following reaction system on ice:

[0065]

[0066]

[0067] 3) Mix the above reaction system by gently pipetting, centrifuge briefly, and incubate at 37°C for 2 minutes in a PCR instrument to remove DNA contamination in RNA.

[0068] 4) Incubate at 65°C for 2 min to inactivate dsDNase and place on ice until use.

[0069] 5) Prepare the following reaction system on ice:

[0070] Reagents Dosage The reaction product in step "2)" 10μL All-in-One First-Strand SuperMix 4μL Nuclease-Free Water 6μL

[0071] 6) Mix the above reaction system by gentle pipetting, centrifuge briefly, place in a PCR instrument and incubate at 50°C for 15 min, then at 80°C for 5 min, and store the obtained cDNA solution in a -80°C refrigerator.

[0072] (3) PCR reaction

[0073] 1) Take out the fast fluorescent quantitative PCR premix reagent SYBR Green, cDNA solution, and primers, thaw on ice, vortex, and centrifuge briefly for use.

[0074] 2) Prepare the following reaction system on ice:

[0075] Reagents Dosage cDNA template 2μL 2×SYBR Green 10μL Forward primer (10 μmol / L) 0.6μL Reverse primer (10 μmol / L) 0.6μL Nuclease-Free Water 6.8μL

[0076] 3) Mix the above reaction system by gentle pipetting, centrifuge briefly, and place in a PCR instrument to perform amplification reaction using a three-step method:

[0077]

[0078]

[0079] 4) Use 2 -△△CT The results were calculated by relative quantitative method, and the changes of mRNA levels in each group of samples were statistically analyzed. 2.7 Western blot detection of myocardial tissue

[0080] The operation steps are carried out according to conventional methods in the art, wherein the dilution ratio of anti-PPARα antibody is 1:1500, the dilution ratio of anti-PGC-1α antibody is 1:1000, the dilution ratio of anti-NRF1 antibody is 1:2000, the dilution ratio of anti-TFAM antibody is 1:1500, the dilution ratio of anti-Drp1 antibody is 1:1000, the dilution ratio of anti-Mfn2 antibody is 1:1500, and the dilution ratio of anti-GAPDH antibody is 1:5000.

[0081] 2.8 Electron microscopy of myocardial tissue

[0082] (1) After deep anesthesia, mice were fixed in the supine position, the chest area was disinfected, the heart was removed and placed in physiological saline, the residual blood was pumped out, and the heart was placed in a culture dish containing electron microscopy fixative. The left ventricular myocardial tissue was cut into 1 mm × 1 mm × 3 mm rectangles and immediately placed in electron microscopy fixative. The cells were fixed at room temperature in the dark for 2 h, and then fixed in a refrigerator at 4°C.

[0083] (2) Wash in PBS buffer three times, 15 min each time.

[0084] (3) Fix with 1% osmium acid (prepared in PBS) at room temperature in the dark for 2 h, and wash three times in PBS buffer, each time for 15 min.

[0085] (4) Place the tissue in 30% alcohol, 50% alcohol, 70% alcohol, 80% alcohol, 95% alcohol, 100% alcohol I, 100% alcohol II, 100% acetone I, and 100% acetone II, in sequence for 15 min each time.

[0086] (5) Acetone: 812 embedding agent = 1:1, 37°C, 4 h → Acetone: 812 embedding agent = 1:2, infiltration at 37°C overnight → Pure 812 embedding agent at 37°C, infiltration for 6 h, then pour pure 812 embedding agent into the embedding plate, insert the sample into the embedding plate, oven at 37°C overnight, and polymerize in a 60°C oven for 48 h.

[0087] (6) The resin block was cut into ultra-thin sections with a thickness of 60 nm and the sections were scooped out using a 150-mesh copper mesh.

[0088] (7) Place the copper mesh in a 2% uranyl acetate saturated alcohol solution and stain for 8 minutes in the dark → wash with 70% alcohol for 3 times, 1 minute each time → wash with ultrapure water for 3 times, 1 minute each time → stain with 2.6% lead citrate solution in the dark for 8 minutes → wash with ultrapure water for 3 times, 1 minute each time, dry with filter paper, and place the copper mesh slices in a copper mesh box to dry overnight at room temperature.

[0089] (8) Observe the ultrastructural changes of myocardial tissue under a transmission electron microscope, and use the image acquisition system to take pictures, save and analyze them.

[0090] 2.9 Statistical analysis

[0091] All experimental data were described in the form of mean ± standard deviation (Mean ± SD). SPSS25.0 software was used for statistical analysis, and GraphPad Prism 8.0 was used to draw statistical charts. All data were tested for normal distribution and homogeneity of variance. If normal distribution was satisfied, one-way ANOVA was used for statistical comparison of multiple groups of data. If both variance homogeneity and LSD test were satisfied, the two-group comparison between groups was performed; if only normal distribution was satisfied but variance was not homogeneous, Dunnett T3 test was used for two-group comparison between groups. If normal distribution was not satisfied, the nonparametric Kruskal-Wallis rank sum test for multiple independent sample comparison was used for statistical analysis. The test level was α = 0.05, and the data results were considered to be significantly different when P < 0.05.

[0092] 3 Experimental results

[0093] 3.1XJQ activates PPARα / PGC-1α pathway in TAC model mice

[0094] RT-qPCR and Western blot were used to detect the expression of PPARα and PGC-1α, key regulatory factors of the PPAR signaling pathway, in mouse myocardial tissue. Figure 1 As shown in A-B, compared with the Sham group, the expression levels of PPARαmRNA and PGC-1αmRNA in the myocardial tissue of mice in the TAC group were significantly decreased (P < 0.05). After XJQ intervention, the expression of PPARαmRNA and PGC-1αmRNA was significantly increased (P < 0.05). Figure 1 As shown in C-F, compared with the Sham group, the expression levels of PPARα and PGC-1α proteins in the myocardial tissue of mice in the TAC group were significantly decreased (P<0.05). Compared with the TAC group, the expression levels of PPARα and PGC-1α proteins in the myocardial tissue of mice in the XJQH+TAC group were significantly increased (P<0.05), indicating that XJQ can significantly activate the PPARα / PGC-1α pathway in chronic heart failure model mice.

[0095] 3.2XJQ improves mitochondrial dysfunction in TAC model mice

[0096] Mitochondria are the power source of myocardial cells. Changes in their morphology and function are the main reasons for the reduction of ATP synthesis and insufficient energy supply. In this study, transmission electron microscopy was used to observe the ultrastructure of mitochondria in myocardial cells of each group of mice. Figure 2 As shown in the figure, the mitochondria of the cardiomyocytes of the mice in the Sham group were beaded, arranged neatly, and had a large number. The mitochondrial cristae were normal in morphology, and there was no obvious hypertrophy, hyperplasia, pyknosis or mitochondrial membrane rupture. In contrast, the mitochondrial structure of the cardiomyocytes of the mice in the TAC group was damaged, the arrangement was disordered, the number was reduced, the mitochondria were swollen and adhered, and they were in a giant spindle shape. There were obvious hypertrophy and hyperplasia. The mitochondrial cristae were deformed and ablated. Some mitochondria were pyknosis, and the mitochondrial membrane was ruptured. The mitochondrial morphology of the cardiomyocytes in the XJQH+TAC group was basically normal, beaded, arranged neatly, and had a large number. The edema was reduced, and the morphology was slightly hypertrophic. The mitochondrial cristae were basically normal in morphology, with slightly dense cristae. No obvious mitochondrial pyknosis or mitochondrial membrane rupture was observed. The results of electron microscopy showed that the mitochondrial ultrastructure of the cardiomyocytes of the chronic heart failure model mice was severely damaged, and XJQ could reduce the damage to the mitochondrial structure of the failing heart and maintain its structural integrity.

[0097] Western blot was used to detect the expression of mitochondrial function-related proteins NRF1, TFAM, Drp1 and Mfn2 in mouse myocardial tissue. Figure 3As shown in the figure, compared with the Sham group, the expression levels of NRF1 and TFAM proteins in the myocardial tissue of mice in the TAC group were significantly decreased (P < 0.05), the expression of mitochondrial fission-related protein Drp1 was significantly increased, and the expression of mitochondrial fusion-related protein Mfn2 was significantly decreased, indicating that there was severe mitochondrial dysfunction in the myocardial tissue of mice with chronic heart failure model. Compared with the TAC group, after XJQ intervention, the expression of NRF1, TFAM and Mfn2 proteins in the myocardial tissue of mice was significantly increased (P < 0.05), and the expression level of Drp1 protein was significantly decreased, indicating that XJQ can significantly improve mitochondrial biogenesis in TAC model mice, promote mitochondrial fusion, and inhibit mitochondrial fission.

[0098] 4 Summary

[0099] The results of omics analysis suggest that XJQ may play a role in preventing and treating chronic heart failure by regulating the PPAR signaling pathway and fatty acid metabolism. PPARα / PGC-1α is a key signaling pathway that regulates fatty acid metabolism and mitochondrial function. The experimental results of this example found that the expression of PPARα and PGC-1α in the myocardial tissue of mice with chronic heart failure model was reduced, the PPARα / PGC-1α signaling pathway was inhibited, the mitochondrial ultrastructure was damaged, the arrangement was disordered, the number was reduced, swelling and adhesion occurred, and the mitochondrial cristae were deformed and ablated; the expression of mitochondrial biogenesis-related proteins NRF1 and TFAM decreased, the expression of Mfn2 decreased, the mitochondrial fusion decreased, the expression of Drp1 increased, and the fission increased, leading to mitochondrial dysfunction, causing energy metabolism disorders, and insufficient energy supply. After administration, XJQ can significantly activate the PPARα / PGC-1α signaling pathway in chronic heart failure model mice, improve the ultrastructural damage of cardiomyocyte mitochondria, and help restore the normal mitochondrial morphology; activate the NRF1 / TFAM signaling pathway, promote mitochondrial biogenesis, inhibit mitochondrial fission, promote mitochondrial fusion, restore mitochondrial function, maintain the number and quality of mitochondria, thereby meeting the energy needs of cardiomyocytes and alleviating chronic heart failure.

[0100] Example 2

[0101] 1 Experimental Materials

[0102] 1.1 Experimental cells

[0103] The cells used in this experiment were H9c2 rat cardiomyocytes, purchased from Wuhan Pronocell Life Science Co., Ltd., catalog number CL-0089, and the species identification was correct.

[0104] 1.2 Main Reagents

[0105] The main reagents are shown in the table below.

[0106]

[0107]

[0108] 2 Experimental methods

[0109] 2.1 Preparation of main reagents

[0110] (1) Preparation of XJQ lyophilized powder

[0111] XJQ is composed of 40g of Astragalus, 10g of Siegesbeckia, and 2.5g of Perennial Cortex, which were purchased from Dongzhimen Hospital of Beijing University of Chinese Medicine. XJQ crude drug was soaked in 10 times the volume of ultrapure water for 30min, boiled over high heat, and then simmered for 30min, and the first decoction was filtered out. 8 times the volume of ultrapure water was added to the residue again, boiled over high heat, and then simmered for 30min, and the second decoction was collected by filtration. The two collected liquids were combined and continued to heat, boil, and concentrate. The concentrate was spread on a 100mm cell culture dish with a small hole drilled on the upper cover and frozen in a -80℃ refrigerator overnight. The next day, the culture dish was placed in a pre-cooled vacuum freeze dryer for sublimation drying to obtain XJQ freeze-dried powder, which was collected in a 50mL centrifuge tube and stored in a cool and dry place.

[0112] (2) Preparation of complete culture medium

[0113] Mix 10% fetal bovine serum and 90% DMEM high-glucose medium to prepare a complete medium, store it in a refrigerator at 4°C, and use it up as soon as possible.

[0114] (3) Preparation of AngⅡ mother solution

[0115] Mix 10 mg of AngⅡ with 9.5586 mL of ultrapure water, filter and sterilize with a 0.22 um microporous filter membrane to prepare a 1 mmol / L AngⅡ mother solution, divide it into portions and store it in a refrigerator at -20°C, and use it up as soon as possible.

[0116] (4) Preparation of XJQ mother liquor

[0117] Mix 80 mg of XJQ lyophilized powder with 50 mL of complete culture medium, filter and sterilize with a 0.22 um microporous filter membrane to prepare a 1600 μg / mL XJQ stock solution, store it in a refrigerator at 4°C, and use it up as soon as possible.

[0118] 2.2 H9c2 cell culture

[0119] 2.3 Detection of H9c2 cell viability by CCK8 assay

[0120] (1) H9c2 cells in the logarithmic growth phase were washed, digested, centrifuged and resuspended in complete medium. The cell density was adjusted to 1×10 5 / mL, take 100 μL of cell suspension and evenly inoculate it in a 96-well plate, add 100 μL PBS buffer to the outermost circle of the 96-well plate without inoculating cells, and transfer it to a 37°C incubator containing 5% CO2 and culture it for 24 hours.

[0121] (2) The XJQ lyophilized powder stock solution (1600 μg / mL) was diluted with complete culture medium to intervention concentrations of 800 μg / mL, 600 μg / mL, 500 μg / mL, 400 μg / mL, 300 μg / mL, 200 μg / mL, 100 μg / mL, 50 μg / mL, and 25 μg / mL, respectively.

[0122] (3) The original culture medium in the 96-well plate was aspirated, and complete culture medium or different concentrations of XJQ lyophilized powder solution were added to the 96-well plate, 100 μL per well, and the plate was transferred to a 37°C incubator containing 5% CO2 and cultured for 48 h.

[0123] (4) Aspirate the original culture medium or intervention drug in the 96-well plate, add 100 μL of CCK8 working solution (CCK8 stock solution: DMEM high-glucose culture medium = 1:10) to each well under light-proof conditions, and transfer to a 37°C incubator containing 5% CO2 and incubate for 90 min.

[0124] (5) The OD value of each well was measured by an enzyme-labeled instrument at a wavelength of 450 nm. The cell viability of each group was calculated according to the formula: cell viability (%) = [OD value of the drug-treated group - OD value of the blank group] / [OD value of the control group - OD value of the blank group] × 100%, thereby screening out the optimal intervention concentration of XJQ.

[0125] The same method was used to detect the cell viability of each group after H9c2 cells were intervened with different concentrations of AngⅡ (100μmol / L, 10μmol / L, 1μmol / L, 0.1μmol / L) for 48 hours.

[0126] In addition, different final concentrations of XJQ lyophilized powder solution (50 μg / mL, 100 μg / mL, 200 μg / mL) were added to intervene H9c2 cells for 2 h, and then AngⅡ with a final concentration of 1 μmol / L was added to continue intervention for 48 h, and the cell viability of each group was detected. 2.4 Establishment of H9c2 cell hypertrophy model and drug intervention

[0127] According to the results of previous experiments, H9c2 cells were stimulated with AngⅡ at a final concentration of 1 μmol / L for 48 h to establish a cardiomyocyte hypertrophy model, and the final concentration of the XJQ high-dose group was determined to be 200 μg / mL.

[0128] (1) H9c2 cells in the logarithmic growth phase were washed, digested, centrifuged and resuspended in complete medium. The cell density was adjusted to 1×105 / mL, take 3mL of cell suspension and evenly inoculate it in a 60mm cell culture dish, transfer it to a 37℃ incubator containing 5% CO2 and culture it for 24h.

[0129] (2) XJQ lyophilized powder stock solution (1600 μg / mL) was diluted to an intervention concentration of 400 μg / mL with complete culture medium. AngⅡ stock solution (1 mmol / L) was diluted to 2 μmol / L AngⅡ working solution.

[0130] (3) Aspirate the original culture medium in the culture dish and add the corresponding culture medium or drug for intervention:

[0131] ①Blank control group (Control): 2 mL complete culture medium;

[0132] ②Model group (AngⅡ): 2 mL complete culture medium;

[0133] ③XJQ high-dose group (XJQH+AngⅡ): 2mL of 400μg / mL XJQ lyophilized powder solution.

[0134] Transfer to a 37°C incubator containing 5% CO2 and culture for 2 h.

[0135] (4) Remove the culture dish and add 2 mL of complete culture medium to the control group; add 2 mL of 2 μmol / L AngⅡ working solution to the other two groups respectively. Transfer to a 37°C incubator with 5% CO2 and culture for 48 h.

[0136] (5) After the intervention, collect the cell pellet and conduct corresponding tests.

[0137] 2.5 RT-qPCR of H9c2 cells

[0138] After the H9c2 cell intervention, the culture medium and drug solution were aspirated, 1 mL of lysis solution MagZol Reagent was added, and the cells were fully lysed by pipetting and standing at room temperature for 10 min. 100 μL of Buffer BCP was added, and the cells were shaken vigorously by hand for 15 s and stood at room temperature for 3 min. Subsequent RNA extraction, RNA reverse transcription, and PCR reaction processes were carried out according to conventional methods in the field.

[0139] 2.6 Western blot of H9c2 cells

[0140] After the H9c2 cell intervention, the culture medium and the drug solution were aspirated, 3 mL of pre-cooled PBS was added to wash 3 times and then discarded, 500 μL of lysis mixture (RIPA lysis solution: protease and phosphatase inhibitor = 99:1) was added, and the cells were gently scraped along the bottom of the culture dish with a cell scraper until all the cells were free and detached, and then transferred to a 1.5 mL EP tube and placed on ice for 10 minutes to allow the cells to fully lyse. The centrifuge was pre-cooled to 4 ° C in advance, centrifuged at 12000 rpm for 15 minutes, the supernatant was aspirated, and placed on ice. Subsequent BCA protein quantification, gel preparation, Western blot and other processes were carried out according to conventional methods in the field.

[0141] 2.7 Statistical analysis

[0142] The same method as described in Example 1 was used.

[0143] 3 Experimental results

[0144] 3.1XJQ significantly activates the PPARα / PGC-1α pathway in hypertrophic cardiomyocytes

[0145] RT-qPCR and Western blot were used to detect the expression of PPARα and PGC-1α, key regulatory genes of the PPAR signaling pathway in cardiomyocytes. Figure 4 As shown in A-B, compared with the Control group, the expression levels of PPARαmRNA and PGC-1αmRNA in cardiomyocytes in the AngⅡ group were significantly decreased (P<0.05). Compared with AngⅡ, the expression levels of PPARαmRNA and PGC-1αmRNA in cardiomyocytes in the XJQ administration group were significantly increased (P<0.05). Figure 4 As shown in C-E, compared with the Control group, the expression levels of PPARα and PGC-1α proteins in cardiomyocytes in the AngⅡ group were significantly decreased (P < 0.05). After XJQ intervention, the expression levels of PPARα and PGC-1α proteins in cardiomyocytes were significantly increased (P < 0.05), indicating that XJQ can significantly activate the PPARα / PGC-1α signaling pathway in hypertrophic cardiomyocytes.

[0146] 3.2XJQ significantly activates the NRF1 / TFAM pathway in hypertrophic cardiomyocytes and improves mitochondrial dysfunction

[0147] Western blot was used to detect the expression of mitochondrial function-related proteins NRF1, TFAM and Mfn2 in cardiomyocytes. Figure 5As shown in the figure, compared with the Control group, the expression levels of NRF1, TFAM and Mfn2 proteins in cardiomyocytes in the AngⅡ group were significantly decreased (P<0.05), indicating that mitochondrial dysfunction in hypertrophic cardiomyocytes. Compared with the AngⅡ group, the expression levels of NRF1, TFAM and Mfn2 proteins in cardiomyocytes were significantly increased after XJQ intervention (P<0.05), indicating that XJQ can significantly alleviate mitochondrial dysfunction in hypertrophic cardiomyocytes.

[0148] 4 Summary

[0149] The experimental results of this example show that the expression levels of PPARα and PGC-1α in AngⅡ-induced hypertrophic cardiomyocytes are reduced, the PPARα / PGC-1α signaling pathway is inhibited, and the key signaling pathway NRF1 / TFAM that regulates mitochondrial biogenesis is also inhibited. The expression of NRF1, TFAM, and Mfn2 is significantly reduced, and mitochondrial biogenesis is weakened. After XJQ administration, the PPARα / PGC-1α signaling pathway can be activated, the NRF1 / TFAM signaling pathway can be activated, the expression levels of NRF1, TFAM, and Mfn2 can be increased, mitochondrial biogenesis can be promoted, mitochondrial function can be restored, and cardiomyocyte energy metabolism can be improved, thereby reducing cardiomyocyte hypertrophy. In the whole process, PGC-1α plays a vital role. As a powerful transcriptional co-regulator, PGC-1α can activate a variety of downstream nuclear receptors and transcription factors, including PPARs, NRFs, ERRs, HNFs, etc., thereby promoting physiological activities such as mitochondrial biogenesis. Subsequently, a knockdown stable cell line around PGC-1α was constructed to carry out more in-depth mechanism verification.

[0150] Example 3

[0151] 1 Experimental Materials

[0152] 1.1 Experimental cells

[0153] Same as Example 2.

[0154] 1.2 Main Reagents

[0155] The main reagents are shown in the table below.

[0156] name Part Number Manufacturer Ppargc1α RNAi-Easy Lentivirus GXDL0409449 Shanghai Genetech Technology Co., Ltd. Negative control lentivirus 10050475 Shanghai Genetech Technology Co., Ltd. Puromycin P8230 Beijing Solable Technology Co., Ltd. DMEM without double antibody, high glucose medium 12110 Beijing Solable Technology Co., Ltd.

[0157] 2 Experimental methods

[0158] 2.1 Construction of sh-PGC-1α lentivirus

[0159] Based on the sequence of rat PGC-1α gene (NM_031347) in Genebank, three siRNA targets specific to PGC-1α gene were designed for verification, and the optimal sequence was selected for subsequent experiments, among which the target gene sequence of sh-PGC-1α-1 is: GACCGAGAATTCATGGAGCAA (SEQ ID NO: 1), the target gene sequence of sh-PGC-1α-2 is: TCGCAACATGCTCAAGCCAAA (SEQ ID NO: 2), the target gene sequence of sh-PGC-1α-3 is: TCCCACGACTCCTCCTCATAA (SEQ ID NO: 3), and the target gene sequence of sh-NC is: TTCTCCGAACGTGTCACGT (SEQID NO: 4). The lentiviral vector is GV493, and the vector element sequence is Hu6-MCS-CBh-gcGFP-IRES-puromycin. The vector cloning construction, plasmid extraction, and virus packaging experiments were completed by Shanghai Jikai Gene Technology Co., Ltd. The titer of sh-PGC-1α-1 was 2E+9TU / mL, the titer of sh-PGC-1α-2 was 1E+9TU / mL, the titer of sh-PGC-1α-3 was 2E+9TU / mL, and the titer of sh-NC virus was 1.5E+9TU / mL.

[0160] 2.2 Infection of H9c2 cells with sh-PGC-1α lentivirus

[0161] (1) H9c2 cells in the logarithmic growth phase were washed, digested, centrifuged and resuspended in complete medium. The cell density was adjusted to 5 × 10 4 / mL, take 1mL of cell suspension and evenly inoculate it in a 6-well plate, transfer it to a 37℃ incubator containing 5% CO2 and culture it for about 24h, and then infect it with lentivirus when the cell fusion reaches about 30%.

[0162] (2) Aspirate the original culture medium in the 6-well plate and add 1 mL of complete culture medium. According to the previous experimental results of the research group, the volume of lentivirus added was calculated according to MOI = 50, virus volume = (MOI × number of cells) / virus titer. 2.5 μL, 5 μL, 2.5 μL, and 3.3 μL of the corresponding lentivirus were added to the sh-PGC-1α-1 group, sh-PGC-1α-2 group, sh-PGC-1α-3 group, and sh-NC group, respectively. 40 μL of HitransGA virus infection enhancement solution was added, and the plates were placed in a 37°C incubator containing 5% CO2 and cultured for 16 h.

[0163] (3) Aspirate the original culture medium in the 6-well plate and replace it with 2 mL of fresh complete culture medium for continued culture. After 48 hours of infection, observe the GFP green fluorescence expression under a fluorescence microscope and take pictures. If the green fluorescence reaches more than 80% and the cells are in good growth condition, it means that the infection is successful and can be used for the next experiment.

[0164] 2.3 Construction of sh-PGC-1α stable cell line

[0165] (1) After 72 hours of lentiviral infection, the fluorescence was observed. After successful infection, the original culture medium in the 6-well plate was aspirated, the plate was washed with PBS buffer three times, digested with trypsin, centrifuged and resuspended in complete culture medium. The cell density was adjusted to 5×10 4 / mL, 4mL of the cell suspension was evenly inoculated in a 60mm cell culture dish, and 8μL of 1mg / mL puromycin was added to kill the H9c2 cells that were not successfully infected with the lentivirus, and then transferred to a 37℃ incubator containing 5% CO2 for further culture.

[0166] (2) When the cell fusion reaches about 80%, the cells are passaged. Puromycin (1 μg / mL) is continuously added during the passage process to select stable cell lines. The cells are collected, and the efficiency of lentiviral infection is verified by RT-qPCR and Western blot. The group with the most significant PGC-1α knockdown effect is selected from sh-PGC-1α-1, sh-PGC-1α-2, and sh-PGC-1α-3. The cells are continued to be cultured and a portion is frozen for seed preservation for subsequent use.

[0167] 2.4 Establishment of H9c2 cell hypertrophy model and drug intervention

[0168] (1) Take the sh-PGC-1α stable cells and sh-NC stable cells in the logarithmic growth phase, wash, digest, centrifuge and resuspend in complete medium, and adjust the cell density to 1×10 5 / mL, take 3mL of cell suspension and evenly inoculate it in a 60mm cell culture dish, transfer it to a 37℃ incubator containing 5% CO2 and culture it for 24h.

[0169] (2) Aspirate the original culture medium in the culture dish and add the corresponding culture medium or drug for intervention:

[0170] ① Negative control group (sh-NC): 2 mL of complete medium was added to the sh-NC stable transfected cells;

[0171] ② Negative control + model group (sh-NC + AngⅡ): 2 mL of complete medium was added to the sh-NC stable cells;

[0172] ③ Negative control + XJQH group (sh-NC + XJQH + AngⅡ): 2 mL of 400 μg / mL XJQ lyophilized powder solution was added to the sh-NC stable cells;

[0173] ④sh-PGC-1α group (sh-PGC-1α): 2 mL of complete medium was added to the sh-PGC-1α stable transfected cells;

[0174] ⑤sh-PGC-1α+model group (sh-PGC-1α+AngⅡ): 2 mL of complete medium was added to the sh-PGC-1α stable transfected cells;

[0175] ⑥sh-PGC-1α+XJQH group (sh-PGC-1α+XJQH+AngⅡ): 2 mL of 400 μg / mL XJQ lyophilized powder solution was added to the sh-PGC-1α stable transfected cells.

[0176] Transfer to a 37°C incubator containing 5% CO2 and culture for 2 h.

[0177] (4) Remove the culture dish, add 2 mL of complete culture medium to the sh-NC group and sh-PGC-1α group; add 2 mL of 2 μmol / L AngⅡ working solution to the other four groups. Transfer to a 37°C incubator with 5% CO2 and culture for 48 h.

[0178] (5) After the intervention, collect the cell pellet and conduct corresponding tests.

[0179] 2.5 RT-qPCR of H9c2 cells

[0180] Same as Example 2.

[0181] 2.6 Western blot of H9c2 cells

[0182] Same as Example 2.

[0183] 2.7 Statistical analysis

[0184] Same as Example 2.

[0185] 3 Experimental results

[0186] 3.1 PGC-1α knockdown effect verification

[0187] First, RT-qPCR and Western blot were used to verify the infection efficiency of sh-PGC-1α, and the lentivirus with the best knockdown effect was screened for subsequent experiments. Figure 6As shown in the figure, compared with the sh-NC group, the expression level of PGC-1α mRNA and PGC-1α protein in the cardiomyocytes of the sh-PGC-1α-1 group was significantly decreased (P<0.05), the expression level of PGC-1α mRNA decreased by about 70%, and the expression level of PGC-1α protein decreased by about 40%. Compared with the sh-NC group, the expression of PGC-1α mRNA and PGC-1α protein in the cardiomyocytes of the sh-PGC-1α-2 group did not change significantly (P>0.05), and the expression of PGC-1α mRNA and PGC-1α protein in the cardiomyocytes of the sh-PGC-1α-3 group showed a decreasing trend, but there was no significant difference (P>0.05). It shows that sh-PGC-1α-1 can be used as an intervention factor for PGC-1α-1 knockdown. The stable transgenic cell line of PGC-1α knockdown was constructed using sh-PGC-1α-1, and subsequent experiments were carried out on this basis.

[0188] 3.2XJQ alleviates cardiomyocyte hypertrophy by activating PGC-1α

[0189] The expression levels of ANP mRNA, BNP mRNA and β-MHC mRNA in cardiomyocytes of each group were detected by RT-qPCR to evaluate the effect of XJQ on the hypertrophy of sh-PGC-1α cardiomyocytes. Figure 7As shown in the figure, compared with the sh-NC group, the expression levels of ANP mRNA, BNP mRNA and β-MHC mRNA in the sh-NC+AngⅡ group were significantly increased (P<0.05), and there was no significant change in the expression levels of ANP mRNA, BNP mRNA and β-MHC mRNA in the sh-PGC-1α group (P>0.05). Compared with the sh-NC+AngⅡ group, the expression levels of ANP mRNA, BNP mRNA and β-MHC mRNA in the sh-NC+XJQH+AngⅡ group were significantly decreased (P<0.05), indicating that XJQ can significantly improve the hypertrophy of sh-NC cardiomyocytes induced by AngⅡ. Compared with the sh-NC+AngⅡ group, there was no significant change in the expression levels of ANP mRNA, BNP mRNA and β-MHC mRNA in the sh-PGC-1α+AngⅡ group (P>0.05). Compared with the sh-NC+XJQH+AngⅡ group, the expression levels of ANP mRNA, BNP mRNA and β-MHC mRNA in cardiomyocytes of the sh-PGC-1α+XJQH+AngⅡ group were significantly increased (P<0.05), and there was no significant difference between them and the sh-NC+AngⅡ group and the sh-PGC-1α+AngⅡ group (P>0.05), indicating that the protective effect of XJQ on cardiomyocyte hypertrophy was inhibited after PGC-1α knockdown. Compared with the sh-PGC-1α group, the expression levels of ANP mRNA, BNP mRNA and β-MHC mRNA in cardiomyocytes of the sh-PGC-1α+AngⅡ group and the sh-PGC-1α+XJQH+AngⅡ group were significantly increased (P<0.05). Compared with the sh-PGC-1α+AngⅡ group, there was no significant change in the expression levels of ANP mRNA, BNP mRNA and β-MHC mRNA in the cardiomyocytes of the sh-PGC-1α+XJQH+AngⅡ group (P>0.05), indicating that knockdown of PGC-1α can inhibit the improvement effect of XJQ on cardiomyocyte hypertrophy, and XJQ can alleviate cardiomyocyte hypertrophy by activating PGC-1α.

[0190] 3.3XJQ improves mitochondrial dysfunction in hypertrophic cardiomyocytes by activating PGC-1α

[0191] The expression levels of NRF1 and TFAM in cardiomyocytes of each group were detected by Western blot to evaluate the effect of XJQ on the NRF1 / TFAM pathway in sh-PGC-1α cardiomyocytes. Figure 8As shown in the figure, compared with the sh-NC group, the expression levels of NRF1 and TFAM in cardiomyocytes of the sh-NC+AngⅡ group and the sh-PGC-1α group were significantly decreased (P<0.05). Compared with the sh-NC+AngⅡ group, the expression levels of NRF1 and TFAM in cardiomyocytes of the sh-NC+XJQH+AngⅡ group were significantly increased (P<0.05), indicating that XJQ can significantly activate the NRF1 / TFAM signaling pathway in sh-NC hypertrophic cardiomyocytes. Compared with the sh-NC+AngⅡ group, the expression levels of NRF1 and TFAM in the sh-PGC-1α+AngⅡ group did not change significantly (P>0.05). Compared with the sh-NC+XJQH+AngⅡ group, the expression levels of NRF1 and TFAM in cardiomyocytes in the sh-PGC-1α+XJQH+AngⅡ group were significantly decreased (P<0.05), and there was no significant difference between them and the sh-NC+AngⅡ group and the sh-PGC-1α+AngⅡ group (P>0.05), indicating that the effect of XJQ on activating the NRF1 / TFAM signaling pathway was inhibited after PGC-1α knockdown. Compared with the sh-PGC-1α group, the expression levels of NRF1 and TFAM in cardiomyocytes in the sh-PGC-1α+AngⅡ group and the sh-PGC-1α+XJQH+AngⅡ group were significantly decreased (P<0.05). Compared with the sh-PGC-1α+AngⅡ group, there was no significant change in the expression levels of NRF1 and TFAM in cardiomyocytes of the sh-PGC-1α+XJQH+AngⅡ group (P>0.05), indicating that knockdown of PGC-1α can inhibit the activation of XJQ on the NRF1 / TFAM signaling pathway in hypertrophic cardiomyocytes.

[0192] The expression levels of Drp1 and Mfn2 in cardiomyocytes of each group were detected by Western blot to evaluate the effect of XJQ on mitochondrial fission and fusion in sh-PGC-1α cardiomyocytes. Fig. 9As shown in the figure, compared with the sh-NC group, the expression level of Drp1 in the sh-NC+AngⅡ group was significantly increased (P<0.05), and the expression level of Mfn2 was significantly decreased (P<0.05). There was no significant change in the expression levels of Drp1 and Mfn2 in the sh-PGC-1α group (P>0.05). Compared with the sh-NC+AngⅡ group, the expression level of Drp1 in the sh-NC+XJQH+AngⅡ group was significantly decreased (P<0.05), and the expression level of Mfn2 was significantly increased (P<0.05), indicating that XJQ can significantly inhibit the fission of mitochondria in sh-NC hypertrophic cardiomyocytes and promote their fusion. Compared with the sh-NC+AngⅡ group, there was no significant change in the expression levels of Drp1 and Mfn2 in the sh-PGC-1α+AngⅡ group (P>0.05). Compared with the sh-NC+XJQH+AngⅡ group, the expression level of Drp1 in cardiomyocytes in the sh-PGC-1α+XJQH+AngⅡ group was significantly increased (P<0.05), and the expression level of Mfn2 was significantly decreased (P<0.05), and there was no significant difference between the sh-NC+AngⅡ group and the sh-PGC-1α+AngⅡ group (P>0.05), indicating that the effect of XJQ in inhibiting mitochondrial fission and promoting mitochondrial fusion was inhibited after PGC-1α knockdown. Compared with the sh-PGC-1α group, the expression level of Drp1 in cardiomyocytes in the sh-PGC-1α+AngⅡ group and the sh-PGC-1α+XJQH+AngⅡ group was significantly increased (P<0.05), and the expression level of Mfn2 was significantly decreased (P<0.05). Compared with the sh-PGC-1α+AngⅡ group, there was no significant change in the expression levels of Drp1 and Mfn2 in cardiomyocytes of the sh-PGC-1α+XJQH+AngⅡ group (P>0.05), indicating that knockdown of PGC-1α can weaken the effect of XJQ in inhibiting mitochondrial fission and promoting mitochondrial fusion in hypertrophic cardiomyocytes, suggesting that XJQ can activate the NRF1 / TFAM pathway in hypertrophic cardiomyocytes by upregulating PGC-1α, inhibit mitochondrial fission, promote mitochondrial fusion, and thus improve mitochondrial dysfunction.

[0193] 4 Summary

[0194] In this part of the experiment, a stable cell line with PGC-1α knockdown was constructed by lentiviral infection, and the two cell lines sh-NC and sh-PGC-1α-1 were stimulated with AngⅡ and intervened with XJQ administration. The experimental results showed that in sh-NC cells, after AngⅡ stimulation, the expression of cardiomyocyte ANP, BNP, β-MHC and Drp1 was significantly increased, and the expression of PPARα, PGC-1α, CD36, CPT1A, NRF1, TFAM and Mfn2 was significantly decreased. XJQ administration intervention can significantly downregulate ANP, BNP, β-MHC, reduce cardiomyocyte hypertrophy, activate the PPARα / PGC-1α signaling pathway, and enhance fatty acid metabolism; activate the NRF1 / TFAM signaling pathway, promote mitochondrial biogenesis, inhibit mitochondrial fission, and improve mitochondrial dysfunction.

[0195] Compared with the sh-NC+XJQH+AngⅡ group, the expressions of ANP, BNP, β-MHC and Drp1 in the cardiomyocytes of the sh-PGC-1α+XJQH+AngⅡ group were significantly increased, and the expressions of PPARα, PGC-1α, CD36, NRF1, TFAM and Mfn2 were significantly decreased, and there was no significant difference between the sh-NC+AngⅡ group and the sh-PGC-1α+AngⅡ group, indicating that after PGC-1α knockdown, XJQ can inhibit the activation of the PPARα / PGC-1α pathway in hypertrophic cardiomyocytes, thereby inhibiting the effects of XJQ in promoting fatty acid metabolism, restoring mitochondrial dysfunction and improving cardiomyocyte hypertrophy. It further confirmed that XJQ may promote fatty acid metabolism by upregulating PGC-1α, activating the PPARα / PGC-1α signaling pathway, activating the NRF1 / TFAM signaling pathway, promoting mitochondrial biogenesis, inhibiting mitochondrial fission, and improving mitochondrial dysfunction, thereby alleviating AngⅡ-induced cardiomyocyte hypertrophy.

[0196] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0197] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Use of a Siegesbeckia scoparia composition in the preparation of a product for improving cardiac mitochondrial dysfunction, characterized in that: The Siegesbeckia composition is prepared from 38-42 parts by weight of astragalus, 8-12 parts by weight of siegesbeckia herb and 2-3 parts by weight of cortex perillae.

2. The use according to claim 1, characterized in that: The improvement of cardiac mitochondrial dysfunction includes promoting mitochondrial biogenesis, inhibiting mitochondrial fission, and promoting mitochondrial fusion.

3. The use according to claim 1, characterized in that: The Siegesbeckia composition is prepared from 40 parts by weight of Astragalus, 10 parts by weight of Siegesbeckia herb and 2.5 parts by weight of Perennial Perennial Bark.

4. Use of the Siegesbeckia scoparia composition of claim 1 in the preparation of a product for improving the expression level of genes related to cardiac mitochondrial function, characterized in that: The mitochondrial function-related genes are one or more of NRF1, TFAM and Mfn2.

5. The use according to claim 4, characterized in that: The Siegesbeckia sieboldii composition increases the expression level of the mitochondrial function-related gene by increasing the expression level of cardiac PPARα or PGC-1α.

6. Use of the Siegesbeckia scoparia composition of claim 1 in the preparation of a product for reducing the expression level of cardiac Drp1 gene.

7. The use according to claim 6, characterized in that: The Siegesbeckia sieboldii composition reduces the expression level of the Drp1 gene by increasing the expression level of cardiac PPARα or PGC-1α.

8. The use according to any one of claims 1 to 7, characterized in that: The product is a pharmaceutical preparation.

9. The use according to claim 8, characterized in that: The pharmaceutical preparation comprises pharmaceutically acceptable excipients.

10. The use according to claim 8, characterized in that: The dosage form of the pharmaceutical preparation is tablet, capsule, granule, oral solution or injection.

Images