Transcription factor and protein for positively regulating matrine and oxymatrine in plants and application of transcription factor and protein

Abstract

The invention belongs to the field of crop genetic breeding, and relates to cultivation of plants with high matrine and oxymatrine content. In particular discloses a transcription factor for positively regulating matrine and oxymatrine in plants, and a nucleotide sequence of the transcription factor has 90% similarity with a sequence as shown in SEQ ID No.1. Furthermore, the nucleotide sequence of the transcription factor is as shown in SEQ ID No. 1. By constructing an overexpression vector of a subprostrate sophora transcription factor (StNAC46 gene) and performing genetic transformation on the overexpression vector, it is proved that the StNAC46 gene can improve accumulation of matrine and oxymatrine in plants, and a new thought is provided for cultivation and production of subprostrate sophora with high matrine and oxymatrine content.

Description

Technical Field

[0001] The invention belongs to the field of crop genetic breeding and relates to the cultivation of plants with high matrine and oxymatrine contents. Background Art

[0002] Sophora flavescens Sophora tonkinensis The dried root and rhizome of Gagnep. Sophora flavescens is bitter and cold, toxic, and belongs to the lung and stomach meridians. It has the effects of clearing heat, detoxifying, reducing swelling, and relieving pain, and has important medicinal value. The "Pharmacopoeia of the People's Republic of China" (2020 edition) records that matrine and oxymatrine are its main medicinal active ingredients, which have been proven to have anti-inflammatory, antibacterial, antioxidant, immunomodulatory and anti-cancer effects. However, traditional breeding methods have limited the further improvement of the alkaloid content of Sophora flavescens.

[0003] The NAC (NAM, ATAF, CUC) transcription factor family plays a key regulatory role in plant growth, development and stress response. Recent studies have shown that some NAC transcription factors, such as OpNAC1, can target the mitochondria in short snakeroot. OpLAMT Enzymes regulate the synthesis and accumulation of camptothecin. Application No. CN101473037A discloses a NAC transcription factor that can increase yield; Application No. CN113736793A discloses a transcription factor NAC that can improve the cold resistance of grapes; Application No. CN115838760A discloses a transcription factor NAC that can significantly increase the flavonoid content in tea plants; It can be seen that the functions of NAC transcription factors in different plants are different, and the research on the function of NAC transcription factors in Sophora flavescens is in a blank stage. Summary of the invention

[0004] In order to study the function of NAC transcription factor in Sophora flavescens, the present application discloses a transcription factor, protein and application thereof for positively regulating matrine and oxymatrine in plants, which solves the problem of low yield of matrine and oxymatrine in Sophora flavescens, and provides a new idea for cultivating plants with high matrine and oxymatrine content.

[0005] The technical solution of the present invention is achieved in this way: The present application provides a transcription factor that positively regulates matrine and oxymatrine in plants, wherein the nucleotide sequence of the transcription factor has 90% similarity with the sequence shown in SEQ ID No.1.

[0006] Furthermore, the nucleotide sequence of the above transcription factor is shown in SEQ ID No.1.

[0007] The amino acid sequence of the protein encoded by the above-mentioned transcription factor is shown in SEQ ID No.2.

[0008] Application of the above transcription factor or the above protein in increasing the content of matrine and oxymatrine in plants.

[0009] Furthermore, the above-mentioned plant is Sophora flavescens or Nicotiana tabacum.

[0010] The present application also provides a method for increasing the content of matrine and oxymatrine in plants, the steps of which are: constructing an overexpression vector containing the above-mentioned transcription factor, and transferring it into the plant to be improved by genetic transformation to obtain a plant with high matrine and oxymatrine content.

[0011] Preferably, the nucleotide sequence of the transcription factor is shown as SEQ ID No.1.

[0012] Preferably, the above-mentioned overexpression vector is a plant overexpression vector.

[0013] Preferably, the above genetic transformation method is Agrobacterium transformation method, preferably leaf disc method.

[0014] Preferably, the plant to be improved is Sophora flavescens or Nicotiana tabacum.

[0015] The present invention has the following beneficial effects: 1. The present invention obtains Sophora flavescens by genetic engineering StNAC46 base The results of the study showed that the expression of StNAC46 in tobacco plants can affect the biosynthesis of matrine and oxymatrine from Sophora flavescens. StNAC4 Compared with the wild type, the matrine content of the overexpressed plants of the 6 genes increased by 1.3 to 13.0 times, and the oxymatrine content increased by 1.1 to 48.4 times. StNAC46 Transcription factors can increase the accumulation of tobacco matrine and oxymatrine. StNAC46 As the target of regulating the content of matrine and oxymatrine in plants, the development of new genetic improvement methods has important scientific and application value.

[0016] 2. The present invention constructs Sophora flavescens StNAC46 Gene overexpression vector was used to transform the gene and confirm StNAC46 The gene can increase the accumulation of matrine and oxymatrine in plants, providing a new idea for cultivating and producing Sophora flavescens with high matrine and oxymatrine content. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 Agarose gel electrophoresis of total RNA extracted from Sophora tonkinensis (A) and StNAC46 gene amplification product (B); A: M: DL2000 DNA Maker; 1: root total RNA band; 2: leaf total RNA band; B: M: DL2000 DNA Maker; 1: target gene band.

[0019] Figure 2 These are the results of restriction enzyme digestion detection of vector pBWA(V)HS-O-StNAC46; DNA Marker (MR IV): 5000, 3000, 2000, 1500, 750, 500, 250, 100 bp; EcoRV restriction enzyme digestion bands: 5324, 2691, 1969, 1134 bp.

[0020] Figure 3 This is the map of the pBWA(V)HS-O-StNAC46 vector; the vector eukaryotic resistance: Hygromycin, the prokaryotic resistance: Kanamycin.

[0021] Figure 4 For genetic transformation of Nicotiana benthamiana.

[0022] Figure 5 For transfer StNAC46 Gene plant PCR detection.

[0023] Figure 6 Analysis of target gene expression levels in transgenic tobacco. DETAILED DESCRIPTION

[0024] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] Unless otherwise specified, the experimental methods used in the following experimental examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0026] The present application provides a transcription factor that positively regulates matrine and oxymatrine in plants, wherein the nucleotide sequence of the transcription factor has 90% similarity with the sequence shown in SEQ ID No.1.

[0027] Furthermore, the nucleotide sequence of the above transcription factor is shown in SEQ ID No.1.

[0028] The amino acid sequence of the protein encoded by the above-mentioned transcription factor is shown in SEQ ID No.2.

[0029] Application of the above transcription factor or the above protein in increasing the content of matrine and oxymatrine in plants.

[0030] Furthermore, the above-mentioned plant is Sophora flavescens or Nicotiana tabacum.

[0031] The present application also provides a method for increasing the content of matrine and oxymatrine in plants, the steps of which are: constructing an overexpression vector containing the above-mentioned transcription factor, and transferring it into the plant to be improved by genetic transformation to obtain a plant with high matrine and oxymatrine content.

[0032] Preferably, the nucleotide sequence of the transcription factor is shown as SEQ ID No.1.

[0033] Preferably, the above-mentioned overexpression vector is a plant overexpression vector.

[0034] Preferably, the above genetic transformation method is a leaf disc method or an Agrobacterium transformation method.

[0035] Preferably, the plant to be improved is Sophora flavescens or Nicotiana tabacum.

[0036] The present invention constructs Sophora flavescens StNAC46 Gene overexpression vector was used to transform the gene and confirm StNAC46 The gene can increase the accumulation of matrine and oxymatrine in plants, providing a new idea for cultivating and producing Sophora flavescens with high matrine and oxymatrine content.

[0037] Specifically, the following embodiments are used as examples for detailed description: Example

[0038] 1. StNAC46 gene cloning 1) RNA extraction and cDNA synthesis Frozen Sophora flavescens leaves and roots were ground into powder in liquid nitrogen. RNA was extracted using the FastPure Universal PlantTotal RNA Isolation Kit (Vazyme, Nanjing). cDNA was synthesized using the TransscriptOne-Step gDNARemoval and cDNA Synthesis Super Mix TransScript (Quanshijin, Beijing) reverse transcription kit.

[0039] 2) StNAC46 Gene PCR amplification The obtained Sophora flavescens cDNA was used as a template to amplify the target gene fragment.

[0040] Design a 50 μL reaction system: 20 μL of nuclease-free water, 25 μL of high-fidelity enzyme 2×Phanta Max Buffer Mix, 1.5 μL of forward primer (10 μM / L), 1.5 μL of reverse primer (10 μM / L), and 2 μL of cDNA template.

[0041] Forward primer: ATGGACAGCACAGATTCATCATC; Reverse primer: TCAGTTCCAATTTATGCCTCCAAG.

[0042] The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 sec, annealing at 55°C for 15 sec, extension at 72°C for 1.5 min, for a total of 35 cycles, extension at 72°C for another 5 min, and finally storage at 16°C.

[0043] 3) Target fragment gel recovery The sol was recovered using a DNA gel kit (B518131, Biotechnology).

[0044] 4) Connect the target fragment to the cloning vector and transform E. coli The PCR amplified StNAC46 The gene was ligated to the 5×TA / Blunt-Zero Cloning Mix vector, which was then transformed into E. coli DH5α and cultured in the dark at 37°C overnight.

[0045] 5) Identification and sequencing of positive bacterial species The strain was identified by PCR, and after ensuring the correct identification, it was sent to Biotechnology Co., Ltd. for sequencing. The PCR reaction system was 8.2 μL of nuclease-free water, 25 μL of high-fidelity enzyme 2×Phanta Max Buffer Mix, 0.4 μL of forward primer (10 μM / L), 0.4 μL of reverse primer (10 μM / L), and 1 μL of cDNA template. The amplification program was as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 sec, 58℃ annealing for 15 sec, 72℃ extension for 1 min, a total of 35 cycles, 72℃ extension for another 5 min, and finally stored at 16℃.

[0046] The total RNA extracted from Sophora tonkinensis was amplified by PCR and detected by gel electrophoresis. The obtained fragments were consistent with the expected size of the target gene ( Figure 1 B). After gel recovery, the samples were sent to Shanghai Jie Li Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the ORF sequence of the target gene by DNAMAN software. StNAC46The length was determined to be 1083 bp after sequencing. The nucleotide contents were A (28.53%, 309), T (25.95%, 281), G (21.42%, 232) and C (24.10%, 261), and there were no unresolved nucleotides in the sequence.

[0047] 2. Construction of pBWA(V)HS-O-StNAC46 overexpression vector and plant transformation 1) Construction of overexpression vector ① Extract the positive plasmid from the positive strains obtained through sequencing according to the instructions of the kit.

[0048] ② Based on the gene nucleotide information obtained by sequencing, design specific primers containing enzyme cutting sites: Forward primer: AACACGGGGGACTTTGCAACatggacagcacagattcatcatcatgctc; Reverse primer: TGAAGACAGAGCTAGTTACAtcagttccaatttatgcctggaagttgaaattgttg; PCR amplification was performed to obtain positive plasmids. The extracted positive plasmids were double-digested, and the results of enzyme digestion verification were shown in Figure 2 .

[0049] The PCR reaction system was as follows: 20 μL of nuclease-free water, 25 μL of high-fidelity enzyme 2×Biorun Pfu PCR Mix, 2 μL of NAC46(+), 2 μL of NAC46(-), and 1 μL of cDNA.

[0050] The PCR amplification program was as follows: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 sec, 50°C annealing for 45 sec, 72°C extension for 65 sec, for a total of 30 cycles, 72°C extension for another 10 min, and finally storage at 16°C.

[0051] Use 1% agarose gel electrophoresis, 5v / cm voltage, 20min, cut out the electrophoresis fragment of StNAC46 (1083bp) under ultraviolet light, put it in a system for sol recovery, and dissolve the recovered DNA with a total volume of 40uL of water. The recovered product is marked as: rDNAS. After detection, it is recombined with the vector.

[0052] Enzyme digestion and ligation system: nuclease-free water 13μL, 10*Buffer 2μL, BsaI / Eco31I 1μL, pBWA(V)HS-ccdB 4μL.

[0053] Reaction conditions for enzyme digestion and ligation: 37℃ for 1hours.

[0054] Recombination reaction components: Biorun 2*EasyClone Mix 10μL, rDNAs 5μL, pBWA(V)HS-ccdB 5μL.

[0055] Recombination reaction conditions: 37°C 30min.

[0056] 2) Plasmid transformation The ligation product was transformed into competent E. coli DH5α, spread on LB (100 mg / mL Kana) solid medium, and cultured inverted in a 37°C incubator overnight. A single clone was picked and inoculated into LB (100 mg / mL Kana) liquid medium. After shaking culture at 37°C for about 6 h, bacterial liquid PCR was performed to detect pBWA(V)HS- StNAC46 The primers are: Forward primer: tTCATTTGGAGAGAACACGGGggac (2861 bp); Reverse primer: gagaaagttgacatcgtcgg (3503 bp).

[0057] Take 1-3 positive bands corresponding to the bacterial solution, take 100 μL sample sequencing, the sequencing result is 1083bp. The overexpression recombinant plasmid containing the target gene obtained after correct sequencing is named pBWA(V)HS-O- StNAC46 , vector construction schematic diagram see Figure 3 .

[0058] 3) Agrobacterium transformation of Nicotiana benthamiana ① Pre-culture: Soak tobacco seeds in 75% alcohol on a clean bench for 1 min for disinfection, and wash with sterile water 3 to 5 times, 1 min each time; sow the disinfected tobacco seeds on MS culture medium, and culture them in a 25℃ tissue culture room for 4 to 5 weeks (16 h light / 8 h dark). Take young tobacco leaves and cut them into small pieces with a scalpel and inoculate them on the pre-culture medium (MS + 7% agar + 2.5% sucrose + 0.2 mg / L NAA + 1 mg / L 6-BA). The front of the leaves should face down during inoculation, and about 10 leaf discs should be placed in each bottle.

[0059] ②Infection and co-cultivation: Resuspend the Agrobacterium cells collected in "4.2" with MS resuspension (4.432 g / L MS + 30 g / L sucrose), adjust the OD600 of the Agrobacterium resuspension to 0.2, inoculate tobacco leaves pre-cultured for 2 to 3 days in the Agrobacterium suspension for infection for 10 to 15 min, place the infected tobacco leaves on sterile filter paper to absorb the remaining bacterial liquid, and then inoculate them with the back of the leaves facing down on the co-culture medium (MS + 7% agar + 2.5% sucrose + 0.2 mg / L NAA + 1 mg / L 6-BA + 100 μM acetosyringone), and culture in the dark for 48 to 72 h.

[0060] ③ Induction and screening: transfer the co-cultivated leaves to the induction medium to induce callus tissue, culture at 23℃ for 16h light, and change the medium every 2 weeks. Select effective callus tissue and transfer it to the screening medium corresponding to the resistance, culture time 15-30 days, temperature 23±2℃; ④ Differentiation and rooting: Transfer the screened positive callus to differentiation medium (MS+7% agar+2.5% sucrose+1 mg / L 6-BA+0.2 mg / L NAA+500 mg / L Cef+100 mg / L Kan), 4-5 callus tissues per culture dish, and culture at 23℃ for 15-30 days; during the differentiation process, if seedlings are formed in the callus, inoculate them into root induction medium (MS+7% agar+2.5% sucrose+0.2 mg / L NAA+500 mg / L Cef+100 mg / L Kana) for growth.

[0061] ⑤ Training and transplanting seedlings: After the root system of Nicotiana benthamiana is fully developed, transplant the seedlings into the soil after training (1 day). The soil ratio is peat soil: perlite: vermiculite 3:1:1.

[0062] three, StNAC46 Positive identification of transgenic tobacco: Using sterile Nicotiana benthamiana seedlings grown for about 4 weeks, the pBWA(V)HS-O-StNAC46 plasmid was transformed into wild-type Nicotiana benthamiana by the leaf disc method. The infected tobacco leaves were cultured in the dark on the culture medium for 2-3 days. Callus tissue was induced in the tobacco leaves after dark culture. After the vigorous callus tissue grew, it was transferred to the screening culture medium for differentiation and grew tiny buds. The buds successfully transformed with pBWA(V)HS-O-StNAC46 can grow normally on the culture medium containing hygromycin ( Figure 4 ), a total of 6 T2 transgenic lines were screened and PCR positive identification was performed: Using genomic DNA as template, pBWA(V)HS-O- StNAC46 Primer for the hygromycin resistance marker gene in the vector (481 bp): Forward primer: CTGCCCGCTGTTCTACAACCGG; Reverse primer: GGAGCATATACGCCCGGAGTC; Detect transgenic plants to determine whether the constructed vector has been transferred into tobacco. Seeds of positive plants (T0) are further screened with hygromycin. When the positive plants to be screened gradually grow up and have a well-developed root system, they can be moved to the greenhouse for conventional culture to obtain T1 generation seeds.

[0063] The harvested seeds (T1) were screened with 1 / 2 MS medium containing 50 mg / mL hygromycin, and then positive plants were screened by PCR. They were then cultured in a lighted tissue culture room to obtain T2 generation plants.

[0064] Negative control: The transgenic Nicotiana benthamiana without the target fragment inserted into the empty vector was used as the negative control.

[0065] The results are as follows Figure 5 As shown: The transgenic plants showed a fragment of about 500 bp, which was consistent with the amplification result of the hygromycin resistance marker gene primer, while the characteristic band was not found in the lane of wild-type tobacco (negative control). This result preliminarily proved that the exogenous gene StNAC46 to be integrated into tobacco genes ( Figure 5 ).

[0066] Four, StNAC46 Identification of transgenic tobacco by real-time fluorescence quantitative PCR To detect StNAC46 For overexpression in transgenic tobacco, the T2 transgenic tobacco with positive PCR test results was selected. RNA from different transgenic tobacco strains and control Nicotiana benthamiana (WT) seedlings was extracted using the Novozyme RNA extraction kit for real-time fluorescence quantitative PCR.

[0067] Nicotiana benthamiana Nicotiana benthamiana ) elongation factor gene (NbEF1α) was used as an internal reference gene.

[0068] Real-time fluorescence quantitative PCR was used to detect target genes in different tobacco strains and control Nicotiana benthamiana seedlings using primers StNAC46 expression level.

[0069] Forward primer: TCCTCTGGCTGCTGGTCCTC; Reverse primer: TCTCCGTAGAAAGCTCCTTGTCATC.

[0070] result( Figure 6) showed that the exogenous genes in the transgenic plants were successfully expressed, but the expression levels were different. Compared with the wild type (WT), the expression levels of the four strains OE-1, OE-3, OE-4, and OE-6 were significantly improved.

[0071] After antibiotic screening, PCR detection and qRT-PCR detection, transgenic tobacco with stable exogenous genes and successful expression was finally obtained.

[0072] five, StNAC46 Effects of overexpression on alkaloid content in plants Three transgenic tobacco lines OE-1, OE-3, OE-6 and wild-type plants (WT) with high expression levels of the target gene were selected, and the contents of matrine and oxymatrine were determined by ESI-HPLC-MS / MS method. The results are shown in Table 1.

[0073] Table 1 Analysis of matrine and oxymatrine content in transgenic tobacco From Table 1, we can see that: StNAC46 The matrine contents of transgenic tobacco OE-1, OE-3, and OE-6 were 2.78, 2.86, and 27.20 ng / g, respectively, and the oxymatrine contents were 5.74, 5.94, and 253.04 ng / g, respectively. Figure 6 As shown: Compared with the wild-type plants (WT), the matrine content in the StNAC46 overexpression lines increased by 1.3 to 13.0 times, and the oxymatrine content increased by 1.1 to 48.4 times. StNAC46 Transcription factors can enhance the accumulation of tobacco matrine and oxymatrine.

[0074] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for positively regulating the transcription factors of matrine and oxymatrine in plants, characterized in that: The nucleotide sequence of the transcription factor has 90% similarity with the sequence shown in SEQ ID No.

1.

2. The transcription factor for positively regulating matrine and oxymatrine in plants according to claim 1, characterized in that: The nucleotide sequence of the transcription factor is shown in SEQ ID No.

1.

3. The protein encoded by the transcription factor according to claim 1 or 2, whose amino acid sequence is shown in SEQ ID No.

2.

4. Use of the transcription factor according to claim 1 or 2 or the protein according to claim 3 in increasing the content of matrine and oxymatrine in plants.

5. The use of claim 4 for increasing the content of plant matrine and oxymatrine, characterized in that: The plant is Sophora flavescens or Nicotiana tabacum.

6. A method for increasing the content of matrine and oxymatrine in plants, characterized in that: The steps are: constructing an overexpression vector containing the transcription factor according to claim 1 or claim 2, and transferring it into the plant to be improved by genetic transformation to obtain plants with high matrine and oxymatrine content.

7. The method for increasing the content of plant matrine and oxymatrine according to claim 6, characterized in that: The nucleotide sequence of the transcription factor is shown in SEQ ID No.

1.

8. The method for increasing the content of plant matrine and oxymatrine according to claim 7, characterized in that: The overexpression vector is a plant overexpression vector.

9. The method for increasing the content of plant matrine and oxymatrine according to claim 8, characterized in that: The genetic transformation method is Agrobacterium transformation.

10. The method for increasing the content of plant matrine and oxymatrine according to claim 8, characterized in that: The plant to be improved is Sophora flavescens or Nicotiana tabacum.

Images