A circular RNA for regulating Huaxi cattle breeding and its application

Abstract

The present invention provides a circular RNA for regulating breeding of Huaxi cattle and its application, belonging to the field of breeding technology. The circular RNA is novel_circ_0001180, and its transcript sequence and connection gene sequence are shown as SEQ ID NO.1 and SEQ ID NO.2, respectively. The circular RNA promotes meat quality breeding by regulating the proliferation of skeletal muscle cells of Huaxi cattle. In addition, the present invention also provides the application of siRNA of novel_circ_0001180 in the preparation of a preparation for regulating skeletal muscle development of Huaxi cattle, and the siRNA sequence is as SEQ ID NO.15 and SEQ ID NO.16. The gene preparation is composed of siRNA of novel_circ_0001180 and nuclease-free water, which inhibits the proliferation of skeletal muscle cells of Huaxi cattle, thereby achieving the improvement of beef cattle varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of breeding, and in particular relates to a circular RNA used for regulating breeding of Huaxi cattle and an application thereof. Background Art

[0002] As a new breed of beef cattle independently bred in China, "Huaxi Cattle" has complete intellectual property rights and demonstrates strong core industry competitiveness and international market competitiveness. This breed has attracted widespread attention for its fast growth rate, high slaughter rate and net meat rate, excellent reproductive performance and good stress resistance, and its market share continues to increase. In beef cattle production, the growth and development rate is considered to be one of the most critical economic traits, which is directly related to the yield and quality of beef. Therefore, in-depth research on the development of skeletal muscle of Huaxi cattle and analysis of its molecular regulation mechanism will provide important theoretical support and technical guarantee for the improvement of beef cattle breeds, help cultivate new beef cattle breeds in China, and promote the high-quality development of animal husbandry.

[0003] As an important component of the body, skeletal muscle undertakes the important function of maintaining balance and basal metabolism. In recent years, non-coding RNAs (ncRNAs) have gradually been considered as important regulatory factors in skeletal muscle development and regeneration, including microRNAs (miRNAs), long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs). Studies have found that many circRNAs play an important role in the growth and development of skeletal muscle in different cattle breeds, and researchers have analyzed the molecular mechanisms of some circRNAs. However, it is worth noting that different cattle breeds show specificity in regulating circRNAs in muscle growth and development, showing differences between breeds.

[0004] Huaxi cattle is a new breed of beef cattle independently bred in my country, but research on its circRNA regulating muscle development is still insufficient. Therefore, conducting research in this field can not only fill the relevant academic gaps, but also provide new theoretical basis and technical means for the continuous improvement and breeding of Huaxi cattle. This will help improve the overall breeding level of beef cattle in China and promote the development of animal husbandry in a more efficient and sustainable direction. Summary of the invention

[0005] The purpose of the present invention is to provide a circular RNA for regulating Huaxi cattle breeding and its application, so as to accelerate the progress of Huaxi cattle breeding.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides a circular RNA for regulating breeding of Huaxi cattle, wherein the circular RNA is novel_circ_0001180, the transcript sequence of novel_circ_0001180 is shown in SEQ ID NO.1, and the connecting gene sequence of novel_circ_0001180 is shown in SEQ ID NO.2.

[0008] Preferably, the Huaxi cattle breeding regulation is to achieve the selection of Huaxi cattle beef quality by regulating the proliferation of Huaxi cattle skeletal muscle cells.

[0009] In a second aspect, the present invention provides an application of siRNA in preparing a preparation for regulating skeletal muscle development of Huaxi cattle, wherein the siRNA is the siRNA of novel_circ_0001180, the transcript sequence of novel_circ_0001180 is shown in SEQ ID NO.1, and the connecting gene sequence of novel_circ_0001180 is shown in SEQ ID NO.2.

[0010] Preferably, the sequence of the siRNA is as shown in SEQ ID NO.15 and SEQ ID NO.16, and the preparation inhibits the proliferation of Huaxi cattle skeletal muscle cells.

[0011] In a third aspect, the present invention provides a gene preparation for regulating skeletal muscle development of Huaxi cattle, the gene preparation consisting of siRNA of novel_circ_0001180 and nuclease-free water, the transcript sequence of novel_circ_0001180 is shown in SEQ ID NO.1, and the connected gene sequence of novel_circ_0001180 is shown in SEQ ID NO.2.

[0012] Preferably, in the gene preparation, the concentration of the siRNA is 50 μM, the sequence of the siRNA is as shown in SEQ ID NO.15 and SEQ ID NO.16, and the gene preparation inhibits the proliferation of skeletal muscle cells of Huaxi cattle.

[0013] In a fourth aspect, the present invention provides an application of siRNA in the preparation of a preparation for inhibiting the proliferation of skeletal muscle cells of Huaxi cattle, wherein the siRNA is the siRNA of novel_circ_0001180, the transcript sequence of novel_circ_0001180 is shown in SEQ ID NO.1, and the connecting gene sequence of novel_circ_0001180 is shown in SEQ ID NO.2.

[0014] Preferably, the sequence of the siRNA is shown as SEQ ID NO.15 and SEQ ID NO.16.

[0015] In a fifth aspect, the present invention provides an application of siRNA in preparing a preparation for regulating the cell cycle of Huaxi cattle skeletal muscle cells, wherein the siRNA is the siRNA of novel_circ_0001180, the transcript sequence of novel_circ_0001180 is shown in SEQ ID NO.1, and the connecting gene sequence of novel_circ_0001180 is shown in SEQ ID NO.2.

[0016] Preferably, the sequence of the siRNA is as shown in SEQ ID NO.15 and SEQ ID NO.16;

[0017] The preparation promotes the gene expression of cell cycle inhibitory genes CDKN1A and CDKN1B, and the preparation inhibits the gene expression of cell cycle promoting genes Cyclin D1, Cyclin B2 and PCNA.

[0018] The beneficial effects of the present invention are:

[0019] The present invention successfully identified the bovine circular RNA novel_circ_0001180 derived from the SLTM gene and conducted a functional investigation. The results showed that the bovine circular RNA novel_circ_0001180 can regulate the proliferation of bovine skeletal muscle cells. Interference with novel_circ_0001180 can significantly reduce the proliferation efficiency of bovine skeletal muscle primary cells. It can be used as an important candidate molecule for transgenic breeding of beef cattle, providing a theoretical basis for improving local cattle breeds in my country using molecular breeding technology, thereby accelerating the breeding process of high-yield West China cattle. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the identification result of novel_circ_0001180;

[0021] Among them, A is the verification result of novel_circ_0001180 amplified by convergent and divergent primers; B is the reverse splicing junction sequence of novel_circ_0001180 confirmed by Sanger sequencing; C is the expression level of novel_circ_0001180 and β-actin after RNase R treatment; D is the temporal expression map of novel_circ_0001180; in the figure, * indicates significant difference, ** indicates extremely significant difference;

[0022] Figure 2The expression of novel_circ_0001180 in the nucleus and cytoplasm of bovine skeletal muscle cells;

[0023] Among them, A is the detection result of fluorescence in situ hybridization, and B is the detection result of nuclear-cytoplasmic separation;

[0024] Figure 3 To interfere with the effect of novel_circ_0001180 on cell proliferation of bovine skeletal muscle cells;

[0025] Figure 4 The interference effect of siRNA of novel_circ_0001180 and the effect of interference of novel_circ_0001180 on the cell cycle of bovine skeletal muscle cells;

[0026] Among them, A is the interference effect of different siRNAs of novel_circ_0001180, B is the effect of interfering with novel_circ_0001180 on different cell cycle genes, and C is the flow cytometry detection result of the cell cycle after interfering with novel_circ_0001180; in the figure, * indicates significant difference, and ** indicates extremely significant difference. DETAILED DESCRIPTION

[0027] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0028] In the early stage, circRNA sequencing of the longissimus dorsi muscle tissue of Huaxi cattle at three developmental stages (newborn (NB), young (YG), and adult (AD)) was carried out, and novel_circ_0001180 was screened for differential expression during muscle development. Therefore, the biological identification method of novel_circ_0001180 and its proliferation effect in bovine skeletal muscle cells were studied to provide a theoretical basis for novel_circ_0001180 as a new target in beef cattle biological breeding.

[0029] The main sources of reagents involved in the present invention are as follows: DMEM low-glucose medium (Gibco, USA), fetal bovine serum (FBS) and horse serum (HS) (Gibco, USA), penicillin-streptomycin double antibody solution (Gibco, USA), PBS solution (Hyclone), trypsin (Gibco, USA), liposome 3000 reagent (Invitrogen, USA), trizol (invetrogen), PrimeScript™RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara, Dalian), qPCR quantitative kit (Takara, Dalian), blood genomic DNA extraction kit (Tiangen), FISH probe (Guangzhou Ruibo), Edu kit (Guangzhou Ruibo), nuclear cytoplasmic separation kit (Norgen), CCK8 proliferation kit (Biyuntian), cell cycle detection kit (Biyuntian), RNase R (lucigen).

[0030] Example 1

[0031] Obtaining cDNA of the longissimus dorsi muscle tissue of three developmental stages (newborn (NB), young (YG), and adult (AD)) of Huaxi cattle

[0032] A. Total RNA extraction and quality testing

[0033] (1) Grind the longissimus dorsi muscle tissue with liquid nitrogen, add an appropriate amount of TRIzol, and place at room temperature for 3 minutes to lyse the cells:

[0034] (2) Add 200 μL of chloroform per mL of TRIzol, shake vigorously for 20 seconds, and let stand at room temperature for 5 minutes;

[0035] (3) Centrifuge at 12000g for 10 min at 4°C:

[0036] (4) Pipette the supernatant into a new centrifuge tube, add 500 μL of isopropanol per mL of TRIzol, mix by inverting, and let stand at room temperature for 10 min.

[0037] (5) Centrifuge at 12,000 g for 10 min at 4 °C.

[0038] (6) Discard the supernatant. A small amount of white RNA precipitate can be seen at the bottom of the tube. Wash the precipitate with 75% ethanol, centrifuge at 7500 g for 5 min at 4°C, discard the supernatant, and repeat the wash process.

[0039] (7) Allow the precipitate to air dry for 5 min. When the white precipitate begins to turn translucent, add 30 μL of nuclease-free water, shake to mix, and store on ice for a short time.

[0040] (8) Use a spectrophotometer to measure the concentration and purity of RNA and store it at -80°C. After extraction, use NanoDrop2000 to detect the concentration and OD value of total RNA. The OD260 / 280 ratio of RNA should be between 1.8 and 2.0 to ensure that there is no protein or phenol contamination and no degradation for subsequent experiments.

[0041] B cDNA synthesis

[0042] Synthesize the first strand of cDNA using Takara's PrimeScript™ RT reagent Kit with gDNAEraser:

[0043] (1) To remove genomic DNA, the reaction system and conditions are as follows:

[0044]

[0045] Reaction conditions: 42 ℃, 2 min; 4 ℃ forever.

[0046] (2) circRNA reverse transcription, the reverse transcription system and conditions are as follows:

[0047]

[0048] Reaction conditions: 37 ℃ 15 min; 85 ℃ 5 sec; 4 ℃ forever.

[0049] Example 2

[0050] Obtaining genomic DNA from the longissimus dorsi muscle tissue of three developmental stages (newborn (NB), young (YG), and adult (AD)) of Huaxi cattle

[0051] (1) Take part of the tissue and grind it into powder using liquid nitrogen;

[0052] (2) Take an appropriate amount of tissue powder, add 200 μl of buffer GB and 20 μl of proteinase K premix solution to the 200 μl sample obtained by the above treatment, invert thoroughly to mix, and place at 56°C for 10 min, inverting several times during the mixing process, until the solution becomes clear.

[0053] (3) After standing at room temperature for 2-5 minutes, add 350 μl of buffer BD and mix thoroughly by inverting. Flocculent precipitate may appear at this time.

[0054] (4) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CG2 (adsorption column CG2 is placed in a collection tube), centrifuge at 12000 rpm for 30 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CG2 in the collection tube.

[0055] (5) Add 500 μl of buffer GDB to the adsorption column CG2, centrifuge at 12,000 rpm for 30 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CG2 in the collection tube.

[0056] (6) Add 600 μL of rinse solution PWB to adsorption column CG2 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 sec, pour out the waste liquid in the collection tube, and place adsorption column CG2 in the collection tube.

[0057] (7) Repeat step 6.

[0058] (8) Centrifuge at 12,000 rpm for 2 min, discard the waste liquid, and place the adsorption column CG2 at room temperature for 2 min to completely dry the residual rinse liquid in the adsorption material.

[0059] (9) Transfer the adsorption column CG2 into a 1.5 ml centrifuge tube, add 50-200 μl of elution buffer TB to the middle of the adsorption membrane, leave it at room temperature for 2 min, centrifuge it at 12,000 rpm for 2 min, collect the solution into the centrifuge tube, and obtain genomic DNA.

[0060] Example 3

[0061] The longissimus dorsi muscle tissue of young Huaxi cattle was selected for RT-PCT reaction and agarose gel electrophoresis

[0062] The transcript sequence of novel_circ_0001180 is shown as SEQ ID NO.1, and the connection sequence of novel_circ_0001180 is shown as SEQ ID NO.2.

[0063] The upstream primer sequence of the divergent primer of novel_circ_0001180 is: TGACGAACTGAAGGACTCTGA, SEQ ID NO.3; The upstream primer sequence of the divergent primer of novel_circ_0001180 is: CCACTCAACTCATCTGCTTCC, SEQ ID NO.4;

[0064] The upstream primer sequence of the convergent primer of novel_circ_0001180 is: TCATGTCCCTTCACTCACCC, SEQ ID NO.5; the downstream primer sequence of the convergent primer of novel_circ_0001180 is: TCAGGGCTAACTTCTCAACCA, SEQ ID NO.6.

[0065] RT-PCR

[0066] (1) The RT-PCR reaction system is: 15 μL of 2× Master Mix Taq enzyme, 1 μL of cDNA template, 0.8 μL of upstream and downstream primers, and sterile ddH2O to 30 μL.

[0067] (2) The reaction conditions were: 95 °C, 5 min; 95 °C, 30 s; optimal Tm 30 s; 72 °C, 30 s, 36 cycles; 72 °C, 5 min; and stored at 4 °C.

[0068] Agarose gel electrophoresis

[0069] (1) Prepare a 2% agarose gel containing nucleic acid dye, apply 120V voltage and perform electrophoresis for 30 minutes after spotting.

[0070] (2) When the fragments are clearly separated, image them using the BIO-RAD Gel Doc 2000 gel imaging system;

[0071] (3) Analyze the sequence length of the amplified product based on the comparison of the marker and fragment band positions in agarose gel electrophoresis imaging.

[0072] from Figure 1 A shows that novel_circ_0001180 divergent primer can successfully amplify the product using bovine longissimus dorsi cDNA as template, but novel_circ_0001180 divergent primer cannot amplify the product using bovine longissimus dorsi gDNA as template; novel_circ_0001180 convergent primer can successfully amplify the product using bovine longissimus dorsi cDNA as template, and novel_circ_0001180 convergent primer can amplify the product when bovine longissimus dorsi gDNA is used as template.

[0073] Example 4

[0074] Perform Sanger sequencing

[0075] (1) Cut the successfully identified fragment from the gel, place it in a clean centrifuge tube, and weigh it.

[0076] (2) Add an equal volume of PC solution to the gel block and place it in a 50°C water bath for about 10 min. During this time, gently invert the centrifuge tube up and down to ensure that the gel block is fully dissolved.

[0077] (3) Add the solution obtained in the previous step to an adsorption column CB2 (the adsorption column is placed in a collection tube), centrifuge at 12,000 rpm for 1 min, pour out the waste liquid in the collection tube, and place the adsorption column CB2 in the collection tube.

[0078] (4) Add 600 μl of rinse solution PW to the adsorption column CB2, centrifuge at 12,000 rpm for 1 min, pour out the waste liquid in the collection tube, and place the adsorption column CB2 in the collection tube.

[0079] (5) Repeat step 4.

[0080] (6) Place the adsorption column CB2 in a collection tube and centrifuge at 12,000 rpm for 2 min to remove as much of the rinse solution as possible. Leave the adsorption column at room temperature for several minutes to dry thoroughly.

[0081] (7) Place the adsorption column CB2 in a clean centrifuge tube, add an appropriate amount of elution buffer EB to the middle of the adsorption membrane, leave it at room temperature for 2 min, centrifuge it at 12,000 rpm (~13,400xg) for 2 min, and collect the DNA solution.

[0082] (8) The DNA solution was sent to Sangon Biotech Co., Ltd. for Sanger sequencing. The sequencing results were checked to see whether the circularization site was amplified. If the circularization site was amplified, it was confirmed to be circular RNA.

[0083] from Figure 1 As can be seen from the results of B, Sanger sequencing detected the real circularization site, proving that novel_circ_0001180 has a reverse splicing connection but no genomic rearrangement.

[0084] Example 5

[0085] RNase R resistance test

[0086] Total RNA (1 mg) from bovine longissimus dorsi muscle was treated with 2 U / mg RNaseR at 37°C for 20 minutes. The treated RNA was reverse transcribed into cDNA for subsequent fluorescence quantitative PCR experimental verification.

[0087] from Figure 1C shows that novel_circ_0001180 has stronger resistance than the linear mRNA control ( Figure 1 C), which confirmed that novel_circ_0001180 is a bona fide circRNA.

[0088] Example 6

[0089] Fluorescence quantitative PCR and sequencing were used to detect the expression of novel_circ_0001180 in the longissimus dorsi muscle tissue of Huaxi cattle at three developmental stages (newborn (NB), young (YG), and adult (AD)).

[0090] (1) The primer sequences of novel_circ_0001180 were the same as those in Example 3. The upstream primer sequence of GAPDH was ATCCTGCCAACATCAAGTGG, as shown in SEQ ID NO.7, and the downstream primer sequence of GAPDH was TCACGCCCATCACAAACATG, as shown in SEQ ID NO.8.

[0091] (2) The fluorescence quantitative PCR reaction system is as follows:

[0092]

[0093] (3) Fluorescence quantitative PCR reaction conditions: 95°C, 30 s; 95°C, 5 s, 60°C, 34 s; 95°C, 15 s, 60°C, 1 min, 95°C, 15 s, for a total of 40 cycles.

[0094] from Figure 1 From the results of D, we can see that the expression of novel_circ_0001180 is low in the neonatal stage, the expression level of novel_circ_0001180 is the highest in the adolescent stage, and it decreases in the adult stage compared with the adolescent stage. At the same time, we can see that the results of PCR detection and sequencing detection have basically the same trend.

[0095] Example 7

[0096] Detection of novel_circ_0001180 expression in the cytoplasm and nucleus of bovine skeletal muscle cells

[0097] A. Fluorescence in situ hybridization

[0098] 1. Cell Culture

[0099] Place the cell slides at the bottom of a 24-well plate and culture an appropriate amount of cells. Before the experiment, the cell confluence should reach 60%-70%.

[0100] 2. Cell Fixation and Permeabilization

[0101] a. Wash cells with PBS for 5 min;

[0102] b. Fix with 4% paraformaldehyde at room temperature for 10 min;

[0103] c. Wash the cells again with PBS for 5 min, 3 times in total;

[0104] d. Add 1 mL of pre-cooled permeabilization solution to each well and incubate at 4°C for 5 min.

[0105] e. After discarding the permeabilization solution, add 1X PBS to wash the cells for 5 min, three times.

[0106] 3. Probe detection

[0107] a. Add 200uL pre-hybridization solution to each well and block at 37℃ for 30 min;

[0108] b. During pre-hybridization, preheat the hybridization solution at 37°C;

[0109] c. In a dark environment, add 2.5uL 20uM circRNA FISH Probe Mix storage solution or internal reference FISH Probe Mix storage solution to 100 μl hybridization solution;

[0110] d. Discard the pre-hybridization solution in each well of cells, add 100uL of probe hybridization solution containing the probe, protect from light, and hybridize overnight at 37°C;

[0111] e. Wash each well of cells three times at 42°C in dark with hybridization wash solution I for 5 min each time to reduce background signal;

[0112] f. Wash the cells once with hybridization wash solution II at 42°C in a dark place.

[0113] g. Wash the cells once at 42°C with hybridization wash buffer III, away from light;

[0114] h. Protect from light and wash cells with 1X PBS at room temperature for 5 min.

[0115] 4. DNA staining

[0116] a. Protect from light, stain with 1X DAPI staining solution for 10 min. The amount of staining solution should be enough to cover all cells in the area to be hybridized.

[0117] b. Protect from light and wash the cells 3 times with 1X PBS, 5 min each time.

[0118] 5. Covering

[0119] Under light-proof conditions, carefully remove the cell slides from the wells, fix them on glass slides with mounting media, and examine them using a confocal microscope.

[0120] B. Nuclear and cytoplasmic separation

[0121] (1) Preparation of cell components

[0122] a. Aspirate the culture medium and rinse the cells with an appropriate amount of PBS. Aspirate the PBS.

[0123] b. Add 200 μL of pre-chilled Lysis Buffer J directly to the plate.

[0124] c. Place the cell culture dish on ice and lyse the cells for five minutes by gently tapping the dish and swirling the buffer over the surface of the dish.

[0125] d. Use a pipette to transfer the lysate to an RNase-free centrifuge tube and spin the lysate at maximum speed in a benchtop centrifuge for 10 minutes.

[0126] e. Using a small-tip pipette, transfer the supernatant containing the cytoplasmic RNA to another RNase-free tube.

[0127] Another RNase-free tube (not provided). See Important Note below. If nuclear RNA extraction is desired, retain the pellet containing the nuclear RNA.

[0128] (2) Binding of cytoplasmic RNA to the column

[0129] a. Add 200 μL of buffer SK to the supernatant (cytoplasmic RNA fraction) in step 1e and mix by vortexing for 10 seconds.

[0130] b. Add 200uL 96-100% ethanol to the mixture and shake for 10 seconds.

[0131] c. Place the mixture on a spin column equipped with a collection tube and centrifuge at ≥3500 × g (~6000 RPM) for 1 minute.

[0132] d. Discard the liquid. Reassemble the spin column with its collection tube.

[0133] (3) Binding of nuclear RNA to the column

[0134] a. Add 400 μL of buffer SK from step 1e to the pellet (nuclear RNA fraction) and vortex to mix for 10 seconds.

[0135] b. Add 200uL 96-100% ethanol to the mixture and shake for 10 seconds.

[0136] c. Place the mixture onto a second spin column assembled with a collection tube and centrifuge at ≥3500 x g (~6000 RPM) for 1 minute.

[0137] d. Discard the liquid. Reassemble the spin column with its collection tube.

[0138] (4) Column washing

[0139] a. Add 400 μL Wash Solution A to the column, centrifuge for 1 minute, and discard the liquid.

[0140] b. Repeat step 3a.

[0141] c. Wash the column for the third time by adding 400 μL of washing solution A and centrifuging for 1 minute.

[0142] d. Discard the liquid and reassemble the spin column into the collection tube.

[0143] e. Centrifuge for 2 minutes to completely dry the resin. Discard the collection tube.

[0144] (5) RNA elution

[0145] a. Place the adsorption column into the 1.7 mL elution tube provided with the kit.

[0146] b. Add 50 μL of elution buffer E to the adsorption column.

[0147] c. Centrifuge at 200 g for 2 minutes and 14,000 g for 1 minute

[0148] (6) RNA storage

[0149] Purified RNA samples can be stored at -20℃ for several days. It is recommended to store samples at -70℃ for long-term storage.

[0150] C. Reverse transcription and real-time fluorescence quantitative PCR of RNA obtained from cytoplasm and nucleus

[0151] The steps are the same as those in the above embodiment, except that the nuclear RNA internal reference is U6, the upstream primer of U6 is GCTTCGGCAGCACATATACTAAAAT, SEQ ID NO.9; the downstream primer of U6 is CGCTTCACGAATTTGCGTGTCAT, SEQ ID NO.10.

[0152] from Figure 2 As can be seen from the results of A, novel_circ_0001180 fluorescence staining is concentrated in the cytoplasm. Figure 2 The PCR results of B also showed that the expression of novel_circ_0001180 was concentrated in the cytoplasm, so novel_circ_0001180 was mainly distributed in the cytoplasm.

[0153] Example 8

[0154] Effects of novel_circ_0001180 interference on the proliferation of bovine skeletal muscle cells

[0155] (1) Skeletal muscle was added to a 96-well plate. After the cells were completely attached to the plate, the control group was transfected with si-NC and the treatment group was transfected with si-novel_circ_0001180;

[0156] (2) 48 hours after transfection, discard the culture medium, fix the cells with 4% paraformaldehyde solution for 30 min, discard the paraformaldehyde solution, neutralize the excess paraformaldehyde solution in the wells with 2 mg / mL glycine solution, and add PBS to wash three times, each time for 5 min;

[0157] (3) Add 0.5% TritonX-100 permeabilization agent and incubate on a decolorizing shaker for 10 min, then wash once with PBS;

[0158] (4) Add the Apollo staining solution prepared in advance, incubate in a light-proof shaker for 30 min, discard the staining solution, wash three times with PBS, and finally add DAPI to stain the nucleus. Then, take pictures under a fluorescence microscope to compare the changes in the number of positive cells in the control group and the treatment group.

[0159] from Figure 3 According to the results, the number of positive cells in the si-novel_circ_0001180 transfection group was significantly reduced compared with the control group. This result shows that interfering with novel_circ_0001180 can effectively inhibit the proliferation of bovine skeletal muscle cells, indicating that novel_circ_0001180 may play an important role in maintaining cell proliferation capacity. This discovery provides a new perspective for our understanding of the function of novel_circ_0001180 in the regulation of muscle cell growth, which will help develop new strategies to regulate Huaxi cattle muscle development and breeding.

[0160] Example 9

[0161] Effects of novel_circ_0001180 interference on the proliferation of bovine skeletal muscle cells

[0162] siRNA was designed according to the transcript sequence of novel_circ_0001180. The sense strand sequence of si- novel_circ_0001180-1 was: UUCUAACAGCCCAAGUAAA, as shown in SEQ ID NO.11, and the antisense strand was UUUACUUGGGCUGUUAGAA, as shown in SEQ ID NO.12;

[0163] The sense strand sequence of si-novel_circ_0001180-2 is: ACAGCCCAAGUAAAAAACA, as shown in SEQ ID NO.13, and the antisense strand sequence is: UGUUUUUUACUUGGGCUGU, as shown in SEQ ID NO.14;

[0164] The sense strand sequence of si-novel_circ_0001180-3 is: CCCAAGUAAAAAACAGGAA, as shown in SEQ ID NO.15, and the antisense strand of siRNA is: UUCCUGUUUUUUACUUGGG, as shown in SEQ ID NO.16.

[0165] A. Cell transfection

[0166] (1) Dilute the above siRNA to 50 μM with nuclease-free water, and store in a -80°C refrigerator for later use;

[0167] (2) Bovine skeletal muscle cells were seeded into 12-well plates and placed in an incubator until the cells were completely attached to the plate;

[0168] (3) Take two 1.5 mL centrifuge tubes, add 50 μL serum-free low-glucose DMEM and 2.5 μL siRNA to one centrifuge tube, and add 50 μL serum-free low-glucose DMEM and 2.5 μL liposomes to the other centrifuge tube. Mix them well, then mix the two tubes together, mix gently, and incubate at room temperature for 5 min.

[0169] (4) Add the incubated mixture to complete culture medium, mix gently, add to cells for culture, and perform subsequent treatment after 48 hours of culture.

[0170] B. Total RNA extraction, cDNA synthesis and fluorescence quantitative PCR were the same as in the above example.

[0171] First, the inhibitory effects of different si-novel_circ_0001180 were detected, and the results were as follows Figure 4As shown in A, it can be seen that si-novel_circ_0001180-3 has the best inhibitory effect, so si-novel_circ_0001180-3 was used as the siRNA of novel_circ_0001180 in subsequent experiments.

[0172] Then, the effect of interfering with novel_circ_0001180 on cell cycle genes was detected, and the results were as follows Figure 3 shown.

[0173] Among them, the upstream primer sequence of CDKN1A gene is AAACGGCGGCAGACC, SEQ ID NO.17, and the upstream primer sequence of CDKN1A gene is GCCCAAGGCAAAAGG, SEQ ID NO.18;

[0174] The upstream primer sequence of CDKN1B gene is AATGTTTCAGACGGTTCCCC, SEQ ID NO.19, and the upstream primer sequence of CDKN1B gene is TGTTGCTGTTCAGTGCTTGT, SEQ ID NO.20;

[0175] The upstream primer sequence of Cyclin D1 gene is GACGAGCTGCTGCACATGGA, SEQ ID NO.21, and the downstream primer sequence of Cyclin D1 gene is TGCTTGTTCTCCTCGGCCAC, SEQ ID NO.22;

[0176] The upstream primer sequence of Cyclin B2 gene is TGGGAGAGACATAAACGG, SEQ ID NO.23, and the downstream primer sequence of CyclinB2 gene is TGGAAGCCAAGAGCAGTG, SEQ ID NO.24;

[0177] The upstream primer sequence of the PCNA gene is GCTGTGTAGTAAAGATGCCT, SEQ ID NO.25, and the upstream primer sequence of the PCNA gene is ATCTCTATGGCAACAGCTTC, SEQ ID NO.26.

[0178] from Figure 4According to the results of B, after interfering with novel_circ_0001180, the expression of cell cycle inhibitory genes CDKN1A and CDKN1B was significantly upregulated, indicating that the inhibitory mechanism of the cell cycle was activated. At the same time, the expression of cell cycle promoting genes Cyclin D1, Cyclin B2 and PCNA was significantly downregulated, indicating that the cell cycle process was inhibited. This finding suggests that the cell cycle of bovine bone marrow muscle cells can be effectively regulated by interfering with novel_circ_0001180.

[0179] C. Flow cytometry for cell cycle detection

[0180] (1) Cell culture and treatment: Logarithmic phase bovine skeletal muscle cells were inoculated into a medium cell culture dish and transfected when the cell density reached about 50%. When the cell confluence reached about 80%, the cells were digested with trypsin and collected into a 2 mL centrifuge tube. The cells were washed twice with PBS.

[0181] (2) Cell fixation: After washing the cells with PBS, centrifuge and discard the supernatant. Add pre-cooled 70% ethanol and fix at 4°C overnight.

[0182] (3) Cell staining: Collect cells by centrifugation, wash cells twice with 1 mL of PBS, add 500 μL of PI staining solution (PBS containing 50 μg / mL propidium iodide (PI), 100 μg / mL RNase A, 0.2% TritonX-100), and incubate at 4°C in the dark for 30 min.

[0183] (4) Count 20,000 to 30,000 cells using flow cytometry and analyze the data using cell cycle simulation software.

[0184] like Figure 4 As shown in Figure C, the experimental results showed that the number of S phase cells was significantly reduced, which further verified that the interference with novel_circ_0001180 can effectively inhibit the cell cycle of bovine skeletal muscle cells. This change indicates that novel_circ_0001180 plays an important role in cell cycle regulation, and its inhibition may cause cells to arrest in the S phase of DNA synthesis, thereby affecting the proliferation and development of muscle cells.

Claims

1. A circular RNA for regulating Huaxi cattle breeding, characterized in that: The circular RNA is novel_circ_0001180, the transcript sequence of novel_circ_0001180 is shown in SEQ ID NO.1, and the connecting gene sequence of novel_circ_0001180 is shown in SEQ ID NO.

2.

2. The circular RNA according to claim 1, characterized in that The breeding regulation of Huaxi cattle is to achieve the selection and breeding of Huaxi cattle beef quality by regulating the proliferation of Huaxi cattle skeletal muscle cells.

3. Use of siRNA in the preparation of a preparation for regulating skeletal muscle development of Huaxi cattle, characterized in that: The siRNA is the siRNA of novel_circ_0001180, the transcript sequence of novel_circ_0001180 is shown in SEQ ID NO.1, and the connecting gene sequence of novel_circ_0001180 is shown in SEQ ID NO.2; The sequences of the siRNA are shown in SEQ ID NO.15 and SEQ ID NO.16, and the preparation inhibits the proliferation of skeletal muscle cells of Huaxi cattle.

4. A gene preparation for regulating skeletal muscle development in Huaxi cattle, characterized in that: The gene preparation is composed of novel_circ_0001180 siRNA and nuclease-free water, the transcript sequence of novel_circ_0001180 is shown in SEQ ID NO.1, and the connection gene sequence of novel_circ_0001180 is shown in SEQ ID NO.2; The sequences of the siRNA are shown in SEQ ID NO.15 and SEQ ID NO.

16.

5. The gene preparation according to claim 4, characterized in that: In the gene preparation, the concentration of the siRNA is 50 μM, and the gene preparation inhibits the proliferation of skeletal muscle cells of Huaxi cattle.

6. Use of siRNA in the preparation of a preparation for inhibiting the proliferation of skeletal muscle cells of Huaxi cattle, characterized in that: The siRNA is the siRNA of novel_circ_0001180, the transcript sequence of novel_circ_0001180 is shown in SEQ ID NO.1, and the connecting gene sequence of novel_circ_0001180 is shown in SEQ ID NO.2; The sequences of the siRNA are shown in SEQ ID NO.15 and SEQ ID NO.

16.

7. Use of siRNA in the preparation of a preparation for regulating the cell cycle of skeletal muscle cells of Huaxi cattle, characterized in that: The siRNA is the siRNA of novel_circ_0001180, the transcript sequence of novel_circ_0001180 is shown in SEQ ID NO.1, and the connecting gene sequence of novel_circ_0001180 is shown in SEQ ID NO.2; The sequences of the siRNA are shown in SEQ ID NO.15 and SEQ ID NO.

16.

8. The use according to claim 7, characterized in that: The preparation promotes the gene expression of cell cycle inhibitory genes CDKN1A and CDKN1B, and the preparation inhibits the gene expression of cell cycle promoting genes Cyclin D1, Cyclin B2 and PCNA.

Images