Cat hair allergy recombinant fusion protein as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a cat hair allergy recombinant fusion protein as well as a preparation method and application thereof. The method comprises the following steps: analyzing and screening B cell epitopes of the cat hair allergic protein, carrying out series fusion expression on Feld1, Feld3, Feld4, Feld7 and Feld8 and the B cell epitopes of the allergic protein, optimizing escherichia coli codons, and realizing high-efficiency expression in an escherichia coli expression system; the fusion expression scheme not only has higher protein expression, but also enhances the immunogenicity due to the connection with the own B cell epitope. A plurality of cat hair allergy recombinant fusion proteins with strong immunogenicity are adopted to carry out subcutaneous immunization on laying hens to obtain corresponding high-titer broad-spectrum egg yolk antibodies, allergy proteins can be effectively neutralized, the egg yolk antibodies are used for preparing functional cat food or additives, and allergic reactions of animals and contact personnel can be reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a cat hair allergy recombinant fusion protein and a preparation method and application thereof. Background Art

[0002] The allergenic proteins in cat dander are one of the main causes of cat hair allergies, which can cause allergic reactions of varying degrees, often causing patients to suffer from two or more allergic diseases at the same time, seriously affecting the quality of life of patients and their families. Currently, eight components of cat dander allergenic proteins have been identified, including Feld1 to 8 proteins, of which Feld1, Feld3, Feld4, Feld7, and Feld8 are the main components of cat hair allergenic proteins. These allergenic proteins are very small and can be attached to sofas, carpets, or clothing as cats move. When cats lick their hair, allergens may be attached to air particles, so when patients inhale or their skin comes into contact with allergens, allergic reactions will occur.

[0003] When you suspect you are allergic to cat hair, you should first identify the allergens. Avoiding contact with related allergens is the most effective treatment measure. At the same time, for those who have developed various allergic diseases, anti-allergic treatment should be taken when necessary. Cat hair allergy cannot be cured at present, but most patients can be controlled and improved through active diagnosis and treatment.

[0004] Yolk antibody (immunoglobμLin yolk, IgY) is abbreviated as IgY, that is, birds (mostly chickens) produce corresponding specific antibodies after being immunized with specific antigens, and are transported and stored in yolk. Then, high-yield specific polyclonal antibodies can be obtained from yolk through specific extraction technology, which are immunoglobulins that can specifically bind to corresponding antigens. At present, the expression level of in vitro recombinant expression of cat hair allergy protein is low, and industrialization is difficult; cat hair allergy protein has poor immunogenicity, and the titer of yolk antibody is generally low. In addition, the types of allergic proteins currently used to prepare immune compositions of cat hair allergy protein yolk antibodies are relatively small, and the spectrum of yolk antibodies used to prepare cat hair allergens is narrow, and the therapeutic effect is not significant. Therefore, according to the occurrence mechanism and allergens of cat hair allergy, it is of great significance to prepare a yolk antibody with broad spectrum and high efficiency to neutralize multiple cat hair allergy proteins for the prevention and treatment of cat hair allergy. Summary of the invention

[0005] In view of the above problems, the object of the present invention is to provide a cat hair allergy recombinant fusion protein and its preparation method and application.

[0006] The technical contents of the present invention are as follows:

[0007] The present invention provides a cat hair allergy recombinant fusion protein, which is a protein obtained by fusion expression of a cat hair allergy protein or a cat hair allergy protein and its corresponding B cell epitope;

[0008] The fusion order of the cat hair allergy protein and its B cell epitope is not limited, and the fusion order is selectively optimized based on the hydrophobicity and structure of the sequence;

[0009] The cat hair allergy proteins include but are not limited to Feld1, Feld3, Feld4, Feld7, and Feld8;

[0010] The B cell antigen epitopes include but are not limited to Feld1-AD1, Feld1-AD2, Feld1-AD3, Feld3-AD1, Feld3-AD2, Feld4-AD1, Feld4-AD2, Feld4-AD3, Feld7-AD1, Feld7-AD2, Feld7-AD3, and Feld8-AD1;

[0011] The amino acid sequence of the B cell antigen epitope is shown in SEQ ID NOs. 1 to 12, and the codon-optimized nucleic acid sequence is shown in SEQ ID NOs. 13 to 24; the amino acid sequence of the protein expressed by cat hair allergy protein is shown in SEQ ID NOs. 25 to 29, and the codon-optimized nucleic acid sequence is shown in SEQ ID NOs. 30 to 34;

[0012] The cat hair allergy protein is fused with its corresponding B cell epitope and then expressed to obtain an amino acid sequence of the protein as shown in SEQ ID NOs.35 to 46, and a codon-optimized nucleic acid sequence as shown in SEQ ID NOs.47 to 58;

[0013] The expression refers to fusing the protein with a purification tag and expressing it on a vector, which is a routine operation.

[0014] The present invention also provides a method for preparing a cat hair allergy recombinant fusion protein, comprising the following steps:

[0015] 1) Analyze the protein structure of cat hair allergy protein, analyze and screen out suitable B cell antigen epitopes;

[0016] The cat hair allergy protein and B cell antigen epitope are as shown above;

[0017] 2) fusing the selected B cell antigen epitope with its corresponding cat hair allergy protein to construct a fusion protein;

[0018] 3) After codon optimization, the fusion protein is synthesized and constructed into an expression vector to obtain a recombinant plasmid;

[0019] The expression system used in the preparation method is not limited to the Escherichia coli expression system, the yeast expression system, and the cell expression system;

[0020] Furthermore, the E. coli expression system is preferred;

[0021] The E. coli expression vector includes but is not limited to pET-3a, pET-11a, pET-12a, pET-14b, pET-15b, pET-16b, pET-17b, pET-19b, pET-20b, pET-21a, pET-22b, pET-23a, pET-24a, pET-25b, pET-26b, pET-27b, pET-28a, pET-29a, pET-30a, pET-31b, pET-32a, pET-33b, pET- T-34b, pET-35b, pET-37b, pET-39b, pET-40b, pET-41a, pET-42a, pET-43.1a, pET-44a, pET-45b, pET-47b, pET-48b, pET-49b, pET-50b, pET-51b, pET-52b, pETDuet-1, pACYCDuet-1, pCDFDuet-1, pRSFDuet-1, pColaDuet-1 and related transformation vectors;

[0022] 4) transforming the recombinant plasmid into an expression strain to obtain a recombinant expression strain;

[0023] The E. coli expression strains include but are not limited to BL21, cBL21, BL21 (DE3), BL21 codon plus (DE3), BL21 Star (DE3), B834 (DE3), Tuner (DE3), Rosetta (DE3), Rosetta2 (DE3), Arctic Express (DE3), Origami (DE3), Origami2 (DE3), OrigamiB (DE3), SHuffle T7, ER2566, OverExpress C43 (DE3), BLR (DE3), HMS174 (DE3), GT115, MG1655, NovaBlue (DE3) and related modified strains;

[0024] 5) Induce the expression of the recombinant expression strain, perform crude extraction and purification, renaturation and purification on the expression product, and obtain the cat hair allergy recombinant fusion protein.

[0025] The present invention also provides an application of a cat hair allergy recombinant fusion protein in the preparation of broad-spectrum and high-titer egg yolk antibodies and functional cat food or additives;

[0026] The preparation of the broad-spectrum and high-titer yolk antibody is as follows: cat hair allergy recombinant fusion proteins are randomly combined, and the mixture is prepared into an immune preparation with an adjuvant, and then the immunization is performed on laying hens, and then the eggs are collected to extract the yolk antibody, so as to obtain the broad-spectrum and high-titer yolk antibody;

[0027] The functional cat food or additive is prepared by spraying the egg yolk antibody on the cat food or additive according to the potency, and drying at low temperature to obtain the functional cat food or additive that reduces allergic reactions.

[0028] The beneficial effects of the present invention are as follows:

[0029] The cat hair allergy recombinant fusion protein of the present invention is obtained by analyzing and screening the B cell epitopes of the cat hair allergy protein, using Feld1, Feld3, Feld4, Feld7, Feld8 and the B cell epitopes of the allergy protein itself for tandem fusion expression, and optimizing the codons of Escherichia coli, and the fusion protein achieves efficient expression in the Escherichia coli expression system; the fusion expression scheme not only has a high amount of protein expression, but also has enhanced immunogenicity due to the connection with the B cell epitopes of the allergy protein itself, and has a good immune effect on animals. Using multiple cat hair allergy recombinant fusion proteins with strong immunogenicity to subcutaneously immunize laying hens can obtain corresponding high-titer broad-spectrum yolk antibodies, which can effectively neutralize Feld1, Feld3, Feld4, Feld7, Feld8 allergy proteins, and the yolk antibodies are used to prepare functional cat food or additives, which can significantly reduce the content of cat hair attached allergy proteins, thereby reducing the occurrence of allergic reactions in animals and contact personnel. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the PCR identification result of the recombinant bacterial solution;

[0031] Figure 2 The figure is the SDS-PAGE analysis result of the induced expression sample of the recombinant bacteria (1-7);

[0032] Figure 3 This is the SDS-PAGE analysis result of the induced expression sample of the recombinant bacteria (8-17). DETAILED DESCRIPTION

[0033] The present invention is further described in detail below through specific implementation cases and accompanying drawings. It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of protection of the present invention. After reading the present invention, various equivalent forms of modifications to the present invention by those skilled in the art are all within the scope of the claims attached to this application.

[0034] Unless otherwise specified, all raw materials and reagents of the present invention are raw materials and reagents from the conventional market.

[0035] Example 1

[0036] Construction and application of a recombinant fusion protein for cat hair allergy

[0037] 1. Synthesis of the whole gene fragment and construction of recombinant plasmid

[0038] Feld1, Feld3, Feld4, Feld7, and Feld8 amino acid sequences were selected for antigen epitope prediction, and the preferred B cell antigen epitopes (Feld1-AD1, Feld1-AD2, Feld1-AD3, Feld3-AD1, Feld3-AD2, Feld4-AD1, Feld4-AD2, Feld4-AD3, Feld7-AD1, Feld7-AD2, Feld7-AD3, Feld8-AD1) were fused with the corresponding allergic proteins to construct fusion proteins, and the fusion proteins were fully synthesized after Escherichia coli codon optimization. The fusion proteins were fully synthesized by Nanjing GenScript Biotechnology Co., Ltd. in the Escherichia coli expression vector pET28a, and the cloning sites were NdeI and BamHI.

[0039] The plasmids pET28a-Fel d1-H, pET28a-1AD1-Fel d1-H, pET28a-1AD2-Fel d1-H, pET28a-Fel d1-1AD3-H, pET28a-Fel d3-H, pET28a-3AD1-Fel were synthesized for the whole gene. d3-H, pET28a-Feld3-3AD2-H, pET28a-Fel d4-H, pET28a-4AD1-Fel d4-H, pET28a-4AD2-Fel d4-H, pET28a-Fel d4-4AD3-H, pET28a-Fel d7-H, pET28a-7AD1-Fel d7-H, pET28a-7AD2-Fel d7-H, pET28a-Fel d7-7AD3-H, pET28a-Fel d8-H, and pET28a-8AD1-Fel d8-H were used to transform competent BL21 (DE3).

[0040] The amino acid sequences of the selected B cell antigen epitopes Feld1-AD1, Feld1-AD2, Feld1-AD3, Feld3-AD1, Feld3-AD2, Feld4-AD1, Feld4-AD2, Feld4-AD3, Feld7-AD1, Feld7-AD2, Feld7-AD3, and Feld8-AD1 are shown in SEQ ID NOs. 1 to 12, and the codon-optimized nucleic acid sequences are shown in SEQ ID NOs. 13 to 24;

[0041] The constructed pET28a-Fel d1-H, pET28a-1AD1-Fel d1-H, pET28a-1AD2-Fel d1-H, pET28a-Fel d1-1AD3-H, pET28a-Fel d3-H, pET28a-3AD1-Fel d3-H, pET28a-Fel d3-3AD2-H, pET28a-Fel d4-H, pET28a-4AD1-Fel d4-H, pET28a-4AD2-Fel d4-H, pET28a-Fel d4-4AD3-H, pET28a-Fel d7-H, pET28a-7AD1-Fel d7-H, pET28a-7AD2-Fel The amino acid sequences of pET28a-Feld7-7AD3-H, pET28a-Fel d8-H, and pET28a-8AD1-Fel d8-H are shown in SEQ ID NOs. 25 to 41, and the codon-optimized nucleic acid sequences are shown in SEQ ID NOs. 42 to 58.

[0042] 2. Construction of recombinant E. coli expression strain

[0043] 1) Take out the expression strain (BL21(DE3)) from the -80℃ refrigerator, thaw it in an ice bath, add 1μL of the constructed plasmid and 10μL of competent medium into a new sterile 1.5ml EP tube at a volume ratio of 1:10, pipette gently to mix, and place on ice for 30min;

[0044] 2) Then heat stress at 42°C for 90 seconds, followed by an ice bath for 5 minutes;

[0045] 3) Add 200 μL of antibiotic-free LB liquid medium to the centrifuge tube and culture at 37°C with gentle shaking for 60 min;

[0046] 4) Spread the resuspended bacterial solution evenly on LB solid medium containing 50 μg / mL Kana, place it in a 37°C incubator and culture it on its front side for about 15 minutes. After all the liquid is absorbed, turn the plate upside down and culture it for 12-16 hours.

[0047] 3. PCR Identification of Recombinant Prokaryotic Strains

[0048] Use a sterilized pipette tip to carefully pick up single colonies with Kana resistance growing on the above LB plates, pick 3 colonies from each plate, pick the colonies into 2 mL LB liquid culture medium containing 50 μg / mL Kana, and activate and culture at 37°C, 200 r / min for 4 hours; perform PCR identification of the cultured bacterial solution according to the system and procedure in Tables 1 and 2.

[0049] The primers used for PCR identification are:

[0050] Primer F (SEQ ID NO. 59): ACTTTAAGAAGGAGATATAC;

[0051] Primer R (SEQ ID NO. 60): CGAATTCGGATCCTTAGTGG;

[0052] Table 1 PCR identification system

[0053]

[0054] Table 2 PCR identification procedures for recombinant bacterial solution

[0055]

[0056] The results are as follows Figure 1(M: 5000bp DNA Marker; 1: Recombinant Escherichia coli BL21(DE3) / pET28a-Fel d1-H culture medium; 2: Recombinant Escherichia coli BL21(DE3) / pET28a-1AD1-Fel d1-H culture medium; 3: Recombinant Escherichia coli BL21(DE3) / pET28a-1AD2-Fel d1-H culture medium; 4: Recombinant Escherichia coli BL21(DE3) / pET28a-1AD3-Fel d1-H culture medium; 5: Recombinant Escherichia coli BL21(DE3) / pET28a-Fel d3-H culture medium; 6: Recombinant Escherichia coli BL21(DE3) / pET28a-3AD1-Fel d3-H culture medium; 7: Recombinant Escherichia coli BL21(DE3) / pET28a-Fel d3-3AD2-H; 8: recombinant Escherichia coli BL21 (DE3) / pET28a-Fel d4-H; 9: recombinant Escherichia coli BL21 (DE3) / pET28a-4AD1-Fel d4-H; 10: recombinant Escherichia coli BL21 (DE3) / pET28a-4AD2-Fel d4-H; 11: recombinant Escherichia coli BL21 (DE3) / pET28a-Fel d4-4AD3-H; 12: recombinant Escherichia coli BL21 (DE3) / pET28a-Fel d7-H; 13: recombinant Escherichia coli BL21 (DE3) / pET28a-7AD1-Fel d7-H; 14: recombinant Escherichia coli BL21 (DE3) / pET28a-7AD2-Fel coli BL21(DE3) / pET28a-Fel d7-7AD3-H; 16: recombinant Escherichia coli BL21(DE3) / pET28a-Fel d8-H; 17: recombinant Escherichia coli BL21(DE3) / pET28a-8AD1-Fel d8-H), it can be seen that the recombinant Escherichia coli expressing the combination of different cat hair allergy proteins and different B cell epitopes of the cat's own body was successfully constructed.

[0057] 4. Inducible expression of recombinant prokaryotic strains

[0058] 1) The strains with positive identification and brighter nucleic acid bands were inoculated into 100 mL of LB liquid medium containing 50 μg / mL Kana at a volume ratio of 1%, and cultured at 37°C, 200 rpm, and shaken for 4 h until OD600 = 0.6-0.8;

[0059] 2) Add IPTG of corresponding concentration to the above bacterial solution, and induce overnight shaking culture at 37°C and 200 rpm;

[0060] 3) Take the overnight expression bacterial solution and perform ultrasonic disruption (ultrasonication conditions: 5s ultrasonication, 5s interval, 10min, 30% power), centrifuge the disrupted sample (12,000rpm, 4°C, centrifuge for 10min) to collect the supernatant and precipitate;

[0061] Take an appropriate amount of precipitate for SDS-PAGE to check the protein expression and perform SDS-PAGE analysis. The results are as follows: Figure 2 (M: protein marker; 1: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-Fel d1-H; 2: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-1AD1-Fel d1-H; 3: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-1AD2-Fel d1-H; 4: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-1AD3-Fel d1-H; 5: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-Fel d3-H; 6: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-3AD1-Fel d3-H; 7: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-Fel d3-3AD2-H induced bacteria), Figure 3(M: protein marker; 8: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-Fel d4-H; 9: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-4AD1-Fel d4-H; 10: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-4AD2-Fel d4-H; 11: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-Fel d4-4AD3-H; 12: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-Fel d7-H; 13: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-7AD1-Fel d7-H; 14: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-7AD2-Fel coli BL21(DE3) / pET28a-Fel d7-7AD3-H; 16: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-Fel d8-H; 17: induced bacteria of recombinant Escherichia coli BL21(DE3) / pET28a-8AD1-Fel d8-H), it can be seen that the expression levels of the fusion expression of different cat hair allergy proteins with different B cell epitopes of the cat hair allergy protein are quite different, and a fusion expression scheme with high expression level was successfully screened.

[0062] 5. Crude extraction, renaturation and purification of expression products

[0063] 1) Add 10 g of lysis buffer (40 mM Tris, 0.1-0.2 M NaCl, pH 7.0-9.0) to 1 g of wet cells and stir magnetically for 30-60 min;

[0064] 2) After resuspending, the bacterial suspension was placed in an ice bath and then subjected to ultrasonic disruption. The disruption conditions were 65% power, 5 seconds of ultrasonication, 5 seconds of rest, and a total of 20 minutes of disruption.

[0065] 3) Centrifuge at 10000g, 4°C for 20 min, discard the supernatant, add the same volume of inclusion body washing solution (40mM Tris, 0.1MNaCl, 2-4M Urea, 0.5-1% Triton X-100, pH7.0-9.0) as the lysis solution to the precipitate, and stir magnetically for 30-60 min;

[0066] 4) Centrifuge at 10,000 g, 4°C for 20 min, discard the supernatant, add the same volume of inclusion body solubilization solution (40 mM Tris, 0.1 M NaCl, 6-8 M Urea, pH 7.0-9.0) as the lysis solution to the precipitate, and stir magnetically at room temperature for 4-16 h;

[0067] 5) 10000g, 4℃, centrifuge for 20min, filter the supernatant through 0.45um and then renature, the renaturation method is dilution renaturation, slowly add the renaturation solution to the protein while stirring, the renaturation solution is 40mM Tris, 0.1-0.3M NaCl, 0.3-0.5MArg, 1-5mM GSH, 0.1-0.5mM GSSH, pH7.0-9.0), renaturation temperature is 4-8℃, dilution multiple is 10-30 times, renaturation time is 12-48h;

[0068] 6) After dilution and renaturation, the sample is filtered through 0.45 μm and then subjected to reductant-resistant Ni column affinity chromatography to obtain a high-purity renaturation active target product;

[0069] 7) After chromatography, the sample was concentrated and dialyzed through a 5KD ultrafiltration membrane package to a final concentration of 1-2 mg / ml. The final solution was 0.1-0.3 M sorbitol, 0.05-0.1 M sodium acetate buffer, pH 4.0-5.0.

[0070] 6. Cultivation and yield comparison of prokaryotic strains

[0071] The 17 recombinant prokaryotic strains were fermented in a fermenter.

[0072] 6.1 Preparation of seed culture medium

[0073] Liquid LB medium: weigh 4g of peptone, 2g of yeast extract, and 4g of sodium chloride on a precision balance and place in a 1L Erlenmeyer flask. Add 300mL of ultrapure water to dissolve, stir on a stirrer to fully dissolve, adjust the pH to 7.2 with 1mM NaOH, pour the solution into a measuring cylinder, add water to make up to 400mL, sterilize at 121℃ for 20min, and store at room temperature.

[0074] 6.2 Fermentation medium preparation

[0075] Fermentation medium: Weigh 36.0g Angel Yeast Peptone, 72.0g Angel Yeast Extract Powder, 12g Glycerol, 11.49g Potassium Hydrogen Phosphate, and 37.62g Potassium Hydrogen Phosphate on a precision balance and place in a 5L plastic volumetric bucket. Add 2800mL ultrapure water to dissolve, stir on a stirrer to fully dissolve, add water to make the volume 3000mL, pour the solution into a 10L automatic fermentation tank, and sterilize at 121℃ for 20min.

[0076] Initial feed medium: Weigh 60.0g Angel Yeast Peptone, 120.0g Angel Yeast Extract Powder, and 35g Glycerol on a precision balance and place in a 1L beaker. Add 900mL ultrapure water to dissolve, stir on a stirrer to fully dissolve, add water to make the volume 1000mL, pour the solution into a 1L blue cap bottle, and sterilize at 121℃ for 20min.

[0077] Induction feed medium: Weigh 180.0g Angel Yeast Peptone, 360.0g Angel Yeast Extract Powder, and 105g Glycerol on a precision balance and place in a 3L beaker. Add 2800mL ultrapure water to dissolve, stir on a stirrer to fully dissolve, add water to make the volume 3000mL, pour the solution into a 3L blue cap bottle, and sterilize at 121℃ for 20min.

[0078] 6.3 Other reagents configuration

[0079] Preparation of ammonia solution: Take 150mL of ultrapure water and place it in a 500mL blue-capped bottle. Sterilize it at 121℃ with high pressure and wet heat for 20min. After sterilization, cool it to room temperature. Add 150mL of 28% ammonia water to the blue-capped bottle on a clean workbench to prepare a 50% ammonia solution.

[0080] Preparation of phosphoric acid solution: Take 150mL ultrapure water and place it in a 500mL blue-cap bottle, add 150mL 85% phosphoric acid, shake well, and sterilize at 121℃ with high pressure and wet heat for 20min;

[0081] Defoamer preparation: Take 10mL of defoamer and place it in a 100mL blue-cap bottle, add 90mL of ultrapure water, shake well, and sterilize at 121℃ with high pressure and wet heat for 20min;

[0082] IPTG inducer preparation: Weigh 11.9 g IPTG on a precision balance and place in a 250 mL beaker. Add 80 mL ultrapure water to dissolve, stir on a stirrer to fully dissolve, add water to make up to 100 mL, and filter to sterilize.

[0083] During the experiment, except for the above-mentioned key raw materials, other relevant reagents and solutions were prepared according to relevant requirements.

[0084] 6.4 Seed liquid inoculation culture

[0085] Seed liquid inoculation culture: Thaw the seed glycerol bacteria stored at -80℃ at room temperature, take 400μL bacteria and inoculate 400ml liquid LB medium, then add the corresponding screening resistance, and culture at 37℃ for 16h;

[0086] 6.5 Fermentation tank culture

[0087] 1) Preparation: Take out the sterilized fermentation tank containing the initial fermentation medium from the 150L vertical high-pressure steam sterilizer, connect the air, cooling circulating water pipelines, dissolved oxygen, pH probe, feed pipeline, etc., and make preparations before inoculation;

[0088] 2) Cultivation: Inoculate 400 ml of the seeds prepared in step 1.3 into 3 L of fermentation medium, set the temperature, air flow, pressure, and monitor DO and pH;

[0089] 3) Feeding: When the OD600 of the bacterial culture reaches 7-9, start adding the initial feed medium for feeding;

[0090] 4) Induction: When the bacterial culture OD600 reaches 15-20, lactose inducer is added to induce the exogenous gene to begin to express;

[0091] 5) Harvest: After fermentation, collect the bacterial liquid, centrifuge at 4000 rpm for 30 min, pour off the supernatant, and collect the bacterial cells.

[0092] According to the steps in point 5, the purified protein was collected and the protein yield per liter of fermentation broth was calculated using the Coomassie blue staining method. The results are shown in Table 3:

[0093] Table 3 Protein expression of recombinant strains

[0094] Recombinant prokaryotic strain Yield BL21(DE3) / pET28a-Fel d1-H 0.40 g / L BL21(DE3) / pET28a-1AD1-Fel d1 2.12 g / L BL21(DE3) / pET28a-1AD2-Fel d1-H 0.61 g / L BL21(DE3) / pET28a-Fel d1-1AD3-H 2.27 g / L BL21(DE3) / pET28a-Fel d3-H 0.15 g / L BL21(DE3) / pET28a-3AD1-Fel d3-H 0.34 g / L BL21(DE3) / pET28a-Fel d3-3AD2-H 0.50 g / L BL21(DE3) / pET28a-Fel d4-H 0.42 g / L BL21(DE3) / pET28a-4AD1-Fel d4-H 0.65 g / L BL21(DE3) / pET28a-4AD2-Fel d4-H 1.64 g / L BL21(DE3) / pET28a-Fel d4-4AD3-H 1.88 g / L BL21(DE3) / pET28a-Fel d7-H 0.36 g / L BL21(DE3) / pET28a-7AD1-Fel d7-H 1.25 g / L BL21(DE3) / pET28a-7AD2-Fel d7-H 0.60 g / L BL21(DE3) / pET28a-Fel d7-7AD3-H 1.72 g / L BL21(DE3) / pET28a-Fel d8-H 0.28 g / L BL21(DE3) / pET28a-8AD1-Fel d8-H 1.78 g / L

[0095] As can be seen from Table 3, compared with the scheme without fusion expression of Fel d1, Fel d3, Fel d4, Fel d7, and Fel d8, the recombinant strains BL21(DE3) / pET28a-1AD1-Fel d1, BL21(DE3) / pET28a-Fel d1-1AD3-H, BL21(DE3) / pET28a-Fel d3-3AD2-H, BL21(DE3) / pET28a-4AD2-Fel d4-H, BL21(DE3) / pET28a-Fel d4-4AD3-H, BL21(DE3) / pET28a-7AD1-Fel d7-H, BL21(DE3) / pET28a-Fel The protein expression levels of d7-7AD3-H and BL21(DE3) / pET28a-8AD1-Fel d8-H were significantly increased.

[0096] 7. Immunization of laying hens

[0097] The purified proteins Fel d1-H, 1AD1-Fel d1-H, 1AD2-Fel d1-H, Fel d1-1AD3-H, Feld3-H, 3AD1-Fel d3-H, Fel d3-3AD2-H, Fel d4-H, 4AD1-Fel d4-H, 4AD2-Fel d4-H, Fel d4-4AD3-H, Fel d7-H, 7AD1-Fel d7-H, 7AD2-Fel d7-H, Fel d7-7AD3-H, Fel d8-H, and 8AD1-Feld8-H were used to immunize 17 groups of 20-week-old laying hens, with 5 hens in each group. The purified proteins were mixed with aluminum hydroxide gel to 1 ml (protein content 200 μg / ml), and the aluminum hydroxide gel adjuvant accounted for 20% after mixing. The mixed immune preparation is injected at multiple points on the skin under the chicken wings.

[0098] After the first immunization, booster immunization was performed in the second and fourth weeks, and eggs were collected to extract yolk antibodies, and the antibody titer was tested. The results are shown in Table 4:

[0099] Table 4 Yolk antibody titer detection (2 X )(n=5)

[0100] W1 W2 W3 W4 W5 W6 Fel d1-H 1.50±0.50 4.25±0.25 10.25±0.75 12.00±0.50 13.50±0.75 14.55±0.50 1AD1-Fel d1 1.75±0.25 6.75±0.50 11.75±0.50 15.00±0.50 15.75±0.50 17.25±0.50 1AD2-Fel d1-H 1.50±0.50 6.75±0.25 11.25±0.75 14.75±0.25 15.00±0.50 16.50±0.25 Fel d1-1AD3-H 1.75±0.50 7.00±0.50 11.50±0.75 14.75±0.50 15.25±0.25 17.00±0.25 Fel d3-H 1.50±0.50 4.00±0.50 10.25±0.50 11.75±0.25 12.75±0.75 14.00±0.50 3AD1-Fel d3-H 1.75±0.75 7.00±0.25 11.25±0.75 14.75±0.50 15.00±0.50 16.75±0.50 Fel d3-3AD2-H 1.75±0.75 7.25±0.50 12.00±0.50 15.00±0.50 15.75±0.25 17.00±0.50 Fel d4-H 1.75±0.25 4.50±0.25 11.00±0.25 12.50±0.25 13.75±0.75 15.00±0.25 4AD1-Fel d4-H 1.75±0.50 6.25±0.75 11.75±0.25 14.50±0.25 15.25±0.25 16.50±0.25 4AD2-Fel d4-H 2.00±0.25 7.25±0.50 12.00±0.50 15.00±0.50 16.00±0.25 17.25±0.25 Fel d4-4AD3-H 2.00±0.50 7.50±0.75 12.50±0.50 15.50±0.25 16.50±0.50 17.75±0.50 Fel d7-H 1.50±0.50 4.75±0.50 10.25±0.75 12.75±0.25 14.00±0.25 15.00±0.50 7AD1-Fel d7-H 1.75±0.25 5.75±0.50 11.25±0.50 14.25±0.25 15.50±0.50 16.75±0.75 7AD2-Fel d7-H 2.00±0.25 6.25±0.50 11.50±0.50 14.50±0.25 15.50±0.75 16.25±0.50 Fel d7-7AD3-H 1.75±0.25 7.25±0.75 12.75±0.75 15.75±0.50 16.75±0.75 17.50±0.75 Fel d8-H 1.75±0.25 4.25±0.50 10.00±0.50 12.25±0.50 13.75±0.50 15.50±0.25 8AD1-Fel d8-H 2.25±0.25 7.50±0.50 12.50±0.25 15.25±0.25 16.50±0.50 17.00±0.50

[0101] As shown in Table 4, after booster immunization, the antibody titers of each fusion protein began to increase significantly. There were certain differences in the antibody titers of the antigen epitope fusion protein groups, but they were all significantly higher than those of the group without epitopes. The titers of 1AD1-Fel d1 group, 1AD2-Feld1-H group, and Fel d1-1AD3-H group were significantly higher than those of Fel d1-H group, and 1AD1-Fel d1 and Fel d1-1AD3-H were preferred; the titers of 3AD1-Fel d3-H group and Fel d3-3AD2-H group were significantly higher than those of Fel d3-H group, and Fel d3-3AD2-H were preferred; the titers of 4AD1-Fel d4-H group, 4AD2-Fel d4-H group, and Fel d4-4AD3-H group were significantly higher than those of Fel d4-H group, and Fel d4-4AD3-H were preferred; the titers of 7AD1-Fel d7-H group, 7AD2-Fel d7-H group, and Fel d7-7AD3-H group were significantly higher than those of Fel d7-H group, and Fel d The titer of d7-7AD3-H; 8AD1-Fel d8-H group was significantly higher than that of Fel d8-H group, and 8AD1-Fel d8-H was preferred.

[0102] 8. Preparation and effect testing of functional cat food or additives

[0103] After preparing vaccines with 1AD1-Fel d1, Fel d3-3AD2-H, Fel d4-4AD3-H, Fel d7-7AD3-H, and 8AD1-Fel d8-H fusion proteins, laying hens were immunized at 1, 2, and 4 weeks, and the content of each protein was not less than 200 μg / ml. The egg yolks of each group were collected for extraction and freeze-dried, and the egg yolk extracts were sprayed on cat nutritional additives according to the titer (the titer of Fel d1, Fel d3, Fel d4, Fel d7, and Fel d8 antibodies per gram of the finished cat nutritional additive was not less than 3000), and low-temperature dried.

[0104] Thirty adult male cats (weight 1.5-2kg / cat) were randomly divided into an experimental group and a control group, 15 cats in each group. The experimental group was fed with a functional cat nutritional additive sprayed with egg yolk containing Fel d1, Fel d3, Fel d4, Fel d7, and Fel d8 antibodies, and the control group was fed with a cat nutritional additive sprayed with ordinary egg yolk. The cat hair of each group was collected at 0w, 2w, 4w, 6w, and 8w, and the Fel d1, Fel d3, Fel d4, Fel d7, and Fel d8 antigens on the cat hair were detected by Elisa method. The results are shown in Table 5:

[0105] Table 5 Detection of Fel d1, Fel d3, Fel d4, Fel d7 and Fel d8 proteins on cat hair (μg / g hair)

[0106]

[0107] The results showed that during the test period, the content of allergens Fel d1, Fel d3, Fel d4, Fel d7, and Feld8 in cat hair did not change significantly in the control group. After 2 weeks of feeding, the content of allergens Fel d1, Fel d3, Fel d4, Fel d7, and Fel d8 in cat hair in the egg yolk antibody experimental group tended to decrease, and a significant decrease occurred after 4 weeks, and the decrease rate exceeded 55% after 6 weeks.

[0108] The egg yolk antibody extracts of Fel d1, Fel d3, Fel d4, Fel d7 and Fel d8 were randomly combined to prepare egg yolk antibody nutritional additives (the titer of egg yolk antibody contained in each gram of the finished product was not less than 3000). 55 adult male cats (weight 1.5-2kg / cat) were evenly divided into 11 groups, 5 cats in each group, and fed at a dose of 2g / day to test the content of each corresponding allergen, and the percentage of reduction of each allergen before and after feeding was calculated. The results are shown in the following table:

[0109] Table 6 Evaluation of the effect of different compositions of egg yolk antibodies in reducing allergens

[0110]

[0111] Note: The content of allergens Fel d1, Fel d3, and Fel d4 was measured in the Feld1-3-4-7 group; the content of allergens Feld1, Fel d3, Fel d4, and Fel d7 was measured in the Feld1-3-4-7-8 group; the content of allergens Fel d1, Fel d3, Fel d4, Feld7, and Fel d8 was measured in the Feld1-3-4-7-8 group.

[0112] As shown in Table 6, the allergens in each test group decreased significantly after 4 weeks of feeding, and the decrease rate exceeded 58% after 6 weeks. Pet owners can selectively feed cats with cat food or additives containing the antibody of the composition according to their sensitivity to allergens.

Claims

1. A cat hair allergy recombinant fusion protein, characterized in that: The protein is obtained by fusing cat hair allergy protein, or cat hair allergy protein with its corresponding B cell epitope and then expressing it.

2. The cat hair allergy recombinant fusion protein according to claim 1, characterized in that: The cat hair allergy proteins include but are not limited to Feld1, Feld3, Feld4, Feld7, and Feld8.

3. The cat hair allergy recombinant fusion protein according to claim 1, characterized in that: The B cell antigen epitopes include but are not limited to Feld1-AD1, Feld1-AD2, Feld1-AD3, Feld3-AD1, Feld3-AD2, Feld4-AD1, Feld4-AD2, Feld4-AD3, Feld7-AD1, Feld7-AD2, Feld7-AD3, and Feld8-AD1, whose amino acid sequences are shown in SEQ ID NOs.1 to 12, and whose codon-optimized nucleic acid sequences are shown in SEQ ID NOs.13 to 24.

4. The cat hair allergy recombinant fusion protein according to claim 1, characterized in that: The amino acid sequence of the protein expressed by using the cat hair allergy protein is shown in SEQ ID NOs. 25 to 29, and the codon-optimized nucleic acid sequence is shown in SEQ ID NOs. 30 to 34.

5. The cat hair allergy recombinant fusion protein according to claim 1, characterized in that: The cat hair allergy protein is fused with its corresponding B cell epitope and then expressed to obtain an amino acid sequence of the protein as shown in SEQ ID NOs.35-46, and a codon-optimized nucleic acid sequence as shown in SEQ ID NOs.47-58.

6. A method for preparing the cat hair allergy recombinant fusion protein according to any one of claims 1 to 5, characterized in that: The steps include: 1) Analyze the protein structure of cat hair allergy protein, analyze and screen out suitable B cell antigen epitopes; The cat hair allergy protein is as shown in claim 2; The B cell antigen epitope is as shown in claim 3; 2) fusing the selected B cell antigen epitope with its corresponding cat hair allergy protein to construct a fusion protein; 3) After codon optimization, the fusion protein is fully synthesized and constructed into an expression vector to obtain a recombinant plasmid; 4) transforming the recombinant plasmid into an expression strain to obtain a recombinant expression strain; 5) Induce the expression of the recombinant expression strain, perform crude extraction and purification, renaturation and purification on the expression product, and obtain the cat hair allergy recombinant fusion protein.

7. The method for preparing the cat hair allergy recombinant fusion protein according to claim 6, characterized in that: The expression system used in the preparation method includes but is not limited to an Escherichia coli expression system, a yeast expression system, and a cell expression system.

8. The method for preparing the cat hair allergy recombinant fusion protein according to claim 6, characterized in that: The expression strain is preferably Escherichia coli, including but not limited to BL21, cBL21, BL21 (DE3), BL21codonplus (DE3), BL21 Star (DE3), B834 (DE3), Tuner (DE3), Rosetta (DE3), Rosetta2 (DE3), Arctic Express (DE3), Origami (DE3), Origami2 (DE3), OrigamiB (DE3), SHuffle T7, ER2566, OverExpress C43 (DE3), BLR (DE3), HMS174 (DE3), GT115, MG1655, NovaBlue (DE3) and related modified strains.

9. Use of the cat hair allergy recombinant fusion protein according to any one of claims 1 to 5 in the preparation of broad-spectrum egg yolk antibodies and functional cat food or additives.

10. The use according to claim 9, characterized in that: The preparation of the broad-spectrum and high-titer yolk antibody is as follows: cat hair allergy recombinant fusion proteins are randomly combined, mixed with adjuvants to prepare an immune preparation, and then immunized laying hens, and then eggs are collected to extract yolk antibodies, so as to obtain broad-spectrum and high-titer yolk antibodies; The functional cat food or additive is prepared by spraying the egg yolk antibody on the cat food or additive according to the potency, and drying at low temperature to obtain the functional cat food or additive that reduces allergic reactions.

Images