Application of DsHAD gene in regulating growth, reproduction, pathogenicity and stress resistance of Didymella segeticola

Abstract

The application discloses application of a DsHAD gene in regulating growth, reproduction, pathogenicity and adversity resistance of Didymella segeticola. The DsHAD gene is derived from the Didymella segeticola, a knockout gene fragment of the DsHAD gene of D.segeticola is constructed, and the knockout mutant is obtained by introducing the knockout gene fragment into D.segeticola protoplast. It is found through experiments that the DsHAD gene has an effect on the growth, reproduction and adversity resistance of D.segeticola, and significantly reduces the pathogenicity of D.segeticola to tea tree leaves. Therefore, the DsHAD can be used as a fungicide target and a key protein of a pathogenic mechanism of a disease, and is used for developing a medicament for the disease caused by D.segeticola infection and cultivating a new variety of disease-resistant plants, and has a wide application prospect in the prevention and treatment of plant pathogenic fungal diseases.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biotechnology, and particularly relates to application of DsHAD gene in regulating growth, reproduction, pathogenicity and stress resistance of Didymella segeticola. BACKGROUND

[0002] The genus Didymella belongs to the Ascomycota, Dothideomycetes, Pleosporales, Didymellaceae and many fungi of this genus are of certain pathogenicity to various plants (Crous, P.W., Gams, W., Stalpers, J.A., Robert, V., Stegehuis, G. MycoBank: an online initiative to launch mycology into the 21st century. Studies in Mycology, 2004, 50(1): 19-22; Chen, Q., Hou, L.W., Duan, W.J., Crous, P.W., Cai, L. Didymellaceae revisited. Studies in Mycology, 2017, 87: 105-159).For example, Didymella segeticola can cause pepper leaf spot disease (Yang, J., Chen, C., Yin, X., Xu, H., Long, H., Gu, G., Shu, R., Yuan, J., Zhou, H. Didymella segeticola is a new pathogen causing leaf spot disease on Zanthoxylum bungeanum. New Zealand Journal of Crop and Horticultural Science, 2022, 51: 694-703), tobacco leaf spot disease (Guo, Z. N., Xie, H. L., Wang, H. C., Huang, Y., Chen, Q. L., Xiang, L. G., Yu, Z. H., Yang, X. H. Leaf spot caused by Didymella segeticola on tobacco in China. Plant Disease, 2019, 104(5): 1559-1560), tea leaf spot disease (Deng, X., Yang, J., Wan, Y., Han, Y., Tong, H., Chen, Y. Characteristics of leaf spot disease caused by Didymella species and the influence of infection on tea quality. Phytopathology, 2023, 113(3): 516-527) D. segeticola var. camelliae strain GZSQ-4 (deposited with China General Microbiological Culture Collection Center, strain preservation number CGMCC 3.20152) was isolated and identified from tea leaf spot disease in Shiqian County, Guizhou Province by the research group of the present inventors. The pathogen can infect tea tree shoots, tender leaves and mature leaves, and has a serious impact on tea quality and yield. Technical measures need to be developed for the disease (Zhao, X. Z., Wang, Y., Li, D. X., Ren, Y. F., Chen, Z. Morphological characteristics and phylogenetic analysis of Phoma segeticola var. camelliae, a new pathogen of tea plant. Plant Disease, 2018, 48(4): 556-559).

[0003] The haloacid dehalogenase (HAD) superfamily is the largest of the enzyme superfamilies, and is composed mainly of phosphotransferases, ATPases, phosphorylases, and sugar phosphomutases (Kaur, H., Rode, S., Sandra, K. P., Mahto, J. K., Alam, M. S., Gupta, D. N., Kar, B., Singla, J., Kumar, P., Sharma, A. K. Characterization of haloacid dehalogenase superfamily acid phosphatase from Staphylococcus lugdunensis. Archives of Biochemistry and Biophysics, 2024, 753, 109888.). Current research has focused mainly on the structural properties of the enzyme, its catalytic properties, and its potential for industrial applications (Kuznetsova, E., Nocek, B., Brown, G., Makarova, K. S., Flick, R., Wolf, Y. I., Khusnutdinova, A., Evdokimova, E., Jin, K., Tan, K., Hanson, A. D., Hasnain, G., Zallot, R., de Crecy-Lagard, V., Babu, M., Savchenko, A., Joachimiak, A., Edwards, A. M., Koonin, E. V., Yakunin, A. F. Functional diversity of haloacid dehalogenase superfamily phosphatases from Saccharomyces cerevisiae: biochemical, structural, and evolutionary insights. Journal of Biological Chemistry, 2015, 290(30): 18678-18698; Yang, L., Lu, Y., Tian, W., Feng, Y., Bai, J., Zhang, H. Insights into the functional divergence of the haloacid dehalogenase superfamily from phosphomonoesterase to inorganic pyrophosphatase.Archives of Biochemistry and Biophysics, 2021, 705, 108896; Wang, Y., Xiang, Q., Zhou, Q., Xu, J., Pei, D. Mini review: advances in 2-haloacid dehalogenases. Frontiers in Microbiology, 2021, 12, 758886.

[0004] So far, the molecular biology research of D. segicola is still weak, especially the lack of pathogenic mechanism reports. Therefore, fully excavating the pathogenic related genes of D. segicola and carrying out the function research are helpful to comprehensively understand the pathogenic mechanism of D. segicola and the disease control. The application obtains a halogenated acid dehydrogenase superfamily gene (named as DsHAD) from D. segicola, which is related to the pathogenicity and growth and reproduction of D. segicola, so the DsHAD gene will have important significance and application prospect in the disease control caused by D. segicola and the breeding of new plant disease-resistant varieties. SUMMARY

[0005] Therefore, one of the purposes of the application is to provide a new use of DsHAD protein derived from D. segicola, that is, the application of DsHAD protein in regulating the pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of D. segicola, wherein the DsHAD protein is a protein with an amino acid sequence as shown in sequence SEQ ID NO. 2 or a fusion protein obtained by connecting a tag to the N terminal and / or C terminal of the protein with an amino acid sequence as shown in sequence SEQ ID NO. 2.

[0006] The second purpose of the application is to provide the application of biological materials related to DsHAD protein in regulating the pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of D. segicola, wherein the biological materials are nucleic acid molecules encoding DsHAD protein or expression cassettes, recombinant vectors or recombinant microorganisms containing the nucleic acid molecules, such as recombinant vectors or recombinant microorganisms containing the expression cassettes.

[0007] Preferably, the nucleotide sequence of the nucleic acid molecule is as shown in sequence SEQ ID NO. 1. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA, or RNA, such as mRNA or hnRNA, etc. The vector can be a plasmid, a cosmid, a bacteriophage or a viral vector; the microorganism can be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0008] The third object of the present application is to provide the use of the above-mentioned DsHAD protein as a target in the design and screening of anti-fungal drugs.

[0009] The fourth object of the present application is to provide the use of the above-mentioned DsHAD protein or the above-mentioned biological material in the cultivation of transgenic D. segeticola with reduced pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance.

[0010] The fifth object of the present application is to provide a method for cultivating transgenic D. segeticola with reduced pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance, comprising the step of reducing the expression amount and / or activity of the above-mentioned DsHAD protein in the recipient D. segeticola, to obtain the transgenic D. segeticola (such as DsHAD knockout mutant). The pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of the transgenic D. segeticola is lower than that of the wild-type D. segeticola.

[0011] Preferably, the method for reducing the expression amount and / or activity of the DsHAD protein in the recipient D. segeticola is achieved by knocking out or inhibiting or silencing the expression of the gene encoding the DsHAD protein in the recipient D. segeticola.

[0012] Preferably, the method for knocking out is a method of homologous recombination to knock out the gene encoding the DsHAD protein in the recipient D. segeticola.

[0013] Preferably, the method of homologous recombination is to introduce a homologous recombination fragment for homologous recombination into the protoplast of the recipient DsHAD.

[0014] The sixth object of the present application is to provide the use of the above-mentioned method in the prevention and treatment of diseases caused by DsHAD.

[0015] The application provides a DsHAD protein derived from D.segeticola and application of a coding gene thereof in regulating pathogenicity, growth rate, reproductive capacity and stress resistance of the plant pathogenic fungus D.segeticola. It is found that the pathogenicity, growth rate, reproductive capacity and stress resistance of the D.segeticola after knocking out the DsHAD protein coding gene in the wild type D.segeticola are significantly reduced. Therefore, the DsHAD can be used as a fungicide target and a key protein of pathogenic mechanism of diseases to develop a medicament for diseases caused by D.segeticola infection and cultivate new varieties resistant to diseases, and has a broad application prospect in the prevention and treatment of plant pathogenic fungal diseases. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 DsHAD gene knockout and mutant screening strategy of D.segeticola in the application;

[0017] Figure 2 DsHAD gene knockout and mutant screening strategy of D.segeticola in the application;

[0018] Figure 3 DsHAD gene knockout and mutant screening strategy of D.segeticola in the application;

[0019] Figure 4 DsHAD gene knockout and mutant screening strategy of D.segeticola in the application;

[0020] Figure 5 DsHAD gene knockout and mutant screening strategy of D.segeticola in the application;

[0021] Figure 6 DsHAD gene knockout and mutant screening strategy of D.segeticola in the application;

[0022] Figure 7 DsHAD gene knockout and mutant screening strategy of D.segeticola in the application;

[0023] Figure 8 DsHAD gene knockout and mutant screening strategy of D.segeticola in the application;

[0024] Figure 9 DsHAD gene knockout and mutant screening strategy of D.segeticola in the application; DETAILED DESCRIPTION

[0025] The application will be described in detail below with reference to the embodiments, which are only illustrative and not restrictive to the application. The application is not limited to the following embodiments or examples, and any modification and variation made without departing from the spirit of the application shall be included in the scope of the application. The experimental materials used in the following examples are commercially available unless otherwise specified.

[0026] The wild type strain GZSQ-4 of D. segiticola in the following examples was isolated and identified from tea leaf spot in a tea leaf base in Datun Village, Longtang Town, Shiqian County, Guizhou Province, and was deposited in China General Microbiological Culture Collection Center with a strain deposit number of CGMCC3.20152. The genomic DNA sequence and CDS sequence of the DsHAD gene in the strain are both shown as SEQ ID NO. 1, and by sequence alignment, the gene should belong to the Haloacid dehalogenase (HAD) superfamily gene; the amino acid sequence of the DsHAD protein encoded by the gene is shown as SEQ ID NO. 2.

[0027] Example 1 Knockout of DsHAD gene of D. segiticola

[0028] 1. Construction of knockout gene fragment

[0029] 1) Amplification of upstream and downstream homologous sequences of the target gene: the genomic DNA of the wild type strain CGMCC3.20152 of D. segiticola was used as a template, and primer 1F and 2R were used to amplify the upstream A fragment, and primer 3F and 4R were used to amplify the downstream B fragment, and a reverse complementary sequence of primer HYG-F was added to the 5' end of primer 2R, and a reverse complementary sequence of primer HYG-R was added to the 5' end of primer 3F. The sequences (5' end to 3' end) of primers 1F, 2R, 3F, 4R, HYG-F and HYG-R are as follows:

[0030] 1F: TACGAAGTTTGGAAGAACCGC

[0031] 2R: ACCTCCACTAGCTCCAGCCAAGTACGTAGAGCTTCCTTACGATCG 3F: GAATAGAGTAGATGCCGACCGGGGGAAGATCAAGAAGCCTACAGTG 4R: AGAATCGTGACGGTGCTTTTC

[0032] HYG-F: CTTGGCTGGAGCTAGTGGAGGT

[0033] HYG-R: CCCGGTCGGCATCTACTCTATTC

[0034] 2) Amplification of the hygromycin resistance gene hph: The first half of the hygromycin resistance gene Hl (1094 bp) was amplified using primers HYG-F and HYG-1R with plasmid pCT74 (map shown in Figure) as the template; the second half of the hygromycin resistance gene H2 (748 bp) was amplified using primers HYG-1F and HYG-R. The sequences of primers HYG-1F and HYG-1R (5' end to 3' end) are: HYG-1F: CGTTGCAAGACCTGCCTGAA; HYG-1R: GGATGCCTCCGCTCGAAGTA. Figure 1

[0035] 3) Fusion of the upstream and downstream fragments of the target gene with the hygromycin resistance gene: Overlapping PCR was used to overlap the recovered A fragment and B fragment with the Hl fragment and the H2 fragment, respectively, to obtain A-Hl and H2-B ligation fragments. Primers 1F / HYG-1R and HYG-1F / 4R were used to amplify the A-Hl and H2-B fragments, respectively, and the knockout fragment was purified to a concentration of 500 ng / μL.

[0036] 2, Preparation of D. segiticola protoplasts

[0037] 1) D. segiticola was inoculated into potato dextrose broth (PDB) and incubated at 25°C for 36 h. The mycelium was collected into a 2 mL centrifuge tube, and the mycelium was broken up using a grinder. The mycelium suspension was transferred to CM liquid medium and incubated at 25°C for 36 h. The fresh mycelium of D. segiticola was collected by filtration;

[0038] 2) 10 mL of 0.8 mol / L KCl solution was used as an osmotic stabilizer to prepare a mixed enzyme solution of Drislase, lysozyme and snailase. The enzyme solution was used to lyse 5 g of the mycelium suspension at 30°C and 100 rpm for 4 h;

[0039] 3) The filtrate was collected after filtration through 2-3 layers of sterilized lens paper (fiber mesh size 45 ± 12 μm) and rinsing with 0.8 mol / L KCl. The filtrate was centrifuged at 4000 rpm for 6 min at 4°C, and resuspended in 15 mL of 1.2 mol / L STC buffer solution.

[0040] 4) The supernatant was discarded, and the protoplasts were resuspended in 1 mL of STC buffer to prepare a protoplast suspension at a concentration of 1 x 10 7 protoplasts / mL. The suspension was stored on ice until use.

[0041] 3, Transformation of D. segiticola protoplasts ​

[0042] 1) Take 200 μL protoplast suspension into 50 mL centrifuge tube, add 10-20 μg A-H1 and H2-B knock-out transforming fragment, mix gently, and stand on ice for 20 min.

[0043] 2) Add 1.4 mL 40% polyethylene glycol 4000 buffer (PTC) in two times, mix gently, stand at room temperature for 20 min, add 5 mL TB3 liquid medium, mix gently, and cultivate at 25°C, 120 rpm for 12-16 h.

[0044] 3) Centrifuge at room temperature, 4000 rpm / min for 6 min, discard supernatant, and resuspend the remaining 1 mL with regenerated protoplasts.

[0045] 4) Add 50 mL warm TB3 regenerated solid medium, mix, and prepare a plate. After cultivation at 25°C for 24 h, cover with PDA medium containing 30 μg / mL hygromycin B, cultivate at 25°C for 2-4 d, until the transformants grow, and then subculture for 3 generations for selection.

[0046] 4. PCR verification of transformants

[0047] After subculturing for 3 generations on PDA medium containing hygromycin, ΔDsHAD transformants can be obtained. CTAB method is used to extract DNA from the transformant colonies, and PCR amplification is performed using primers to amplify fragment P1 using primer pair HYGF / HYGR to detect the hph gene, and to amplify the target gene to detect whether it is knocked out using primer pair 5F / 6R. The sequences of primers 5F and 6R (5' end to 3' end) are as follows:

[0048] 5F: CCGCTATGTACCCTTCGCAA

[0049] 6R: CACATGGTCTCGTCTGCACT

[0050] The gene knock-out fragment is introduced into D. segiticola protoplasts by homologous recombination to obtain hygromycin-positive transformants. The positive transformants are analyzed by PCR verification using hph gene-specific primers, and the results are shown in Figure 3 hph gene, occurrence of homologous recombination upstream, and occurrence of homologous recombination downstream are detected in the transformants, and the DsHAD gene is not amplified in the electrophoretogram, so the corresponding positive transformants are screened, i.e., ΔDsHAD knock-out mutants are obtained.

[0051] Example 2 Phenotype observation and stress resistance analysis of D. segiticola wild type and ΔDsHAD knock-out mutants

[0052] 1. Colony morphology observation and growth rate determination

[0053] Wild-type D. segeticola and knockout mutant ΔDsHAD were inoculated onto PDA medium and cultured at 25°C in the dark for 8 days. The colony diameter was then measured using the cross-cross method, and the colony morphology was observed. Each treatment was replicated in triplicate.

[0054] The colony morphology and growth rate of wild-type and knockout mutant ΔDsHAD of D. segeticola on PDA medium are as follows: Figure 4 and Figure 5 As shown, where, Figure 4 This is a diagram showing the growth of bacterial colonies. Figure 5 This is a statistical graph of colony growth rate, with the vertical axis representing colony diameter. The values ​​are based on the mean of three independent experiments, and data analysis was performed using Duncan's new multiple range method (p < 0.05). Figure 4 and 5 It can be seen that the colony morphology and growth rate of the D. segeticola knockout mutant ΔDsHAD on PDA medium were significantly lower than those of the wild type of D. segeticola, indicating that the ΔDsHAD gene affects the growth of D. segeticola.

[0055] 2. Determination of spore production and spore germination

[0056] Wild-type and knockout mutant ΔDsHAD of *D. segeticola* were inoculated onto oat medium (OA) and cultured in the dark at 25°C. After 14 days, the mycelia were rinsed with sterile water, and spores were collected through a sterile 3-4 layer filter. The supernatant was discarded by centrifugation, and the spores were resuspended in 0.1% Tween water. Spores were counted using a hemocytometer. Each treatment was replicated in triplicate. The spores were diluted to a concentration of 10⁻⁶. 5 Take 100 μL and spread it evenly on 1% water agar medium. After 14-16 h, count the germination.

[0057] The sporulation and spore germination results of wild-type and knockout mutant ΔDsHAD of *D. segeticola* on OA medium were obtained from... Figure 6 It can be seen that the sporulation and spore germination rate of the DsHAD gene knockout mutant ΔDsHAD of D. segeticola were significantly lower than those of the wild type, indicating that the pathogenicity, growth and reproductive capacity of D. segeticola were inhibited after the DsHAD gene was knocked out.

[0058] 3. Analysis of stress resistance

[0059] 1) Analysis of high osmotic pressure stress

[0060] D. segeticola wild type and knockout mutant ΔDsHAD were inoculated on PDA medium containing 1 mol / L KCl, 1.0 mol / L NaCl, and 1.0 mol / L sorbitol, respectively, and cultured in an inverted culture at 25°C for 8 days, and then the colony growth of the knockout mutant ΔDsHAD and the wild type strain was observed.

[0061] The colony diameters of all strains were measured (cross method) and photographed. The strain growth inhibition rate = (control strain colony diameter - treatment strain colony diameter) / control strain colony diameter * 100% was calculated.

[0062] 2) Oxidative stress analysis: D. segeticola wild type and knockout mutant ΔDsHAD were inoculated on PDA medium containing 20 mmol / L H2O2, respectively, and cultured in an inverted culture at 25°C for 8 days, and then the colony growth of the knockout mutant ΔDsHAD and the wild type was observed.

[0063] 3) Cell wall integrity analysis

[0064] D. segeticola wild type and knockout mutant ΔDsHAD were inoculated on PDA medium containing 200 μg / mL Congo red, respectively, and cultured in an inverted culture at 25°C for 8 days, and then the colony growth of the knockout mutant ΔDsHAD and the wild type strain was observed.

[0065] 4) Cell membrane integrity analysis

[0066] D. segeticola wild type and knockout mutant ΔDsHAD were inoculated on PDA medium containing 0.005% sodium dodecyl sulfate (SDS), respectively, and cultured in an inverted culture at 25°C for 8 days, and then the colony growth of the knockout mutant ΔDsHAD and the wild type strain was observed.

[0067] The growth of D. segeticola DsHAD gene knockout mutant ΔDsHAD and wild type under different stress conditions is shown in Figure 7 A-F are the growth of D. segeticola wild type strain on medium under different stress conditions; Figure 7G~L, growth of D. sego ticola mutant strain ΔDsHAD on the medium under different stress conditions; 1 mol / L KCl: containing 1 mol / L KCl in final concentration; 1 mol / L NaCl: containing 1 mol / L NaCl in final concentration; 0.005% SDS: containing 0.005% SDS in final concentration; 200 μg / mL Congo red: containing 200 μg / mL Congo red in final concentration; 20 mmol / L H2O2: containing 20 mmol / L H2O2 in final concentration; 1 mol / L sorbitol: containing 1 mol / L sorbitol in final concentration); the relative growth inhibition rate of the colonies of D. sego ticola under different stress conditions is shown in Figure 8 The vertical coordinate is the relative growth inhibition rate, and the numerical value is the mean value based on 3 independent experiments, and the data is analyzed by Duncan's new multiple range method (p<0.05). Figure 8 The relative growth inhibition rate of the colonies of the wild type and the knockout mutant under NaCl, KCl, sorbitol, H2O2, SDS and Congo red stress is shown from left to right. The data is analyzed by Duncan's new multiple range method (p<0.05). Figure 7 And Figure 8 It can be seen that the relative growth inhibition rate of the colonies of the knockout mutant ΔDsHAD in the medium containing 20 mmol / L H2O2 is significantly higher than that of the wild type, indicating that the knockout of the DsHAD gene improves the sensitivity to H2O2. In summary, the knockout of the DsHAD gene significantly reduces the tolerance to oxidative stress.

[0068] Example 3 Pathogenicity analysis of D. sego ticola knockout mutant

[0069] The wild type and knockout mutant ΔDsHAD of D. sego ticola were inoculated on PDA medium and cultured in an incubator at 25°C for 7 days. A sterile puncher with a diameter of 4 mm was used to take several pieces of the colony at the edge of the colony, and the pieces were inoculated on the surface of tea leaves. The tea leaves were investigated for disease after 3 days.

[0070] The results of the pathogenicity test of the DsHAD gene knockout mutant ΔDsHAD of D. sego ticola on tea leaves are shown in Figure 9 , wherein, Figure 9 A is the lesion map of D. sego ticola wild type strain and mutant strain ΔDsHAD inoculated on tea leaves for 3 days; Figure 9 B is a graph of the lesion area measurement results of D. sego ticola wild type strain and mutant strain ΔDsHAD inoculated on tea leaves for 3 days. The vertical coordinate is the lesion area measurement, and the numerical value is the mean value based on 20 independent experiments, and the data is analyzed by Duncan's new multiple range method (p<0.05).Figure 9 It can be known that the lesion area of the knockout mutant ADsHAD on the tea leaves is greatly reduced compared with the wild type, which indicates that the pathogenicity of D. segeticola is inhibited after the DsHAD gene is knocked out.

[0071] It can be known that the DsHAD gene provided by the present application can be used for the prevention and treatment of diseases caused by D. segeticola, and can be used as a target for a medicine for plant disease prevention and treatment. Those skilled in the art can follow the present specification to develop a fungicide for preventing and treating plant diseases, in particular, diseases caused by D. segeticola.

[0072] The conventional techniques and schemes not described in detail in the above examples are well known in the art, and thus will not be described in detail herein. The above examples and / or experimental examples describe the preferred embodiments of the present application in detail, however, the present application is not limited to the specific details in the above embodiments, and various simple modifications can be made to the technical solutions of the present application within the technical concept of the present application, and these simple modifications all belong to the protection scope of the present application.

Claims

1. Reducing DsHAD protein expression in reducing Didymella segeticola Its application in pathogenicity and / or growth rate and / or reproductive capacity and / or resistance to adverse conditions is characterized by, The DsHAD protein is a protein with an amino acid sequence as shown in sequence SEQ ID NO. 2 or a fusion protein with a tag linked to the N-terminus and / or C-terminus of the protein as shown in sequence SEQ ID NO.

2.

2. Use of a biological material associated with the reduction of the expression of a DsHAD protein as described in claim 1, for reducing the pathogenicity and / or growth rate and / or reproductive capacity and / or stress resistance of a microorganism. D. segeticola The biological material is a nucleic acid molecule encoding a DsHAD protein or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule. ​ 3. Use according to claim 2, wherein the compound is ###0002### The nucleotide sequence of the nucleic acid molecule is as shown in sequence SEQ ID NO.

1.

4. Use of a DsHAD protein as described in claim 1 as a target in the design and screening of anti-infective drugs. D. segeticola pharmaceutical composition for use according to claim 3, characterized in that The anti D. segeticola The drug is to reduce the expression of DsHAD protein.

5. Use of a biological material which reduces the expression of a DsHAD protein as defined in claim 1 or which reduces the expression of a DsHAD protein associated with a reduced pathogenicity and / or a reduced growth rate and / or a reduced reproductive capacity or a reduced stress tolerance in a transgenic organism according to claim 2 or 3. D. segeticola 5. Use of a biological material which reduces the expression of a DsHAD protein as defined in claim 1 or which reduces the expression of a DsHAD protein associated with a reduced pathogenicity and / or a reduced growth rate and / or a reduced reproductive capacity or a reduced stress tolerance in a transgenic organism according to claim 2 or 3.​ 6. A method for breeding a transgenic plant having reduced pathogenicity and / or reduced growth rate and / or reduced reproductive capacity and / or reduced stress tolerance, characterized in that, D. segeticola including reducing the expression and / or activity of a DsHAD protein in a recipient D. segeticola of claim 1, resulting in a transgenic D. segeticola plant. ​ 7. The method of claim 6, wherein, said method of reducing the expression and / or activity of a DsHAD protein in a cell as defined in claim 1 is achieved by knocking out or inhibiting or silencing the expression of the gene encoding the DsHAD protein in said cell. D. segeticola said method of reducing the expression and / or activity of a DsHAD protein in a cell as defined in claim 1 is achieved by knocking out or inhibiting or silencing the expression of the gene encoding the DsHAD protein in said cell. D. segeticola said method of reducing the expression and / or activity of a DsHAD protein in a cell as defined in claim 1 is achieved by knocking out or inhibiting or silencing the expression of the 8. The method of claim 7, wherein, The method for knocking out is a method using homologous recombination.

9. The method of claim 8, wherein, The method using homologous recombination is to introduce a homologous recombination fragment for performing homologous recombination into a protoplast of a recipient D. segeticola .

10. The use of a method according to any one of claims 6 to 9 for the control of diseases caused by D. segeticola Xanthomonas campestris.

Images