Bacillus velezensis SFT4 with bacteriostatic function and its application

Abstract

The present invention provides a Bacillus velezensis SFT4 with antibacterial function and its application, belonging to the technical field of microbial application. Bacillus velezensis SFT4 has good inhibitory effects on Irpex lacteus, Aspergillus pallidus, Clostridium perfringens, Staphylococcus aureus, Micrococcus luteus, etc., and has a certain inhibitory effect on Salmonella. A probiotic preparation containing Bacillus velezensis SFT4 and its metabolites is provided, and a method for using the probiotic preparation is provided. The probiotic preparation is composed of Bacillus velezensis SFT4, Lactobacillus reuteri, Lactobacillus casei, and Lactobacillus plantarum. The application of the probiotic preparation in the livestock and poultry breeding industry can effectively prevent and control Clostridium perfringens and Escherichia coli, and the probiotic preparation can be made into a feed additive or directly fed through a drinking water line, and it is not easy to block the drinking and feeding pipeline.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial applications, and specifically refers to a Bacillus velezensis SFT4 with antibacterial function and its application. Background Art

[0002] Clostridium perfringens ( Clostridium perfringens , CP) is also known as Clostridium welchii ( Clostridium welchii ), belonging to the family Bacillaceae and the genus Clostridium. It is a conditional pathogenic bacterium widely distributed in natural environments such as water sources and soil, as well as in the intestinal tracts of animals. Clostridium perfringens has strong environmental tolerance and can cause diseases with different clinical symptoms in humans and various livestock by producing bioactive proteins or toxins. Escherichia coli belongs to the genus Escherichia of the family Enterobacteriaceae. Escherichia coli is a Gram-negative, facultatively anaerobic, rod-shaped bacterium with blunt ends at both ends, capable of movement, and without spores. Escherichia coli mainly parasitizes in the large intestines of humans and animals, accounting for about 1% of the intestinal bacteria. Escherichia coli is a conditional pathogen and can cause gastrointestinal infections or infections of various local tissues and organs such as the urinary tract in humans and various animals under certain conditions.

[0003] For the prevention and control of Clostridium perfringens and Escherichia coli, in addition to using chemical methods to disinfect the environment and antibiotics for prevention and control, the use of probiotics is a green and effective method. Generally, in large-scale farms, probiotics are activated by adding nutrient solution and then fed to animals through the drinking water line. In the actual application of feeding probiotics to Hy-Line Brown laying hens through the drinking water line by Taojiang County Jinyuan Animal Husbandry Co., Ltd., a subsidiary of our company, it was found that probiotics are easily contaminated by fungi in the environment during the activation process. Lactic acid bacteria can inhibit the contamination of many bacteria by producing acid, but many fungi in the environment are acid-tolerant. The proliferation of fungi in the probiotic propagation solution not only brings potential and unforeseeable hazards to animals, but the more direct drawback is that the continuous proliferation of fungal mycelia easily clogs the drinking water pipeline, bringing great inconvenience to the application of probiotics. Summary of the Invention

[0004] In order to solve the above technical problems, the present invention provides a Bacillus velezensis SFT4 with antibacterial function and its application. By isolating fungi in the probiotic agent activated in the farm, analyzing the easily infected fungi, screening probiotics with antibacterial effects on fungi, using them as strains to prevent and control the contamination of probiotics, and based on the screened probiotics, screening probiotics with antibacterial functions against Clostridium perfringens and Escherichia coli to protect the intestinal health of animals as compound bacteria.

[0005] To achieve the above object, this solution first provides a Bacillus velezensis SFT4 with antibacterial function. The Bacillus velezensis is a new strain SFT4 of the genus Bacillus, which was deposited in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on August 22, 2024, with the deposit number CGMCC No. 31720.

[0006] Preferably, the 16S rDNA sequence of the Bacillus velezensis SFT4 is as shown in SEQ ID NO.1

[0007] Based on a general inventive concept, this solution also provides an application of Bacillus velezensis SFT4 in inhibiting Irpex lacteus, Aspergillus pallidus, Clostridium perfringens, Staphylococcus aureus, Micrococcus luteus, and Salmonella.

[0008] Based on a general inventive concept, this solution also provides a probiotic preparation containing Bacillus velezensis SFT4. The probiotic preparation includes Bacillus velezensis SFT4, Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei.

[0009] Preferably, the preparation method of the probiotic preparation includes the following steps:

[0010] S1. Preparation of slant seeds: Activate Bacillus velezensis SFT4 on the slant of a nutrient agar medium test tube, and activate Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei on the slant of an MRS agar test tube respectively;

[0011] S2. Preparation of seed liquid: Pick 2-3 loops of the activated Bacillus velezensis SFT4 in step S1 and inoculate them into a seed liquid medium to culture and obtain a Bacillus velezensis SFT4 seed liquid; Pick 2-3 loops of the activated Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei in step S1 respectively, and inoculate them into an MRS broth medium respectively, and ferment them airtight at 37°C for 16 h to obtain lactic acid bacteria seed liquid;

[0012] S3. Probiotic preparation propagation: Inoculate the Bacillus velezensis SFT4 seed liquid prepared in S2 into a Bacillus velezensis propagation medium at an inoculation amount of 1%-5% by volume and ferment it airtight for 24 h, then inoculate the Lactobacillus reuteri, Lactobacillus casei, and Lactobacillus plantarum seed liquids prepared in S2. The total inoculation amount of the lactic acid bacteria seed liquid is 1.5%-5% by volume. While inoculating, add 1%-5% brown sugar and ferment it airtight for 24 h to obtain the probiotic preparation. The volume ratio of the three lactic acid bacteria seed liquids in the total inoculation amount of the lactic acid bacteria seed liquid is 1:1:1.

[0013] Preferably, the culture conditions of the Bacillus velezensis seed liquid in step S2 are: culture temperature 37°C, rotation speed 200 r / min, ventilation volume 15 L / min, and culture time 16 - 20 h.

[0014] Preferably, the seed liquid culture medium in step S2 is LB or NB or YPD culture medium.

[0015] Preferably, the Bacillus velezensis propagation culture medium in step S3 includes 1 - 5% brown sugar, 0.5% - 2% ammonium sulfate, 1% sodium chloride, and the fermentation temperature is 30 - 37°C.

[0016] Based on a general inventive concept, this solution also provides an application of a probiotic preparation in the preparation of an antibacterial preparation in aquaculture. It is characterized in that the strains include Irpex lacteus, Aspergillus pallidus, Clostridium perfringens, Staphylococcus aureus, Micrococcus luteus, Salmonella, and Escherichia coli.

[0017] Preferably, the probiotic preparation can be made into a feed additive for use or directly fed through a drinking water line.

[0018] The antibacterial mechanism of the antibacterial preparation in this solution is as follows:

[0019] In this solution, the fungi in the probiotic bacteria agent activated in the farm are isolated, the susceptible fungi are analyzed, and the probiotics with antibacterial effects on fungi are screened as the strains for preventing and controlling the contamination of the probiotic bacteria agent. Based on the screened probiotics, the probiotics with antibacterial functions against Clostridium perfringens and Escherichia coli are screened as the compound bacteria to protect the intestinal health of animals.

[0020] Bacillus velezensis can effectively prevent and control Clostridium perfringens, Irpex lacteus, and Aspergillus pallidus. Lactobacillus plantarum ACCC 10171, Lactobacillus reuteri ACCC 03959, and Lactobacillus casei ACCC 03965 (all preserved in the China Center for Type Culture Collection of Agricultural Microorganisms) can effectively prevent and control Escherichia coli. After the compound probiotic preparation is activated by the process of the present invention, the shelf life of the probiotic preparation propagation liquid is longer, it is not easily contaminated with bacteria, and at the same time, it has good functions of preventing and controlling Escherichia coli and Clostridium perfringens.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] In this solution, Bacillus velezensis SFT4 was screened from the manure of laying hens. Bacillus velezensis SFT4 was sent to the China General Microbiological Culture Collection Center on August 22, 2024, with the preservation number CGMCC No. 31720. This Bacillus velezensis SFT4 has multiple functional characteristics: (1) It has inhibitory activity against fungi such as Irpex lacteus and Aspergillus pallidus; (2) It has inhibitory activity against bacteria such as Clostridium perfringens, Micrococcus luteus, Staphylococcus aureus, and Salmonella. These functional characteristics enable Bacillus velezensis SFT4 to have diverse application forms, such as preventing and treating livestock and poultry diseases, preparing drugs for preventing and treating fungal or bacterial diseases, and microecological preparation liquids, etc., with broad application prospects.

[0023] (2) Bacillus velezensis SFT4 can effectively prevent and treat Irpex lacteus, Aspergillus pallidus, Clostridium perfringens, Staphylococcus aureus, Micrococcus luteus, and Salmonella, and Lactobacillus reuteri, Lactobacillus casei, and Lactobacillus plantarum can effectively prevent and treat Escherichia coli. Compared with single strains, the composite microecological preparation can produce more broad-spectrum antibacterial substances such as antibacterial peptides, reuterin, lactic acid, and plantaricin after activation, and the four strains are not antagonistic to each other, with a more broad-spectrum antibacterial effect. After the composite microecological preparation is activated by the process of the present invention, the microecological preparation propagation liquid has a longer shelf life, is not easily contaminated with bacteria, and has good functions of preventing and treating Escherichia coli and Clostridium perfringens.

[0024] (3) The Bacillus velezensis in this solution can be applied to the application of Bacillus velezensis fermentation broth, bacterial agents, and derivative products in the livestock and poultry breeding industry. Brief Description of the Drawings

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0026] Figure 1 It is the colony morphology of Bacillus velezensis in Example 1;

[0027] Figure 2 It is the PCR electrophoresis pattern of Bacillus velezensis in Example 1;

[0028] Figure 3 It is the phylogenetic tree of Bacillus velezensis in Example 1;

[0029] Figure 4 It is the colony morphology diagram of two strains of fungi in Example 2, a is Aspergillus pallidus, and b is Irpex lacteus;

[0030] Figure 5 PCR electrophoresis patterns of two strains of fungi in Example 2;

[0031] Figure 6 Phylogenetic tree of Aspergillus pallidus in Example 2;

[0032] Figure 7 Phylogenetic tree of Irpex lacteus in Example 2;

[0033] Figure 8 Inhibitory effect of Bacillus velezensis on Clostridium perfringens after enzyme treatment in Example 2. a: Inhibition of Clostridium perfringens by 75 ppm chlortetracycline hydrochloride; b: Inhibition of Clostridium perfringens by Bacillus velezensis without enzyme treatment; c: Inhibition of Clostridium perfringens by Bacillus velezensis treated with proteinase K; d: Inhibition of Clostridium perfringens by Bacillus velezensis treated with pepsin;

[0034] Figure 9 Inhibitory effect of Bacillus velezensis on Clostridium perfringens after different pH treatments in Example 2. a: Inhibition of Clostridium perfringens by 75 ppm chlortetracycline hydrochloride; b: Inhibition of Clostridium perfringens by Bacillus velezensis treated at pH 3.0; c: Inhibition of Clostridium perfringens by Bacillus velezensis treated at pH 5.0; d: Inhibition of Clostridium perfringens by Bacillus velezensis treated at pH 7.0; e: Inhibition of Clostridium perfringens by 75 ppm chlortetracycline hydrochloride; f: Inhibition of Clostridium perfringens by Bacillus velezensis treated at pH 9.0;

[0035] Figure 10 Inhibitory effect of Bacillus velezensis on Aspergillus pallidus and Irpex lacteus in Example 2. a: Inhibition of Aspergillus pallidus by Bacillus velezensis; b: Inhibition of Irpex lacteus by Bacillus velezensis;

[0036] Figure 11 Inhibitory effect of Bacillus velezensis on Staphylococcus aureus in Example 3;

[0037] Figure 12 Inhibitory effect of Bacillus velezensis on Micrococcus luteus in Example 3;

[0038] Figure 13 Inhibitory effect of Bacillus velezensis on Salmonella in Example 3;

[0039] Figure 14 Status of the microecological propagation liquid in Example 5. a: Microecological preparation propagation liquid containing Bacillus velezensis; b: Microecological preparation propagation liquid without Bacillus velezensis;

[0040] Figure 15For the comparison of the antibacterial effects of the propagation liquid T1 of Bacillus velezensis SFT4, the propagation liquid T2 of Lactobacillus, and the propagation liquid T3 of the probiotic preparation in Example 5, a is the antibacterial effect of each group against Escherichia coli, and b is the antibacterial effect of each group against Clostridium perfringens. Detailed implementation mode

[0041] To make the technical problems, technical solutions, and advantages to be solved by the present invention clearer, the following will be described in detail with reference to the accompanying drawings and specific embodiments.

[0042] The following examples are used to illustrate the present invention, but are not used to limit the scope of the present invention. Without departing from the spirit and essence of the present invention, any modification or replacement made to the methods, steps, or conditions of the present invention belongs to the scope of the present invention.

[0043] Unless otherwise specified, the technical means used in the examples are conventional means well-known to those skilled in the art; unless otherwise specified, the reagents used in the examples are all commercially available.

[0044] Example 1.

[0045] Screening of Bacillus velezensis SFT4.

[0046] Healthy laying hen manure was taken from the chicken house of Taojiang County Jinyuan Animal Husbandry Co., Ltd., and Bacillus in the manure was isolated by the coating method. The medium was LB solid medium. Using Clostridium perfringens, Escherichia coli, Salmonella, and Staphylococcus aureus as indicator bacteria, the isolated strains were screened by the plate confrontation method to obtain strains with antagonistic effects against the indicator bacteria. The screened strains were cultured in LB liquid medium and then added with sterile glycerol (final glycerol concentration 20%), and were sub-packed in sterile freeze-drying tubes and stored in the company's strain preservation library at -80 °C for later use.

[0047] A candidate strain SFT4 was initially screened (see the colony morphology diagram in Figure 1 ). The purified SFT4 strain was picked and PCR was performed using primers 27F and 1492R;

[0048] 27F: AGAGTTTGATCCTGGCTCAG; (SEQ ID NO.2)

[0049] 1492R: GGT TACCTTGTTACGACTT) (SEQ ID NO.3);

[0050] The PCR stock solution (see the PCR result in Figure 2 ) was sent to Beijing Tsingke Biotechnology Co., Ltd., Changsha Branch for sequencing, and the sequencing sequence was used to construct a phylogenetic tree with MEG7.0 (see Figure 3), and its 16S rDNA sequence is shown in SEQ ID NO: 1. Combined with physiological and biochemical reactions, SFT4 has been confirmed to be Bacillus velezensis of the same species but different strains ( Bacillus velezensis ).

[0051] Finally, the SFT4 strain was sent to the General Microbiology Center of the China Committee for Culture Collection of Microorganisms on August 22, 2024. The address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. After identification, the preservation name of this strain is Bacillus velezensis SFT4, and its taxonomic name is Bacillus velezensis , the preservation date is August 22, 2024, the preservation number is CGMCC No. 31720, and the preservation center completed the detection on August 22, 2024, and confirmed that the preserved microorganism survived.

[0052] Example 2.

[0053] Investigate the inhibition of Bacillus velezensis SFT4 against Irpex lacteus, Aspergillus pallidus and Clostridium perfringens.

[0054] First, fungi were isolated from the activated and propagated microecological preparation liquid in a chicken farm. After multiple samplings and purification, it was found that there were two main fungi in the microecological preparation of the chicken farm (see the colony morphology diagram in Figure 4 ). After purifying and culturing the fungi with PDA medium, the mycelia were picked and ultrasonically broken with a cell ultrasonic crusher, and PCR was performed using primers NL1 and NL4 (see the PCR results in Figure 5 ).

[0055] NL1: GCATATCAATAAGCGGAGGAAAAG; (SEQ ID NO.4)

[0056] NL4: GGTCCG TGTTTCAAGACGG; (SEQ ID NO.5)

[0057] The PCR stock solution was sent to the Changsha Branch of Beijing Tsingke Biotechnology Co., Ltd. for sequencing, and the sequencing sequences were used to construct a phylogenetic tree with MEG7.0 ( Figure 6 、 Figure 7 ). The two strains of fungi were preliminarily identified as: Irpex lacteus ( Irpex lacteus ), Aspergillus pallidus ( Aspergillus pallidus ). The 16S rDNA sequence of the Aspergillus pallidus strain is shown in SEQ ID NO.6, and the 16S rDNA sequence of the Irpex lacteus strain is shown in SEQ ID NO.7;

[0058] The fermentation broth of Bacillus velezensis SFT4 was centrifuged at 8000 r / min for 10 minutes, and the supernatant was treated with proteinase K and pepsin for 30 minutes respectively. Using 75 ppm chlortetracycline hydrochloride as a control, the effect of enzymes on the ability of SFT4 to inhibit Clostridium perfringens was investigated (the results are shown in Figure 8 ). a is the inhibition of Clostridium perfringens by 75 ppm chlortetracycline hydrochloride, and the inhibition zone diameter is 33.06 mm; b is the inhibition of Clostridium perfringens by Bacillus velezensis without enzyme treatment, and the inhibition zone diameter is 22.38 mm; c is the inhibition of Clostridium perfringens by Bacillus velezensis treated with proteinase K, and the inhibition zone diameter is 20.30 mm; d is the inhibition of Clostridium perfringens by Bacillus velezensis treated with pepsin, and the inhibition zone diameter is 22.37 mm. The results show that the metabolites of Bacillus velezensis can tolerate proteinase and will not be decomposed by pepsin in the animal gastrointestinal tract, and can still play a good role in inhibiting Clostridium perfringens in the animal intestine.

[0059] The pH values of the supernatant were adjusted to 3.0, 5.0, 7.0, and 9.0 respectively and treated for 30 minutes, and then the pH of the treated supernatant was readjusted to 7.0. Using 75 ppm chlortetracycline hydrochloride as a control, the Oxford cup method was used to determine the inhibitory effect of the treated supernatant on Clostridium perfringens, and the inhibition rate was calculated. The inhibition rate = the inhibition zone diameter of the experimental group / the inhibition zone diameter of chlortetracycline hydrochloride * 100% (the results are shown in Figure 9 ). a is the inhibition of Clostridium perfringens by 75 ppm chlortetracycline hydrochloride; b is the inhibition of Clostridium perfringens by Bacillus velezensis treated at pH 3.0, and the inhibition rate is 53.68%; c is the inhibition of Clostridium perfringens by Bacillus velezensis treated at pH 5.0, and the inhibition rate is 55.56%; d is the inhibition of Clostridium perfringens by Bacillus velezensis treated at pH 7.0, and the inhibition rate is 52.61%; e is the inhibition of Clostridium perfringens by 75 ppm chlortetracycline hydrochloride; f is the inhibition of Clostridium perfringens by Bacillus velezensis treated at pH 9.0, and the inhibition rate is 51.98%. The results show that Bacillus velezensis SFT4 in this scheme can maintain a high activity of inhibiting Clostridium perfringens at pH 3-9 and can still play an antibacterial function in the acidic environment of the animal gastrointestinal tract.

[0060] The Oxford cup method was used to determine the antibacterial effects of strain SFT4 against Irpex lacteus and Aspergillus pallidus. Irpex lacteus and Aspergillus pallidus were respectively inoculated into sterilized potato dextrose liquid medium (20 g of potatoes were chopped and boiled for 30 min, filtered through four layers of gauze, 20 g of dextrose, and the volume was made up to 1 L with water, pH natural) and cultured for 72 h for use. Sterilized PDA solid medium was poured into a 9-cm sterile petri dish with a small amount of medium (about 5 mL), evenly spread. After the medium cooled and solidified, a 10-mm-sized Oxford cup was placed in the middle of the petri dish, and an appropriate amount of PDA medium (about 20 mL) was poured. After the medium cooled, the Oxford cup was removed. 50 μL of the culture solutions of Irpex lacteus and Aspergillus pallidus were respectively taken and evenly spread on the PDA medium with a spreading rod. 150 μL of the supernatant of the SFT4 fermentation broth was added to the Oxford cup wells, and no fermentation broth supernatant was added in the blank control. The experimental results showed that strain SFT4 had good antibacterial effects against Irpex lacteus and Aspergillus pallidus (the inhibitory effects are shown in Figure 10 ) and Clostridium perfringens, indicating that Bacillus velezensis has an inhibitory effect on Irpex lacteus and Aspergillus pallidus, and the metabolites of Bacillus velezensis can tolerate the proteases and acidic environment in the gastrointestinal tract and can play a good role in the animal gastrointestinal tract after being ingested by animals.

[0061] Example 3.

[0062] The antibacterial effects of Bacillus velezensis SFT4 against Staphylococcus aureus, Micrococcus luteus, and Salmonella were investigated.

[0063] The obtained Bacillus velezensis SFT4 strain was cultured in LB liquid medium for 36 h, and after centrifugation, the supernatant was filtered through a 0.22-μm sterile microporous membrane. The filtrate was used to conduct antibacterial experiments on Staphylococcus aureus, Micrococcus luteus, Escherichia coli, Salmonella, and Klebsiella pneumoniae by the Oxford cup method. The experimental results showed that the diameter of the antibacterial zone of Bacillus velezensis SFT4 against Staphylococcus aureus was 15.64 mm (see Figure 11 ), the diameter of the antibacterial zone against Micrococcus luteus was 23.76 mm (see Figure 12 ), showing good inhibitory effects, the diameter of the antibacterial zone against Salmonella was 11.47 mm, showing a certain inhibitory effect (see Figure 13 ), and it had no inhibitory effect on Escherichia coli and Klebsiella pneumoniae.

[0064] Example 4.

[0065] Prepare a probiotic preparation containing Bacillus velezensis SFT4.

[0066] The plate confrontation method was used to screen strains with good inhibitory effects on Escherichia coli and Clostridium perfringens, and Lactobacillus plantarum ACCC 10171, Lactobacillus reuteri ACCC 03959, and Lactobacillus casei ACCC 03965 were obtained. These three strains had good inhibitory effects on Escherichia coli.

[0067] S1. Preparation of slant seeds

[0068] Bacillus velezensis SFT4 was activated on a slant of nutrient agar medium test tube, and Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei were respectively activated on a slant of MRS agar test tube.

[0069] S2. Preparation of seed liquid

[0070] Pick 2 - 3 loops of the activated Bacillus velezensis and inoculate them into LB liquid medium (1000 ml Erlenmeyer flask, liquid loading volume is 400 ml, autoclaved at 121 °C for 15 min), and ferment at 37 °C and 200 r / min for 16 h to obtain the seed liquid of Bacillus velezensis.

[0071] Pick 2 - 3 loops of the activated Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei respectively, and inoculate them into MRS broth medium (1000 ml Erlenmeyer flask, liquid loading volume is 800 ml, autoclaved at 110 °C for 15 min), and ferment anaerobically at 37 °C for 16 h to obtain the seed liquid of lactic acid bacteria.

[0072] S3. Propagation of microecological agents

[0073] Propagation culture of Bacillus velezensis: 3% brown sugar, 1.5% ammonium sulfate, 1% sodium chloride. Weigh 100 L of tap water, stir the above substances evenly, inoculate 2 L of the seed liquid of Bacillus velezensis, stir evenly, and place it in a 37 °C environment for anaerobic culture for 24 h.

[0074] Propagation of microecological agents: Add 2% brown sugar to the propagation liquid of Bacillus velezensis after 24 h of propagation culture, inoculate 1% of the seed liquid (1 L) of each lactic acid bacterium, stir evenly, and place it in a 37 °C environment for anaerobic culture for 24 h to obtain the microecological agent containing Bacillus velezensis.

[0075] Example 5.

[0076] Investigate the actual antibacterial effect of the microecological agent containing Bacillus velezensis SFT4.

[0077] (1) Place the propagated microecological agent at room temperature in the farm environment, and use the propagation liquid of the microecological agent without Bacillus velezensis as a control to observe whether mold grows on the surface of the propagation liquid.

[0078] The results are as Figure 14It shows that the microbial agent propagation liquid without Bacillus velezensis starts to grow mold from the 2nd day, while the microbial agent propagation liquid containing Bacillus velezensis can remain mold-free for at least 12 days.

[0079] (2)Using Clostridium perfringens and Escherichia coli as indicator bacteria, and the propagated SFT4 Bacillus and propagated lactic acid bacteria as controls, compare the antibacterial effects of the propagated microbial agent and the controls. Centrifuge the propagated Bacillus (Propagation culture of Bacillus velezensis SFT4: 3% brown sugar, 1.5% ammonium sulfate, 1% sodium chloride. Weigh 100 L of tap water, stir the above substances evenly, inoculate 2 L of Bacillus velezensis seed liquid, stir evenly, and place it in a sealed environment at 37 °C for 24 h), propagated lactic acid bacteria (Prepare seed liquid from activated Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei. Add 2% brown sugar to 100 L of tap water and stir evenly. Inoculate 1% of each lactic acid bacteria seed liquid, stir evenly, and place it in a sealed environment at 37 °C for 24 h.), and the propagated microbial agent, and then filter them through a 0.22 μm sterile filter membrane for use. Pour 5 mL of sterile agar into each 9 cm sterile petri dish, spread it flat, and after cooling, place 3 10 mm Oxford cups in each petri dish. Cool the sterile TSC medium to 50 °C, add 2‰ of Clostridium perfringens, mix well, and pour 20 mL of this medium into each petri dish; cool the sterile LB solid medium to 50 °C, add 2‰ of Escherichia coli respectively, mix well, and pour 20 mL of this medium into each petri dish. After the medium cools, remove the Oxford cups. Add 150 μL of the centrifuged and filtered propagated liquid to each petri dish, culture it overnight in a 37 °C incubator, measure the antibacterial diameter, and compare their antibacterial effects.

[0080] The results are as Figure 15 shown. Comparison of the antibacterial effects of the propagated liquid T1 of Bacillus velezensis SFT4, the propagated liquid T2 of lactic acid bacteria, and the propagated liquid T3 of the microbial agent. a is the antibacterial effect of each group against Escherichia coli, and b is the antibacterial effect of each group against Clostridium perfringens; the propagated Bacillus velezensis SFT4 has no inhibitory effect on Escherichia coli, and the antibacterial circle diameter against Clostridium perfringens is 19.61 mm; the antibacterial circle diameter of the propagated lactic acid bacteria against Escherichia coli is 19.81 mm, and the antibacterial circle diameter against Clostridium perfringens is 20.33 mm; the antibacterial circle diameter of the propagated microbial agent against Escherichia coli is 20.05 mm, and the antibacterial circle diameter against Clostridium perfringens is 21.24 mm. The results show that the antibacterial effect of the composite microbial agent is better than that of the separately propagated Bacillus SFT4 and lactic acid bacteria.

[0081] The above is only the preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments. For those skilled in the art, the improvements and transformations obtained without departing from the technical concept of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. A bacteriostatic Bacillus velezinii ( Bacillus velezensis ) SFT4, characterized in that, It was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on August 22, 2024, with the deposit number CGMCCNo.31720.

2. The Bacillus Velezii SFT4 according to claim 1, characterized in that The 16SrDNA sequence of the Bacillus Velezii SFT4 is shown in SEQ ID NO.

1.

3. Use of the Bacillus Velezii SFT4 as claimed in any one of claims 1 to 2 for the purpose of inhibiting Albugo spp., Aspergillus pallidum, Clostridium perfringens, Staphylococcus aureus, Micrococcus luteus or Salmonella for non-disease treatment purposes.

4. A microecological preparation containing the Bacillus Velezii SFT4 according to any one of claims 1 to 2, characterized in that: The microecological preparation comprises Bacillus Velez SFT4, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus casei.

5. The microecological preparation according to claim 4, characterized in that: The preparation method of the microecological preparation comprises the following steps: S1. Preparation of slant seeds: Activate Bacillus Velezii SFT4 on the slant of a nutrient agar test tube, and activate Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei on the slant of an MRS agar test tube, respectively; S2, preparation of seed liquid: 2-3 loops of the Velez SFT4 activated in step S1 are inoculated into a seed liquid culture medium to obtain Velez SFT4 seed liquid; 2-3 loops of the Lactobacillus plantarum, Lactobacillus reuteri, and Lactobacillus casei activated in step S1 are inoculated into MRS broth culture medium respectively, and the mixture is sealed and fermented at 37° C. for 16 hours to obtain lactic acid bacteria seed liquid; S3. Propagation of microecological preparations: The seed solution of Bacillus Velez subtilis SFT4 prepared in S2 is inoculated into the Bacillus Velez subtilis propagation medium at an inoculation rate of 1%-5% by volume, and then the seed solution of Lactobacillus reuteri, Lactobacillus casei, and Lactobacillus plantarum prepared in S2 is inoculated. The total inoculation amount of the lactic acid bacteria seed solution is 1.5%-5% by volume. 1%-5% brown sugar is added at the same time of inoculation. The microecological preparation is obtained after 24 hours of closed fermentation. The volume ratio of the three lactic acid bacteria seed solutions in the total inoculation amount of the lactic acid bacteria seed solution is 1:1:

1.

6. The microecological preparation according to claim 5, characterized in that: The culture conditions of the Bacillus Velez seed solution in step S2 are: culture temperature 37° C., rotation speed 200 r / min, ventilation volume 15 L / min, and culture time 16-20 h.

7. The microecological preparation according to claim 5, characterized in that: The seed liquid culture medium in step S2 is LB, NB or YPD culture medium.

8. The microecological preparation according to claim 5, characterized in that: In step S3, the Bacillus Velez subtilis propagation medium includes 1-5% brown sugar, 0.5%-2% ammonium sulfate and 1% sodium chloride, and the fermentation temperature is 30-37°C.

9. An application of the probiotic preparation according to any one of claims 4 to 8 in the preparation of an antibacterial preparation in aquaculture, characterized in that: The antibacterial bacteria include white capsule rake tooth fungus, pale aspergillus, gas capsule clostridium, staphylococcus aureus, luteus micrococcus, salmonella and escherichia coli.

10. The use according to claim 9, characterized in that: The microecological preparation can be made into a feed additive or fed directly through a drinking water line.

Images