Pseudomonas neoantibioticum for preventing and controlling tomato bacterial wilt and promoting tomato growth and application thereof

Abstract

The application discloses a Pseudoneobacillus sp. capable of efficiently preventing and controlling tomato bacterial wilt and promoting tomato growth and an application thereof, and belongs to the technical field of agricultural microorganisms. The strain C159 is identified as a potential new species of Pseudoneobacillus sp., and is named Pseudoneobacillus sp. C159. The strain has been preserved in the Guangdong Microbial Culture Collection Center (GDMCC), and has a preservation number of GDMCC No: 65250. The Pseudoneobacillus sp. disclosed by the application can produce IAA, mineralize insoluble organic phosphorus, significantly reduce the incidence of tomato bacterial wilt (the disease resistance efficiency is as high as 89.29%), and significantly promote the growth of tomato plants (the growth promotion efficiency is as high as 22.68%). Therefore, the Pseudoneobacillus sp. C159 disclosed by the application has important research value and application potential in improving the bacterial wilt resistance of crops and promoting the growth of crops.

Description

Technical Field

[0001] The present invention relates to the technical field of agricultural microorganisms, and in particular to a pseudoneobacillus strain capable of effectively preventing and controlling tomato bacterial wilt and promoting tomato growth, and applications thereof. Background Art

[0002] Tomato (Solanum lycopersicum), as one of the important vegetable crops in the world, has extremely high economic and nutritional value. According to statistics from the Food and Agriculture Organization of the United Nations, the global tomato planting area in 2020 was approximately 5.055 million hectares, with an annual output of 182 million tons, making it one of the most widely consumed horticultural crops in the world. Tomatoes are rich in vitamin C, vitamin A and a variety of antioxidants (such as lycopene), which play a significant role in preventing cardiovascular disease, certain cancers and other chronic diseases. However, tomatoes face many challenges in the production process, especially disease invasions, and tomato bacterial wilt is particularly serious. The disease is caused by Ralstonia solanacearum, which can cause tomato plants to wilt. In severe cases, the yield loss can reach more than 80%, or even total failure, causing huge losses to farmers and the agricultural industry.

[0003] Faced with the increasingly serious problem of crop diseases, traditional chemical pesticide control methods, while effective in the short term, have raised questions about their sustainability due to the negative impacts of long-term use, including soil and water pollution, food safety risks, and ecological imbalance. Modern agriculture urgently needs to find alternative protective measures, and microbial technology has emerged as a solution. Microorganisms, particularly disease-resistant and plant growth-promoting microorganisms, not only enhance plant disease resistance by secreting antimicrobial compounds or enhancing plant immune responses, but also promote plant growth by producing siderophores, IAA, or dissolving / mineralizing insoluble phosphorus in the soil. The application of these microorganisms can enhance plant disease resistance, increase crop yields, improve crop quality, and significantly reduce pesticide use, thereby achieving environmentally friendly and economically sustainable agriculture.

[0004] As microbial agents become increasingly popular in the market, existing products face significant homogeneity and poor functional stability, resulting in suboptimal results. This situation necessitates the development of new microbial products, and the key lies in identifying highly effective new microbial resources. By screening and utilizing new microbial resources with disease resistance and plant growth-promoting properties, we can provide a more effective biomass foundation for crops, minimize the drawbacks of existing microbial agents, and align closely with the requirements of sustainable agricultural development. Summary of the Invention

[0005] The purpose of the present invention is to provide a new species of Pseudoneobacillus sp. C159 with disease resistance and growth promotion, so as to provide a new microbial resource for improving the resistance of crops to bacterial wilt and promoting crop growth.

[0006] To achieve the above objectives, the present invention provides a new species C159 of the genus Pseudoneobacillus isolated from tomato rhizosphere soil and named Pseudoneobacillus sp. C159. The strain is deposited in the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, with a deposit number of GDMCC No: 65250 and a deposit date of October 14, 2024.

[0007] Identification characteristics of the described pseudoneobacillus:

[0008] Strain C159 is a Gram-positive bacterium. On TSA medium, single colonies are approximately round, off-white in the center, surrounded by a white ring, matte on the surface, and with irregular edges. The 16S rRNA gene sequence of strain C159 is 1550 bp long. Sequence alignment analysis showed that this strain is similar to Pseudoneobacillus rhizosphaerae JJ-79. T The strain C159 has the highest similarity of 98.70%. Based on the results of comparative genome analysis, the strain C159 has the highest similarity of 98.70% with the only model species of the genus Pseudoneobacillus rhizosphaerae JJ-79. T The average nucleotide identity was 75.31% and the digital DNA-DNA hybridization value was 19.60%.The results showed that strain C159 represents a new species of the genus Pseudomonas.

[0009] The present invention found that strain C159 has the ability to produce IAA, which is 33.72 mg·L -1 .

[0010] The present invention found that strain C159 can mineralize insoluble organic phosphorus.

[0011] The present invention found that inoculating the tomato root system with the strain C159 can significantly reduce the incidence of tomato bacterial wilt, and the disease resistance efficiency is 89.29%.

[0012] The present invention found that inoculating the tomato root system with the strain C159 can significantly promote the growth of tomato plants, with the growth-promoting effect on the aboveground part being 10.45%, the root system being 51.64%, and the whole plant being 22.68%.

[0013] The present invention also provides a microbial fertilizer and / or microbial preparation, characterized in that it contains the pseudoneobacillus C159, or its fermentation liquid, or the supernatant of its fermentation liquid as an active ingredient.

[0014] The present invention also provides the use of the above-mentioned Bacillus pseudoneosubtilis C159 or the above-mentioned microbial fertilizer and / or microbial preparation in producing IAA.

[0015] The present invention also provides the use of the above-mentioned Bacillus pseudoneosubtilis C159 or the above-mentioned microbial fertilizer and / or microbial preparation in the mineralization of insoluble organic phosphorus.

[0016] The present invention also provides the use of the above-mentioned Bacillus pseudoneobacillus C159, or its fermentation broth, or the supernatant of its fermentation broth, or the above-mentioned microbial fertilizer and / or microbial preparation in biological control of tomato bacterial wilt.

[0017] The present invention also provides the use of the above-mentioned Bacillus pseudoneosubtilis C159, or its fermentation liquid, or the supernatant of its fermentation liquid, or the above-mentioned microbial fertilizer and / or microbial preparation in promoting tomato growth.

[0018] Preferably, the crop is tomato.

[0019] The present invention has the following advantages over the prior art:

[0020] 1) Pseudomonas C159 is a new species distinct from other Pseudomonas bacteria. Furthermore, only one species of Pseudomonas has been reported to date.

[0021] 2) Pseudomonas aeruginosa C159 can not only produce IAA (33.72 mg·L -1 ), and can also mineralize insoluble organic phosphorus.

[0022] 4) Pseudomonas aeruginosa C159 can significantly reduce the incidence of tomato bacterial wilt, with an anti-disease efficiency of up to 89.29%.

[0023] 5) Pseudomonas aeruginosa C159 can significantly promote the growth of tomato plants, with the growth-promoting effects on the aboveground part, root system and the whole plant reaching 10.45%, 51.64% and 22.68%, respectively.

[0024] Therefore, the pseudoneobacillus C159 disclosed in the present invention can improve the resistance of crops to bacterial wilt and promote crop growth, and has broad application prospects in the preparation of crop microbial fertilizers and microbial preparations.

[0025] Pseudoneobacillus sp.C159 is deposited in the Guangdong Provincial Microbiological Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province, Postal Code: 510070, with the deposit number GDMCC No: 65250 and the deposit date being October 14, 2024. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the colony morphology of Bacillus pseudoneocolitis C159 on TSA medium.

[0027] Figure 2 This is the phylogenetic tree of the genome of Bacillus pseudoneocolitis C159.

[0028] Figure 3 It is the insoluble organic phosphorus mineralized by Bacillus pseudoneoplasticus.

[0029] Figure 4 The effect of inoculation with Bacillus pseudoneoplasticus C159 on tomato bacterial wilt and plant growth.

[0030] Figure 5 It is the effect of Bacillus pseudoneoplasticus C159 on the disease grade, plant biomass, aboveground biomass and root biomass of plants. DETAILED DESCRIPTION

[0031] The following are specific implementation examples of the present invention. It should be noted that these embodiments are merely examples and do not constitute any limitation on the scope of the present invention. Modifications and replacements of the details and forms of the embodiments within the scope of the present invention fall within the scope of protection of the present invention.

[0032] Unless otherwise defined, the technical terms used in the following examples have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. The experimental reagents used in the following examples, unless otherwise specified, are all conventional biochemical reagents.

[0033] Example 1: Isolation of strain C159

[0034] The soil used to isolate strain C159 was collected from a tomato field in Jintang Town, Maonan District, Maoming City, Guangdong Province. Soil bacteria were isolated using high-throughput bacterial isolation, culture, and identification techniques. The specific procedure was as follows: 1 g of fresh soil was diluted 5000-fold and then 2000-fold with sterile magnesium chloride solution and 10% TSB liquid medium, respectively. 160 μL of the diluted solution was added to 48 96-well cell culture plates and incubated at 30°C in the dark for 2 weeks. 10 μL of the bacterial solution was evenly aspirated from each well of the culture plate and bacterial DNA was extracted using alkaline lysis. 140 μL of 80% (v / v) glycerol was added to the remaining bacterial solution and stored as a bacterial glycerol stock for subsequent bacterial activation. PCR amplification was performed using primers 799F / 1193R (V5-V7 region of the 16S rRNA gene) and Novozymes Green Taq Mix. The product was diluted 120 times and used as a template for PCR amplification using primers 799F and 1193R with sequencing adapters (Illumina adapters) and barcodes. The second-round PCR product was electrophoresed, and the approximately 550bp band was excised for purification and its product concentration was determined. Each 96-well plate was prepared according to 100ng, and the mixed library of 48 plates totaled 4800ng. High-throughput sequencing was performed at Beijing Novogene Technology Co., Ltd. The sequencing data was analyzed using the analysis process Culturome (https: / / github.com / YongxinLiu / Culturome) to determine the position of the cultured bacteria in the 96-well plate. 25μL of bacterial solution was aspirated from the wells of the corresponding 96-well cell culture plate and the bacteria were activated on 1 / 2TSA medium. The bacteria were purified by multiple streaking method, and the purified bacterial strain was mixed with 25% glycerol (v / v) and stored in a -20℃ refrigerator.

[0035] The strain C159 was identified as a Gram-positive bacterium. The single colony on TSA medium was approximately round, with a beige center, a white circle around it, a dull surface, and irregular edges ( Figure 1 ).

[0036] Example 2: 16S rRNA gene sequence analysis of strain C159

[0037] The genomic DNA of strain C159 was extracted using the HiPure Bacterial DNA Kit (Cat. No. D3146-02) of Guangzhou Meiji Biotechnology Co., Ltd., and the full length of the 16S rRNA gene was amplified using the bacterial universal primers 27F / 1492R. The PCR product was sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing. The sequence is shown in SEQ ID NO.1, with a length of 1550bp. The sequences obtained by sequencing were compared on the EzBioCloud (https: / / www.ezbiocloud.net / identify) website. The results showed that strain C159 was similar to the model species Pseudoneobacillus rhizosphaerae JJ-79 T The highest similarity was 98.70%. It is noteworthy that only one species of the genus Pseudoneobacillus, Pseudoneobacillus rhizosphaerae, has been reported. Based on 16S rRNA gene sequence similarity, strain C159 belongs to the genus Pseudoneobacillus, but its taxonomic status remains uncertain.

[0038] Example 3: Full gene sequence analysis of strain C159

[0039] Strain C159 was sent to Shanghai Meiji Biopharmaceutical Technology Co., Ltd. for genome sequencing using the Illumina Novaseq platform. SPAdes v3.15.3 software was used to assemble the bacterial genome sequence and remove low-quality contig sequences less than 500bp in length. CheckM v1.1.3 software was used to perform quality analysis on the integrity and contamination of the bacterial genome. If the genome integrity is not less than 95% and the contamination is not more than 5%, the genome is considered to be of high quality. The analysis results showed that the genome integrity of strain C159 was 97.44% and the contamination was 0.87%, so the genome is a high-quality genome. The bacterial genome was analyzed using QUAST v5.0.2. The results showed that the total genome length of strain C159 was 4.65Mbp, the length of N50 was 160740bp, and the G+C content of genomic DNA was 38.65%.

[0040] The genome of the model species of the genus Pseudoneobacillus was downloaded from NCBI (https: / / www.ncbi.nlm.nih.gov / datasets / genome / ?taxon=2946549). Since only one species of the genus Pseudoneobacillus has been reported, to ensure the reliability of the results, other model species were downloaded from the closest relative Neobacillus (https: / / www.ncbi.nlm.nih.gov / datasets / genome / ?taxon=2675232) to construct the genome phylogenetic tree. In addition, to further clarify the relationship between strain C159 and Pseudoneobacillus rhizosphaerae JJ-79, the genome of the model species Pseudoneobacillus rhizosphaerae JJ-79 was constructed. T The differences between strain C159 and the model strain Pseudoneobacillus rhizosphaerae JJ-79 were calculated using ANI Calculator (http: / / www.ezbiocloud.net / tools / ani) and Genome-to-Genome Distance Calculator v3.0 (https: / / ggdc.dsmz.de / ggdc.php#), respectively. T The average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) values ​​between genome sequences showed that strain C159 had a similar genome sequence to the model strain Pseudoneobacillus rhizosphaerae JJ-79. T The ANI value between the two bacterial genomes was 75.31%, and the dDDH value was 19.60%. When the ANI value of two bacterial genomes is less than 95%, they are different species. A whole-genome DNA-DNA hybridization value of 70% is the gold standard for prokaryotic species classification. In addition, strain C159 was constructed using UBCG v3.0 and Pseudoneobacillus rhizosphaerae JJ-79 T The results showed that strain C159 and the model strain Pseudoneobacillus rhizosphaerae JJ-79 T Formed an independent phylogenetic branch with a bootstrap value of 100 ( Figure 2), indicating that strain C159 has an independent taxonomic status. Based on these multiple results, strain C159 is a potential new species of the genus Pseudoneobacillus and is named Pseudoneobacillus sp. C159. This strain is deposited with the Guangdong Provincial Microbiological Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province, Postal Code: 510070, with GDMCC No: 65250 and a deposit date of October 14, 2024.

[0041] Example 4: Identification of IAA Production Ability of Bacillus pseudoneocolonus C159

[0042] The activated single colony of Bacillus pseudoneoplasticus C159 was inoculated into a solution containing 200 mg·L -1 The cells were cultured in R2A liquid medium containing L-tryptophan at 30°C and 200 rpm for 2 days with 3 biological replicates. 1 mL of bacterial culture was aspirated and the supernatant was collected by centrifugation at 12,000 rpm for 5 minutes. IAA production was determined using the Salkowski colorimetric method. 100 μL of supernatant was mixed with an equal volume of Salkowski colorimetric solution (50 mL 35% HClO4 + 1 mL 0.5 mol·L -1 FeCl3) was mixed. After standing for 0.5 h in the dark, the absorbance at 530 nm was measured using an enzyme marker. Sterile R2A liquid culture medium was used as a control. The prepared 200 mg·L -1 The IAA standard solution was diluted in a gradient manner and the OD at the corresponding concentration was measured. 530 The absorbance value was used to draw a standard curve and calculate the IAA production capacity of Bacillus pseudoneoplasticus C159.

[0043] The results showed that the IAA production capacity of Bacillus pseudoneocolitis C159 was 33.72 mg·L -1 .

[0044] Example 5: Identification of the ability of Bacillus pseudoneobiosinus C159 to mineralize insoluble organophosphorus

[0045] A single colony of activated Bacillus pseudoneosubtilis C159 was inoculated into TSB liquid culture medium and cultured at 30°C and 200 rpm for 2 days. 10 μL of the bacterial liquid was added to the insoluble organophosphorus culture medium, and the plate was inverted and cultured at 30°C for 5 days. The phosphate solubility zone on the plate was observed to determine whether the strain C159 had the ability to solubilize phosphate.

[0046] Insoluble organophosphorus culture medium: glucose 10 g·L -1 , ammonium sulfate 0.5 g·L -1 , yeast extract powder 0.5g·L-1 , sodium chloride 0.3g·L -1 , potassium chloride 0.3g·L -1 , magnesium sulfate 0.3g·L -1 , ferrous sulfate 0.03g·L -1 , manganese sulfate 0.03g·L -1 , lecithin 0.2g·L -1 , calcium carbonate 1.0g·L -1 , agar 15 g·L -1 The culture medium was purchased from Qingdao Hi-Tech Industrial Park Haibo Biotechnology Co., Ltd., product number HB8673-1.

[0047] The results showed that Bacillus pseudoneocolon C159 could mineralize insoluble organic phosphorus ( Figure 3 ).

[0048] Example 6: Evaluation of the ability of Bacillus pseudoneoplasticus C159 to resist tomato bacterial wilt and promote growth

[0049] The soil from which Pseudoneobacillus C159 was isolated was used as the test soil. The soil was air-dried, passed through a 2 mm sieve, and then sterilized with high-temperature and high-pressure steam (121°C for 1 h). This potted experiment was conducted with four treatments: CK (control, inoculated with water only), P (inoculated with the pathogen Ralstonia solanacearum QL-Rs1115 only), C159 (inoculated with Pseudoneobacillus C159 only), and C159-P (inoculated with the pathogen first, followed by Pseudoneobacillus C159). Six biological replicates were set up for each treatment.

[0050] After the Xinzhongshu No. 4 tomato seeds were germinated, the germinated seeds were selected and sown in pots. After 14 days of growth, tomato seedlings with uniform growth were selected and 5 mL of the bacterial suspension of Bacillus pseudoneoplasticus C159 (resuspended in sterile water, OD 600 =1.0), 5 mL of sterile water was inoculated into the CK and P groups. After 7 days, 5 mL of Ralstonia solanacearum QL-Rs1115 bacterial suspension (OD 600 =1.0), and 5 mL of sterile water was inoculated into both the CK and C159 groups. Ten days later, the bacterial wilt disease severity of the tomatoes was calculated. The bacterial wilt disease severity scale is 0 to 5, representing no symptoms (0), 20% (1), 40% (2), 60% (3), 80% (4), and 100% (5) of the leaves showing symptoms. The aboveground parts and roots of the tomatoes were then dried separately, and their biomass was measured.

[0051] The results showed that the tomato seedlings in the CK and C159 groups did not show symptoms of bacterial wilt, while the tomato seedlings in the P and C159-P groups showed typical symptoms of bacterial wilt ( Figure 4 Compared with the P group, the incidence of bacterial wilt in the C159-P group was significantly reduced (P<0.001, n=6), and the disease resistance efficiency of the inoculated Bacillus pseudoneoplasticus C159 was as high as 89.29% ( Figure 5 Compared with the CK group, the aboveground biomass, root biomass (P<0.01, n=6) and plant biomass (P<0.01, n=6) of the C159 group were significantly increased, and the growth promotion efficiency of inoculation with Bacillus pseudoneoplasticus C159 was as high as 10.45%, 51.64% and 22.68%, respectively ( Figure 5 Compared with the P group, the aboveground biomass (P<0.05, n=6), root biomass (P<0.05, n=6) and plant biomass (P<0.05, n=6) of the C159-P group were significantly increased. The growth promotion efficiency of inoculation with Pseudomonas aeruginosa C159 on tomato infected by pathogens was as high as 42.04%, 50.79% and 44.49%, respectively. Figure 5 ). Combining these results, it can be seen that (1) compared with the aboveground part of tomatoes, Bacillus pseudoneoplasticus C159 has a greater growth-promoting effect on tomato roots; (2) when pathogens are present, Bacillus pseudoneoplasticus C159 has a greater promoting effect on the aboveground biomass and plant biomass of tomatoes. In summary, Bacillus pseudoneoplasticus C159 is a multifunctional bacterium that is highly resistant to tomato bacterial wilt and can effectively promote the growth of tomato plants (especially tomato roots).

[0052] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be construed as limiting the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. Persons skilled in the art will appreciate that improvements and modifications may be made without departing from the spirit and scope of the present invention, and such improvements and modifications should also be considered within the scope of protection of the present invention.

[0053] Full-length sequence of the 16S rRNA gene of Bacillus pseudoneoplasticus C159 (SEQ ID NO.1)

[0054] TTATTGGAGAGTTTGATCCTGGCTCAGGACGAACGCTGGCGGCGTGCCTAATACATGC

[0055] AAGTCGAGCGAATCACTGGGTGCTTGCACCCTTTGGTTAGCGGCGGACGGGTGAGTAA

[0056] CACGTGGGCAACCTGCCTATAAGACTGGGATAACTTCGGGAAACCGGAGCTAATACCG

[0057] GATAATCCTTTTCCACTCATGTGGAGAAGTTGAAAGACGGTTTCGGCTGTCACTTATAG

[0058] ATGGGCCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCGACGATGC

[0059] GTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCT

[0060] ACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGC

[0061] CGCGTGAGCGATGAAGGCCTTCGGGTCGTAAAGCTCTGTTGTTAGGGAAGAACAAGTA

[0062] CCGGAGTAACTGCCGGTACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGT

[0063] GCCAGCAGCCGCGGTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAA

[0064] GCGCGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGG

[0065] TCATTGGAAACTGGGGAACTTGAGTACTGAAGAGGAAAGCGGAATTCCACGTGTAGCG

[0066] GTGAAATGCGTAGAGATGTGGAGGAACACCAGTGGCGAAGGCGGCTTTCTGGTCAGTA

[0067] ACTGACGCTGAGGCGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTC

[0068] CACGCCGTAAACGATGAGTGCTAAGTGTTAGAGGGTTTCCGCCCTTTAGTGCTGCAGC

[0069] AAACGCATTAAGCACTCCGCCTGGGGAGTACGGTCGCAAGACTGAAACTCAAAGGAAT

[0070] TGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGA

[0071] ACCTTACCAGGTCTTGACATCCTTTGACCACCCTAGAGATAGGGCTTTCCCCTTCGGGG

[0072] GACAAAGTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTGGGTTA

[0073] AGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCAGCATTCAGTTGGGCACTCTAA

[0074] GGTGACTGCCGGTGACAAACCGGAGGAAGGTGGGGATGACGTCAAATCATCATGCCCC

[0075] TTATGACCTGGGCTACACACGTGCTACAATGGATGGTACAAAGGGCTGCAAAACCGCG

[0076] AGGTTGAGCCAATCCCATAAAACCATTCTCAGTTCGGATTGCAGGCTGCAACTCGCCTG

[0077] CATGAAGCCGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCCG

[0078] GGCCTTGTACACACCGCCCGTCACACCACGAGAGTTTGTAACACCCGAAGTCGGTGGG

[0079] GTAACCGTAAGGAGCCAGCCGCCTAAGGTGGGACAGATGATTGGGGTGAAGTCGTAA

[0080] CAAGGTAGCCGTATCGGAAGGTGCGGCTGGATCACCTCCTTT。

Claims

1. Pseudomonas aeruginosa ( Pseudoneobacillus sp.) C159, deposited with GDMCC No: 65250.

2. A microbial fertilizer, characterized in that: Contains the pseudoneobacillus C159 or the fermentation broth of pseudoneobacillus C159 according to claim 1 as an active ingredient.

3. Use of the pseudoneobacillus C159 according to claim 1 or the microbial fertilizer according to claim 2 in producing IAA.

4. Use of the pseudoneobacillus C159 according to claim 1 or the microbial fertilizer according to claim 2 in the mineralization of insoluble organic phosphorus.

5. Use of the pseudoneobacillus C159 or the fermentation broth of pseudoneobacillus C159 according to claim 1 or the microbial fertilizer according to claim 2 in biological control of tomato bacterial wilt.

6. Use of the pseudoneobacillus C159 or the fermentation liquid of pseudoneobacillus C159 according to claim 1 or the microbial fertilizer according to claim 2 in the growth of tomato crops.

Images