Homologous independent targeted integration for gene editing

Abstract

The present invention relates to a method of integrating an exogenous DNA sequence into the genome of a cell, preferably homologous independent targeted integration (HITI), comprising contacting the cell with: a donor nucleic acid comprising the exogenous DNA sequence, optionally one or more albumin exons wherein the donor nucleic acid flanks a reverse targeting sequence at 5'and 3 '; a complementary strand oligonucleotide homologous to a targeting sequence and a nuclease that recognizes the targeting sequence, wherein the targeting sequence is located at the 3'end of the albumin gene in a region selected from the intron 12, intron 13 and intron 14 of the albumin gene. The invention also relates to systems, vectors and pharmaceutical compositions comprising said donor nucleic acid and / or a complementary strand oligonucleotide and / or nuclease homologous to a targeting sequence and to medical uses thereof.

Description

Technical Field

[0001] This invention relates to a method for integrating a foreign DNA sequence into the genome of a cell, comprising contacting the cell with a donor nucleic acid, a complementary oligonucleotide homologous to a target sequence, and a nuclease that recognizes the target sequence. The invention also relates to constructs, vectors, systems, and pharmaceutical compositions comprising said donor nucleic acid and / or complementary oligonucleotides and / or nucleases homologous to the target sequence, and their medical uses. Background of the Invention

[0003] In recent years, genome editing has become a viable option for treating hereditary diseases. Genome editing uses endonucleases, typically CRISPR / Cas9 [1,2]. CRISPR-Cas9 is a ribonucleoprotein that binds to a sequence called guide RNA (gRNA) and uses it to recognize a target DNA sequence via Watson-Crick base complementarity. This target DNA sequence must be adjacent to a pre-intermediate neighbor motif (PAM) sequence, which allows Cas9 to bind to the DNA and cleave the target sequence [3]. Cas9’s RNA-based targeting facilitates the design of targeting different loci and even allows targeting two different sequences by delivering Cas9 and two different gRNAs to the same cell. Once Cas9 is targeted to a specific location in the genome, it produces a double-strand break (DSB), which is repaired through one of two repair mechanisms:

[0004] Non-homologous end joining (NHEJ) is the most prevalent mechanism in most cell types because it is active at all stages of the cell cycle and consists of the insertion or deletion of random bases at the DSB site to repair the DSB. Such random insertions or deletions (INDELs) usually result in changes to the reading frame, thereby knocking out the expression of the targeted gene [3].

[0005] Homologous targeted repair (HDR) is a process that occurs primarily during the G and S2 phases of the cell cycle and uses a homologous template, which can be provided by an external donor DNA or by other alleles, for precise correction of DSB [3]. Gene correction via HDR has been successfully used in vitro [4] and in vivo [5-8], even in the absence of Cas9 [6]. However, its efficiency in vivo is limited by the low activity of the homologous recombination pathway in differentiated cells [9]. Therefore, there is a need in the art for alternative therapeutic gene replacement strategies that can perform gene correction in tissues and differentiated cells that have not undergone active regeneration.

[0006] Homology-Independent Targeted Integration (HITI) [10,11] has recently been developed to overcome the limitations of both allele-specific knockout and HDR gene correction. HITI uses donor DNA flanked by the same gRNA target sequence within the gene of interest. After Cas9 cleaves both the gene and the donor DNA, the cell’s NHEJ mechanism can include the donor DNA in the repair of the cleavage with surprisingly high (60%–80%) integration rates in the absence of insertions / deletions. Potential reverse integration of the donor DNA is avoided by reversing its gRNA target sequence, so that if reverse integration occurs, Cas9 can recognize and cleave the target sequence again. Because HITI uses NHEJ, it is effective in terminally differentiated cells (such as neurons) or tissues (such as the liver) independent of their regenerative potential (e.g., in both adult and pediatric tissues)

[11] . Furthermore, HITI-mediated insertion of wild-type copies of therapeutic genes has therapeutic potential independent of specific pathogenic mutations and the potential proliferative state of the target cells

[11] .

[0007] The inventors have previously discovered that HITI can be used to convert the liver in a factory to release high levels of therapeutic proteins systemically, which is desirable for the treatment of many genetic and common conditions caused by loss of function, or conditions in which the factor to be replaced is secreted from the liver and / or must reach other target organs via the bloodstream to perform its function, such as in hemophilia, LSD, or diabetes, overcoming the limitations of currently available therapies such as inefficient enzyme replacement therapy, conventional gene therapy, and gene editing.

[0008] Adeno-associated virus (AAV)-based vectors are the most commonly used for in vivo gene therapy because they have a broad safety profile, wide tropism, and the ability to provide long-term transgene expression

[12] . However, given the episomal status of the AAV genome, liver transgene expression from AAV may be lost over time in developing livers or due to liver damage

[13] , resulting in limited success, for example in pediatric patients.

[0009] Therefore, there is a need for more stable and efficient liver transgene expression.

[0010] The inventors have developed HITI, which overcomes the aforementioned limitations [5-8] by inserting the coding sequence of the secreted protein of interest into a highly transcribed albumin locus, providing long-term expression of high levels of systemic secreted proteins while preserving endogenous albumin expression.

[0011] Mucopolysaccharidosis type VI (MPS VI) is a rare lysosomal storage disease (LSD) caused by a deficiency of arylsulfatase B (ARSB), resulting in the widespread accumulation and urinary excretion of toxic glycosaminoglycans (GAGs). Clinically, the MPS VI phenotype is characterized by growth retardation, coarse facial features, skeletal deformities, joint stiffness, corneal opacity, thickened heart valves, and organ hypertrophy, without primary cognitive impairment

[14] . Treatment of MPS depends on the secretion of normal lysosomal hydrolases, which are then taken up by most cells via the mannose-6-phosphate receptor pathway.

[0012] The inventors previously demonstrated that a single systemic administration of recombinant AAV vector serotype 8 (AAV2 / 8), which encodes ARSB (AAV2 / 8.TBG.hARSB) under the transcriptional control of the liver-specific thyroxine-binding globulin (TBG) promoter, resulted in sustained liver transduction and phenotypic improvement in an MPSVI animal model [15-21]. The inventors also demonstrated that this was at least as effective in MPSVI mice as weekly administration of enzyme replacement therapy (ERT), the current standard of care for this condition [22-24]. The inventors recently initiated a Phase I / II clinical trial (ClinicalTrials.gov Identifier: NCT03173521) to test both the safety and efficacy of this method in MPSVI patients.

[0013] Hemophilia A (HemA) is a serious bleeding disorder caused by a lack or complete absence of the activity of clotting factors VIII or 8 (FVIII or F8). It is the most common inherited X-linked recessive clotting disorder, with a global incidence of approximately 1 in 5,000 live male infants.

[0014] Approximately 50% of HemA cases are severe, i.e., with circulating FVIII levels of less than 1%

[25] . Severe forms of HemA are clinically characterized by spontaneous musculoskeletal and soft tissue bleeding, and inability to stop bleeding after trauma unless a concentrated clotting factor is infused. Current treatment is prophylactic administration of recombinant or plasma-derived clotting FVIII. Infusions are frequently required (twice or three times a week) and can be cumbersome. Furthermore, they do not prevent spontaneous bleeding and there is always a high risk of developing neutralizing anti-FVIII antibodies (inhibitors) (in approximately 25%–30% of patients). Therefore, gene therapy holds promise as an alternative therapy for achieving a single-dose, lifelong cure.

[0015] Over the past 20 years, the application of HemA gene therapy has been extensively studied, revealing that even modest improvements in FVIII levels (1%–2%) can significantly reduce the risk of spontaneous bleeding events and decrease the need for FVIII replacement infusions. Furthermore, gene therapy offers a broad therapeutic scope, where gene expression does not require strict regulation and has easily quantifiable therapeutic endpoints (FVIII plasma levels). Several gene transfer strategies for FVIII replacement have been evaluated, and adeno-associated virus (AAV) vectors are emerging as the most promising due to their excellent safety profile and ability to guide long-term transgene expression in post-mitotic tissues such as the liver. However, HemA presents significant challenges for AAV gene therapy because the size (7kb) of the F8 gene coding sequence to be transferred exceeds the standard AAV's 4.7kb carrying capacity. Previously, a 5kb expression cassette containing a B-domain deletion (BDD) F8 transgene, along with a short liver-specific promoter and polyadenylation signaling, had been packaged into AAV5 and shown to induce therapeutic levels of FVIII in mice and cynomolgus monkeys

[26] and HemA patients

[27] . However, the genome of this vector is slightly large and is packaged in an AAV capsid as a library of heterogeneous truncated genomes, resulting in ineffective transduction after recombination in target cells. The ultra-large AAV vector is less efficient than normal-sized AAV vectors, and the quality of such products with heterogeneous truncated genomes may hinder their further development. All AAV-based products in clinical trials consist of a ~4.4kb B-domain deletion (BDD) version of the F8 transgene

[28] . However, such a large transgene leaves limited space in the vector for the desired regulatory elements, thus limiting the selection of promoters and polyadenylation signals. Furthermore, all of these vector genomes are on the edge of AAV's normal carrying capacity and are at risk of being improperly packaged into libraries of heterogeneous truncated genomes. Although these ultra-large vectors can successfully express large proteins, their long-term efficiency and safety remain to be confirmed [28-32].

[0016] HITI at a highly transcribed albumin locus in hepatocytes has the potential to overcome several limitations of other safe and effective liver gene therapies using AAV, including: i. its particularly high transgene expression level from the albumin locus; ii. the stability of transgene expression is ensured by inserting a therapeutic coding sequence at the genomic locus, which will be replicated even in the event of hepatocyte loss and in the developing liver, thus enabling the therapy to be used in pediatric patients.

[0017] A previous method for integrating exogenous DNA sequences into the genome of a cell based on HITI is disclosed in WO2020079033, which specifically targets the second exon of the albumin gene. In this method, the targeted albumin gene locus is disrupted by inserting donor DNA carrying the transgene of interest.

[0018] There remains a need for gene therapy strategies for diseases requiring stable systemic expression of therapeutic proteins. Invention Overview

[0020] The inventors have now discovered a novel method for integrating exogenous DNA sequences into the genome of cells without disrupting their expression using the HITI system that targets the albumin gene. Evidence of efficacy has been provided in MPS VI mice using ARSB encoding arylsulfatase B (a lysosomal enzyme lacking in mucopolysaccharidosis VI (MPS VI)) and in hemophilia mice using the F8 CodopV3 transgene encoding factor VIII missing in hemophilia A.

[0021] The inventors have now discovered that integration of transgenes (such as ARSB or F8) at the 3' end of mouse albumin (mAlb) via a novel HITI system leads to increased levels and / or activity of lost enzymes. Specifically, ARSB integration resulted in circulating supraphysiological levels of the enzyme at two test doses, while one dose induced lower levels of the circulating enzyme, and phenotypic improvement in newborn MPS VI mice up to 36 weeks post-delivery, while F8 activity levels were increased by 20% in hemophilia mice treated with the system of the present invention compared to unaffected controls. The inventors have also demonstrated the in vitro integration of reporter genes into the 3' end of human albumin (hALB).

[0022] Overall, the novel HITI resulted in stable, high expression levels of the therapeutic transgene from the liver as hepatocytes proliferated.

[0023] This invention relies on inserting a sequence of interest into a locus of a gene (i.e., albumin) that is highly expressed in the liver. Despite originating from a relatively small number of cells within the liver parenchyma, the gene of interest is expressed under the albumin promoter, resulting in high-level expression of the gene of interest, thus sufficiently high to achieve a therapeutic effect. Furthermore, because the gene of interest is stably integrated into the liver genome, its expression is not lost during tissue regeneration (in children or during liver injury). The albumin locus is targeted using a strategy that allows for the preservation of albumin gene expression.

[0024] One object of the present invention is a method for integrating a foreign DNA sequence into the genome of a cell, the method comprising contacting the cell with:

[0025] a) Donor nucleic acid, including:

[0026] -The exogenous DNA sequence

[0027] -Optional one or more albumin exons

[0028] The donor nucleic acid is attached to the reverse target sequence on the 5' and 3' sides;

[0029] b) Complementary oligonucleotides homologous to the target sequence, and

[0030] c) Nucleases that recognize the target sequence.

[0031] The target sequence is located at the 3' end of the albumin gene in a region selected from introns 9, 11, 12, 13, and 14 of the albumin gene.

[0032] In this invention, the donor nucleic acid preferably contains one or more albumin exons, and the exons are exon 10 and / or exon 11 and / or exon 12 and / or exon 13 and / or exon 14 or fragments thereof.

[0033] Another object of the present invention is a method for integrating a foreign DNA sequence into the genome of a cell, the method comprising contacting the cell with:

[0034] a) Donor nucleic acid, including:

[0035] -The exogenous DNA sequence

[0036] -Optional one or more albumin exons

[0037] The donor nucleic acid is attached to the reverse target sequence on the 5' and 3' sides;

[0038] b) Complementary oligonucleotides homologous to the target sequence, and

[0039] c) Nucleases that recognize the target sequence.

[0040] The target sequence is located at the 3' end of the albumin gene in a region selected from introns 12, 13, and 14 of the albumin gene.

[0041] In this invention, the donor nucleic acid preferably contains one or more albumin exons, and the exons are exon 13 and / or exon 14 or fragments thereof.

[0042] In a preferred embodiment, the albumin exon is present, and it is (they are) exon 10 and / or exon 11 and / or exon 12 and / or exon 13 and / or exon 14 or fragments thereof. Preferably, it is located at the 5' end of the foreign DNA sequence and is separated from the foreign DNA sequence by a ribosomal skip sequence.

[0043] In a preferred embodiment, the albumin exon is present, and it is exon 13 and / or exon 14 or a fragment thereof. Preferably, it is located at the 5' end of the foreign DNA sequence and can be separated from the foreign DNA sequence by a ribosomal skip sequence. In this invention, the donor nucleic acid preferably comprises one or more albumin exons, and the exons are exon 10 and / or exon 11 and / or exon 12 and / or exon 13 and / or exon 14 or fragments thereof.

[0044] In this invention, the donor nucleic acid preferably contains one or more albumin exons, and the exons are exon 13 and / or exon 14 or fragments thereof.

[0045] The albumin exons can be derived from albumin genes of any origin, preferably from human or mouse albumin genes.

[0046] Preferably, the complementary oligonucleotide homologous to the target sequence is a guide RNA that hybridizes with the target sequence or its complementary strand located in introns 9, 11, 12, 13 or 14 of the albumin gene, and preferably the guide RNA is adjacent to the preintermediate adjacent motif (PAM) sequence.

[0047] Preferably, the complementary oligonucleotide homologous to the target sequence is a guide RNA that hybridizes to the target sequence or its complementary strand located in intron 12, intron 13 or intron 14 of the albumin gene, and preferably the guide RNA is adjacent to the preintermediate adjacent motif (PAM) sequence.

[0048] Preferably, the target sequence is a guide RNA (gRNA) target site, and the complementary oligonucleotide homologous to the target sequence is the guide RNA, which hybridizes with the target sequence or its complementary strand located in intron 12, intron 13, or intron 14. Therefore, the oligonucleotide guides the nuclease to cleave the albumin gene in intron 12, 13, or 14. Preferably, the guide RNA is adjacent to a preintermediate adjacent motif (PAM) sequence.

[0049] Preferably, the target sequence is a guide RNA (gRNA) target site, and the complementary oligonucleotide homologous to the target sequence is the guide RNA, which hybridizes with the target sequence or its complementary strand located in intron 9, intron 11, intron 12, intron 13, or intron 14. Therefore, the oligonucleotide guides the nuclease to cleave the albumin gene in intron 9, intron 11, intron 12, intron 13, or intron 14. Preferably, the guide RNA is adjacent to the preinterstitial adjacent motif (PAM) sequence.

[0050] In the context of this invention, the albumin gene is preferably a human gene or a mouse gene.

[0051] Preferably, the target sequence comprises a sequence or fragment thereof of any one of SEQ ID NO:1-2, 9-18, 54, 92-98, or a sequence having at least 95% identity with any one of SEQ ID NO:1-2, 9-18, 54, 92-98, or a fragment thereof, and / or the complementary oligonucleotide homologous to the target sequence comprises a sequence or fragment thereof of any one of SEQ ID NO:1-2, 9-18, 54, 92-98, or a sequence having at least 95% identity with any one of SEQ ID NO:1-2, 9-18, 54, 92-98, or a fragment thereof.

[0052] In this embodiment, the guide RNA containing SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:54, 92-98 or fragments thereof, or having at least 95% identity with SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:54, 92-98 or fragments thereof, can be associated with guide RNA containing SEQ ID NO:1, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or SEQ ID NO:18 or fragments thereof, or having at least 95% identity with ...8 or fragments thereof, or having at least 95% identity with SEQ ID NO:1, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:18 or fragments thereof, or having at least 95% identity with SEQ ID NO:1, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17 or SEQ ID The target sequence NO:17 or SEQ ID NO:18 or a fragment thereof has at least 95% identity with the target sequence, or binds to the complementary strand of these sequences.

[0053] In this embodiment, the guide RNA containing SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17 or 18 or fragments thereof, or having at least 95% identity with SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17 or 18 or fragments thereof, can bind to target sequences containing SEQ ID NO:1, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13 or SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or 18 or fragments thereof, or having at least 95% identity with SEQ ID NO:1, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13 or SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or 18 or fragments thereof, or to the complementary strand of these sequences.

[0054] Preferably, the fragment is at least 15 nucleotides long.

[0055] In one implementation, the target sequence and the corresponding gRNA are described in Tables 1 and 3.

[0056] The present invention also includes embodiments in which the above sequences, namely SEQ ID NO:1, 2, 9-18, 54, 92-98, have a reverse orientation, namely from 3' to 5'.

[0057] The present invention also includes embodiments in which the above sequences, namely SEQ ID NO:1, 2, 9-18, 54, 92-98, are RNA.

[0058] The gRNA mentioned is also an objective of this invention.

[0059] Another object of the present invention is to isolate guide ribonucleic acid (gRNA) comprising or consisting of the following: a sequence substantially complementary to or fully annealed to a sequence selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or SEQ ID NO:18, 54, 92-98 and a portion thereof at least 15 nucleotides in length.

[0060] Preferably, the albumin gene is derived from humans or mice.

[0061] The albumin gene introns can be in albumin genes from any source, preferably in human or mouse albumin genes.

[0062] In one implementation, the complementary oligonucleotide homologous to the target sequence is controlled by a promoter, preferably the U6 promoter.

[0063] In this invention, guide RNA or gRNA can be used as a synonym for complementary oligonucleotides homologous to the target sequence.

[0064] In a preferred embodiment, the exogenous DNA sequence is the coding sequence of the arylsulfatase B (ARSB) gene. Preferably, the ARSB coding sequence is human. Preferably, it comprises the sequence of SEQ ID NO:33 or a sequence having at least 95% identity with SEQ ID NO:33. The coding sequence may encode variants of arylsulfatase B (ARSB), for example, it may contain additions, deletions, or substitutions relative to the coding sequence of the wild-type arylsulfatase B (ARSB) gene, as long as these protein variants retain substantially the same relevant functional activity as the original ARSB. The coding sequence may also encode fragments of arylsulfatase B (ARSB), as long as the fragment retains substantially the same relevant functional activity as the original ARSB.

[0065] Appropriately, the encoded sequence can be codon-optimized for expression in humans.

[0066] In another preferred embodiment, the exogenous DNA sequence is the coding sequence of the factor 8 (F8) gene or the B-domain deletion (BDD) F8 gene. Preferably, the BDD F8 coding sequence is human, more preferably, it comprises the sequence of SEQ ID NO:36 or 55 or has substantially at least 95% identity with SEQ ID NO:36 or 55. Preferably, the F8 coding sequence comprises the sequence of SEQ ID NO:36 or 55 or has substantially at least 95% identity with SEQ ID NO:36 or 55. The coding sequence may encode BDD F8 or variants of F8, for example, it may contain additions, deletions, or substitutions relative to the coding sequence of the wild-type BDD F8 gene or the wild-type F8 gene, as long as these protein variants retain substantially the same relevant functional activity as the original BDD F8 or F8, respectively. The coding sequence may also encode fragments of BDD F8 or F8, as long as the fragment retains substantially the same relevant functional activity as the original BDD F8 or F8, respectively.

[0067] In another preferred embodiment, the exogenous DNA sequence is the coding sequence of a gene associated with a loss-of-function mutation in patients with recessive genetic diseases. Therefore, the liver can be used as a therapeutic target.

[0068] In another preferred embodiment, the exogenous DNA sequence is the coding sequence of one or more F9 genes mutated in α1-antitrypsin (AAT) deficiency, Wilson's disease, OAT deficiency, and MPSVII.

[0069] In the context of this invention, the reverse targeting sequences are located upstream and downstream of the donor nucleic acid, which is a DNA construct that is cleaved and then integrated into the target locus. The reverse targeting sequence is an identical sequence that recognizes the guide RNA at the target genomic locus, i.e., the target sequence, but is reversed or inverted relative to the genomic sequence. Reverse or inverted means that if the target sequence has a specific 5'-3' sequence, the reverse targeting sequence has the same sequence but with a 3'-5' orientation. Therefore, the reverse targeting sequence is complementary to but inverted with the guide RNA. This allows for unidirectional integration, as known in the HITI method. In short, in the case of donor DNA integration in the opposite orientation, a nuclease (such as Cas9) will be able to recognize its target site again and cleave it. After integration in the correct orientation, the nuclease will no longer be able to cleave the target site. The reverse targeting sequence is preferably the reverse of the target sequence relative to a region selected from introns 9, 11, 12, 13, and 14 located at the 3' end of the albumin gene. Preferably, each of the reverse targeting sequences is linked at its 3' position to a pre-interstitial adjacent motif (PAM) sequence.

[0070] The exogenous DNA sequence may also include a reporter gene, preferably selected from at least one of DiscosomaRed, green fluorescent protein (GFP), red fluorescent protein (RFP), luciferase, β-galactosidase, and β-glucuronidase.

[0071] In one embodiment, the donor nucleic acid further comprises one or more of the following:

[0072] - Posttranscriptional regulatory elements, preferably located at the 3' end of the exogenous DNA sequence;

[0073] - A transcription termination sequence, preferably located at the 3' end of a post-transcriptional regulatory element or the 3' end of a foreign DNA sequence;

[0074] - The splice acceptor sequence, preferably located at the 3' end of the donor nucleic acid, for example linked to an albumin exon, if the albumin exon is present;

[0075] - Ribosome jumping sequence, preferably located between the exogenous DNA sequence and the albumin exon.

[0076] In one embodiment, the donor nucleic acid further comprises one or more of the following:

[0077] - The splice acceptor sequence is preferably located at the 5' end of the donor nucleic acid, for example, it is linked to an albumin exon, if the albumin exon is present;

[0078] - Ribosome skipping sequence, preferably located between albumin exons and foreign DNA sequences;

[0079] - Posttranscriptional regulatory elements, preferably located at the 3' end of the exogenous DNA sequence;

[0080] - A transcription termination sequence, preferably located at the 3' end of a post-transcriptional regulatory element or the 3' end of a foreign DNA sequence.

[0081] Preferably, the ribosome jumping sequence is T2A, P2A, E2A, or F2A, with T2A being the most preferred. When expressed in cells, this sequence allows the protein of interest to be separated from albumin.

[0082] Preferably, the post-transcriptional regulatory element is a marmot hepatitis virus post-transcriptional regulatory element (WPRE).

[0083] Preferably, the transcription termination sequence is a polyadenylation signal sequence, more preferably bovine growth hormone polyadenylate (BGH polyA), and most preferably a short synthetic polyadenylate.

[0084] As described above, the donor DNA sequence is attached to the same but reversed gRNA target sites (e.g., reversed target sites) recognized by the gRNA at the 5' and 3' sides.

[0085] Preferably, the target sequence comprises one of the sequences mentioned herein or a functional fragment thereof, or a sequence having at least 95% identity with one of the sequences mentioned herein or a functional fragment thereof, and / or the complementary oligonucleotide homologous to the target sequence comprises one of the sequences mentioned herein or a functional fragment thereof, or a sequence having at least 95% identity with one of the sequences mentioned herein or a functional fragment thereof.

[0086] Preferably, the reverse targeting sequence comprises or substantially has at least 95% identity with the following sequences: SEQ ID NO:20, 54 or 77, or SEQ ID NO:2 or 1, or any one of SEQ ID NO:9-18, 92-98 or 54.

[0087] Preferably, the donor nucleic acid comprises:

[0088] - The reverse target sequence and its adjacent motif (PAM) sequence in the pre-interstitial region;

[0089] - Clipping acceptor sequence

[0090] - One or more albumin exons, preferably selected from one or more exons of exons 13 and 14;

[0091] - Ribosomal skipping sequence, preferably T2A;

[0092] -Exogenous DNA sequence, preferably the coding sequence of the marker dsRed, the human ARSB gene, or the BDD F8 gene;

[0093] - Transcription termination sequence; and

[0094] - Additional reverse targeting sequences and their adjacent pre-interstitial motif (PAM) sequences.

[0095] Preferably, the donor nucleic acid comprises:

[0096] - The reverse target sequence and its adjacent motif (PAM) sequence in the pre-interstitial region;

[0097] - Clipping acceptor sequence

[0098] - One or more albumin exons, preferably selected from one or more exons of exon 10, exon 11, exon 12, exon 13 and exon 14;

[0099] - Ribosomal skipping sequence, preferably T2A;

[0100] -Exogenous DNA sequence, preferably the coding sequence of the marker dsRed, the human ARSB gene, or the BDD F8 gene;

[0101] - Transcription termination sequence; and

[0102] - Additional reverse targeting sequences and their adjacent pre-interstitial motif (PAM) sequences.

[0103] Preferably, the elements are arranged in the listed 5'-3' order, but other orders are equally suitable.

[0104] Preferably, the transcription termination sequence comprises or substantially has at least 95% identity with the following sequences: SEQ ID NO:26 or SEQ ID NO:37 or SEQ ID NO:48 or SEQ ID NO:65.

[0105] Preferably, the ribosomal skipping sequence comprises or substantially has at least 95% identity with the following sequence: SEQ ID NO:23 or 63.

[0106] Preferably, the albumin exon contains the following or substantially has a sequence having at least 95% identity with the following: SEQ ID NO:22 and / or 78 and / or 79.

[0107] Preferably, the splice acceptor sequence comprises or substantially has at least 95% identity with the following sequence: SEQ ID NO:21.

[0108] Preferably, the reverse targeting sequence comprises or substantially has at least 95% identity with the following sequences: SEQ ID NO: 1 or 2 or 20 or 54 or 77, and preferably does not contain a PAM sequence.

[0109] The nuclease may be provided as a protein or as a nucleic acid encoding the nuclease. The nucleic acid may be DNA or RNA; for example, it may be the mRNA of the nuclease, or it may be the cDNA or DNA coding sequence of the nuclease or a DNA construct encoding the nuclease.

[0110] Preferably, the nucleic acid encoding the nuclease is a DNA construct containing a nucleic acid encoding Cas9 or spCas9, which is preferably controlled by a tissue-specific promoter (e.g., a liver-specific promoter, such as a hybrid liver promoter (HLP)). The construct may also contain a polyadenylate, conveniently a short synthetic polyadenylate (synt.polyA). All these elements are well known in the art and can have conventional nucleotide sequences. Exemplary DNA constructs encoding nucleases contain the following or substantially have sequences having at least 95% identity with the following: SEQ ID NO: 43, 47, or 52.

[0111] The nuclease is preferably selected from: CRISPR nuclease, TALEN, DNA-guided nuclease, mega-nuclease, and zinc finger nuclease. Preferably, the nuclease is a CRISPR nuclease selected from the group consisting of: Cas9, Cpf1, Cas12b (C2c1), Cas13a (C2c2), Cas3, Csf1, Cas13b (C2c6), and C2c3 or variants thereof, such as SaCas9, VQR-Cas9-HF1, or dCas9.

[0112] Preferably, the cell is in contact with the nucleic acid encoding the nuclease, and preferably the nucleic acid encoding the nuclease is controlled by a tissue-specific promoter (e.g., a liver-specific heterozygous liver promoter (HLP)).

[0113] Preferably, the nucleic acid encoding the nuclease is controlled by a tissue-specific promoter, most preferably a liver-specific promoter, such as a hepatocyte-specific promoter, such as a liver-specific heterozygous liver promoter (HLP).

[0114] Suitablely, the donor nucleic acid, the complementary oligonucleotide homologous to the target sequence, and the nucleic acid encoding the nuclease are included in a DNA construct. Preferably, a first DNA construct includes a donor nucleic acid and a complementary oligonucleotide homologous to the target sequence, and a second DNA construct includes a nucleic acid encoding a nuclease that recognizes the target sequence. Alternatively, a first DNA construct includes a donor nucleic acid, and a second DNA construct includes a complementary oligonucleotide homologous to the target sequence and a nucleic acid encoding a nuclease that recognizes the target sequence. As another alternative, three constructs are provided: a first construct including a donor nucleic acid, a second construct including a complementary oligonucleotide homologous to the target sequence, and a third construct including a nucleic acid encoding a nuclease that recognizes the target sequence.

[0115] The aforementioned construct is also the subject of this invention.

[0116] Preferably, one or more of the DNA constructs are contained in a vector, preferably a viral vector, and even more preferably a lentiviral vector or an adeno-associated virus vector. Alternatively, all or some of the DNA constructs may be inserted into a non-viral vector, wherein the non-viral vector is selected from polymer-based, particle-based, lipid-based, peptide-based delivery media or combinations thereof, such as cationic polymers, micelles, liposomes, exogenous bodies, microparticles, and nanoparticles including lipid nanoparticles (LNPs).

[0117] The carrier is also the subject of this invention.

[0118] The complementary oligonucleotide, the donor nucleic acid, and the nucleic acid encoding the nuclease can be contained in one or more viral or non-viral vectors, preferably the viral vectors are selected from adeno-associated virus, lentivirus, retrovirus, and adenovirus. This means they can be in the same or different vectors. Preferably, the cells are selected from the group consisting of: liver cells, lymphocytes, monocytes, neutrophils, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, osteocytes, platelets, adipocytes, cardiomyocytes, neurons, retinal cells, smooth muscle cells, skeletal muscle cells, spermatocytes, oocytes, and pancreatic cells, induced pluripotent stem cells (iPS cells), stem cells, hematopoietic stem cells, and hematopoietic progenitor stem cells, preferably, the cells are liver cells of the subject. Another object of the present invention is the cells obtainable by the above method.

[0119] The cells can be used as a drug or for use in the treatment of genetic diseases or in the treatment of recessive and common diseases, preferably including diabetes, lysosomal storage diseases including mucopolysaccharidosis (MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVI, MPSVII), sphingolipid storage diseases (Fabry's Disease, Gaucher Disease, Nieman-Pick Disease, GM1 ganglioside storage disease), lipofuscin storage diseases (Batten's Disese, etc.) and mucolipid storage diseases; choroidal and retinal gyral atrophy, adenosine monosuccinate deficiency, hemophilia A and B, ALA dehydratase deficiency, and adrenoleukodystrophy.

[0120] The cells of the present invention can be used in the treatment of diseases in which both mutant and wild-type alleles are replaced by the correct copy of the gene provided by donor DNA, or for the treatment of recessive and common diseases caused by loss of function, preferably selected from: hemophilia; diabetes; lysosomal storage diseases, including mucopolysaccharidosis, such as MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVI, and MPSVII; sphingolipid storage diseases, such as Fabry disease, Gaucher disease, Niemann-Pick disease, and GM1 ganglioside storage diseases; lipofuscin storage diseases, such as Barton's disease, and mucolipid storage diseases; choroidal and retinal gyral atrophy, adenosine monosuccinate deficiency, hemophilia A and B, ALA dehydratase deficiency, and adrenoleukodystrophy.

[0121] Therefore, the cells of the present invention can be used to treat: hemophilia; diabetes; lysosomal storage diseases, including mucopolysaccharidosis such as MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVI, and MPSVII; sphingolipid storage diseases such as Fabry disease, Gaucher disease, Niemann-Pick disease, and GM1 ganglioside storage diseases; lipofuscin storage diseases such as Barton's disease; and mucolipid storage diseases; gyral atrophy of the choroid and retina; adenosine monosuccinate deficiency; hemophilia A and B; ALA dehydratase deficiency; or adrenoleukodystrophy.

[0122] Cells obtained according to the present invention express exogenous DNA sequences. Suitably, cells obtained according to the present invention also express full-length albumin-coding sequences.

[0123] When donor nucleic acids come into contact with cells, they are typically inserted into the target gene via non-homologous end joining.

[0124] Another object of the present invention is a system comprising:

[0125] a) Donor nucleic acid, including:

[0126] -Exogenous DNA sequence

[0127] -Optional one or more albumin exons

[0128] The donor nucleic acid is attached to the reverse target sequence on the 5' and 3' sides;

[0129] b) Complementary oligonucleotides homologous to the target sequence, and

[0130] c) Nucleases that recognize the target sequence.

[0131] The target sequence is located in the region selected from introns 9, 11, 12, 13 and 14 at the 3' end of the albumin gene.

[0132] Another object of the present invention is a system comprising:

[0133] a) Donor nucleic acid, including:

[0134] -Exogenous DNA sequence

[0135] -Optional one or more albumin exons

[0136] The donor nucleic acid is attached to the reverse target sequence on the 5' and 3' sides;

[0137] b) Complementary oligonucleotides homologous to the target sequence, and

[0138] c) Nucleases that recognize the target sequence.

[0139] The target sequence is located in the region selected from introns 12, 13 and 14 at the 3' end of the albumin gene.

[0140] The nuclease may be provided as a protein or as a nucleic acid encoding the nuclease. The nucleic acid may be DNA or RNA; for example, it may be the mRNA of the nuclease, or it may be the cDNA or DNA coding sequence of the nuclease or a DNA construct encoding the nuclease.

[0141] In one embodiment, the nuclease is encoded by a nucleic acid, and the donor nucleic acid, the complementary oligonucleotide, and the nucleic acid encoding the nuclease are located on a DNA construct. Preferably, the donor nucleic acid and the complementary oligonucleotide are located on the same DNA construct, while the nucleic acid encoding the nuclease is located on a separate DNA construct. Preferably, the construct containing the donor nucleic acid and the complementary oligonucleotide comprises or has substantially at least 95% identity with sequences comprising the following sequences: SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:33, SEQ ID NO:26, SEQ ID NO:20, SEQ ID NO:27, SEQ ID NO:1, and SEQ ID NO:28.

[0142] In another embodiment, the construct comprising the donor nucleic acid comprises the following or substantially has at least 95% identity with a sequence comprising the following sequences: SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:20.

[0143] The construct comprising the donor nucleic acid and the complementary oligonucleotide may contain SEQ ID NO:34 or have a sequence that is substantially identical to SEQ ID NO:34 by at least 95%.

[0144] The construct containing the donor nucleic acid may contain SEQ ID NO:38 or a sequence that is substantially identical to SEQ ID NO:38 by at least 95%.

[0145] In a preferred embodiment, the donor nucleic acid and / or exogenous DNA sequence and / or albumin exon and / or reverse target sequence and / or target sequence and / or complementary oligonucleotide and / or nuclease and / or introns therein as defined above or herein.

[0146] Another object of the present invention is a method for preparing viral vector particles, including introducing such DNA constructs into host cells, and obtaining viral vector particles is also an object of the present invention.

[0147] In a preferred embodiment, the donor nucleic acid and / or exogenous DNA sequence and / or target sequence and / or complementary oligonucleotide and / or nuclease are as defined above.

[0148] In a preferred embodiment, the donor nucleic acid and / or exogenous DNA sequence and / or albumin exon and / or reverse target sequence and / or target sequence and / or complementary oligonucleotide and / or nuclease and / or introns therein as defined above or herein.

[0149] In the context of this invention, donor nucleic acids and / or complementary oligonucleotides and / or nucleic acids encoding nucleases are contained in one or more viral or non-viral vectors, preferably the viral vectors being selected from adeno-associated viruses, retroviruses, adenoviruses, and lentiviruses; the non-viral vectors are preferably selected from polymer-based, particle-based, lipid-based, peptide-based delivery media or combinations thereof, such as cationic polymers, micelles, liposomes, exosomes, microparticles, and nanoparticles including lipid nanoparticles (LNPs).

[0150] Preferably, the first vector comprises a donor nucleic acid and a complementary oligonucleotide homologous to the target sequence, and the second vector comprises a nucleic acid encoding a nuclease that recognizes the target sequence. Alternatively, the first vector comprises a donor nucleic acid, and the second vector comprises a complementary oligonucleotide homologous to the target sequence and a nucleic acid encoding a nuclease that recognizes the target sequence. As another alternative, three vectors are provided: a first vector comprising a donor nucleic acid, a second vector comprising a complementary oligonucleotide homologous to the target sequence, and a third vector comprising a nucleic acid encoding a nuclease that recognizes the target sequence.

[0151] Preferably, the system comprises a first vector and a second vector, the first vector comprising a nucleic acid expressing a nuclease, and the second vector comprising a donor nucleic acid and a complementary oligonucleotide homologous to the target sequence, wherein such elements are as defined above or herein.

[0152] Preferably, the system comprises a first carrier and a second carrier, the first carrier comprising donor nucleic acid, and the second carrier comprising a complementary oligonucleotide homologous to the target sequence and a nucleic acid encoding a nuclease, wherein such elements are as defined above or herein. The system according to the invention is preferably used for medical purposes, preferably for use in the treatment of genetic diseases or for use in the treatment of hereditary and common diseases caused by loss of function, preferably including diabetes, lysosomal storage diseases including mucopolysaccharidosis (MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIV, MPSVII), sphingolipid storage diseases (Fabry disease, Gaucher disease, Niemann-Pick disease, GM1 ganglioside storage disease), lipofuscin storage diseases (Barton's disease, etc.), and mucolipid storage diseases; choroidal and retinal gyral atrophy, adenosine monosuccinate deficiency, hemophilia A and B, ALA dehydratase deficiency, and adrenoleukodystrophy.

[0153] The system of the present invention can be used in the treatment of diseases in which both the mutant and wild-type alleles are replaced by the correct copy of the gene provided by the donor DNA, or for the treatment of recessive and common diseases caused by loss of function, preferably selected from: hemophilia; diabetes; lysosomal storage diseases, including mucopolysaccharidosis, such as MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVI, and MPSVII; sphingolipid storage diseases, such as Fabry disease, Gaucher disease, Niemann-Pick disease, and GM1 ganglioside storage diseases; lipofuscin storage diseases, such as Barton's disease, and mucolipid storage diseases; choroidal and retinal gyral atrophy, adenosine monosuccinate deficiency, hemophilia A and B, ALA dehydratase deficiency, and adrenoleukodystrophy.

[0154] Therefore, the system of the present invention can be used to treat: hemophilia; diabetes; lysosomal storage diseases, including mucopolysaccharidosis such as MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVI, and MPSVII; sphingolipid storage diseases such as Fabry disease, Gaucher disease, Niemann-Pick disease, and GM1 ganglioside storage diseases; lipofuscin storage diseases such as Barton's disease; and mucolipid storage diseases; choroidal and retinal gyral atrophy, adenosine monosuccinate deficiency, hemophilia A and B, ALA dehydratase deficiency, or adrenoleukodystrophy.

[0155] Another object of the present invention is a vector comprising a donor nucleic acid and / or a complementary oligonucleotide homologous to a target sequence and / or a nucleic acid encoding a nuclease that recognizes a target sequence as defined above or herein.

[0156] In the context of this invention, the donor nucleic acid and / or exogenous DNA sequence and / or albumin exon and / or reverse target sequence and / or target sequence and / or complementary oligonucleotide and / or nuclease and / or introns thereof as defined above or herein.

[0157] Preferably, the vector is a viral vector, preferably a lentiviral vector or an adeno-associated virus vector, or a non-viral vector, preferably selected from polymer-based, particle-based, lipid-based, peptide-based delivery media or combinations thereof, such as cationic polymers, micelles, liposomes, exogenous bodies, microparticles, and nanoparticles including lipid nanoparticles (LNPs). AAV2 / 8 vectors are preferably used.

[0158] In a preferred embodiment of the invention, a vector containing nucleic acid expressing Cas9 is used in conjunction with a second vector containing donor DNA and a complementary oligonucleotide (i.e., gRNA as defined above) homologous to the target sequence.

[0159] In an optional preferred embodiment of the invention, a vector comprising a nucleic acid expressing Cas9 and a complementary oligonucleotide (i.e., gRNA) homologous to the target sequence is used in conjunction with a second vector comprising donor DNA as defined above.

[0160] Preferably, the first vector contains a nucleic acid encoding Cas9 or spCas9, preferably controlled by a tissue-specific promoter (e.g., a liver-specific promoter, such as the liver heterozygous liver promoter (HLP)). The vector may also contain a polyadenylate, conveniently a short synthetic polyadenylate (synt.polyA). Preferably, the second vector contains a gRNA expression cassette as defined above and donor DNA. Preferably, the gRNA expression cassette contains a gRNA as defined above under the U6 promoter. Preferably, the donor DNA has inverse targeting sequences side-linked at 3' and 5', preferably linked to the corresponding PAM.

[0161] Preferably, the vector is a viral vector, and more preferably, the viral vector is a lentiviral vector, adeno-associated virus vector, adenovirus vector, retroviral vector, poliovirus vector, mouse Maloney-based viral vector, alpha virus vector, poxvirus vector, herpesvirus vector, vaccinia virus vector, baculovirus vector, or parvovirus vector. Preferably, the adeno-associated virus is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVSH19, AAVPHP.BAAV2, AAV9, AAV1, AAVSH19, AAVPHP.B, AAV8, or AAV6.

[0162] Preferably, the viral vector or the vector further comprises a 5'-terminal repeat (5'-TR) nucleotide sequence and a 3'-terminal repeat (3'-TR) nucleotide sequence, preferably the 5'-TR is a 5'-inverted terminal repeat (5'-ITR) nucleotide sequence, and the 3'-TR is a 3'-inverted terminal repeat (3'-ITR) nucleotide sequence, preferably the ITR is derived from the same viral serotype or different viral serotypes, preferably the virus is AAV, and preferably has serotype 2.

[0163] In one embodiment, the viral vector comprising a gRNA expression cassette and donor DNA further comprises a preferred 5' inverted terminal repeat (ITR) sequence of AAV preferably located at the 5' end of the construct comprising the gRNA expression cassette and donor DNA, and a preferred 3' inverted terminal repeat (ITR) sequence of AAV preferably located at the 3' end of the construct comprising the gRNA expression cassette and donor DNA.

[0164] Preferably, the ITR comprises a sequence that includes or has at least 95% identity with the following: SEQ ID NO: 110, SEQ ID NO: 29, or 66.

[0165] Preferably, the viral vector comprising a gRNA expression cassette and donor DNA comprises:

[0166] -AAV 5'-inverted terminal repeat (5'-ITR) sequence;

[0167] - The reverse target sequence linked to its adjacent motif (PAM) sequence in the pre-interstitial region;

[0168] - Clipping acceptor sequence;

[0169] - One or more albumin exons, preferably selected from one or more exons of exon 10, exon 11, exon 12, exon 13 and exon 14;

[0170] - Ribosomal skipping sequence, preferably T2A,

[0171] -Exogenous DNA sequence, preferably the coding sequence of the human ARSB gene;

[0172] - Transcription termination sequence;

[0173] - An additional reverse targeting sequence linked to its adjacent motif (PAM) sequence in the pre-interstitial region;

[0174] - Complementary oligonucleotides homologous to the target sequence, controlled by a promoter, preferably by the U6 promoter;

[0175] -Chimeric gRNA scaffold, and

[0176] -AAV 3'-inverted terminal repeat (3'-ITR) sequence.

[0177] Preferably, the viral vector comprising a gRNA expression cassette and donor DNA comprises:

[0178] -AAV 5'-inverted terminal repeat (5'-ITR) sequence;

[0179] - The reverse target sequence linked to its adjacent motif (PAM) sequence in the pre-interstitial region;

[0180] - Clipping acceptor sequence;

[0181] - One or more albumin exons, preferably selected from one or more exons of exons 13 and 14;

[0182] - Ribosomal skipping sequence, preferably T2A,

[0183] -Exogenous DNA sequence, preferably the coding sequence of the human ARSB gene;

[0184] - Transcription termination sequence;

[0185] - An additional reverse targeting sequence linked to its adjacent motif (PAM) sequence in the pre-interstitial region;

[0186] - Complementary oligonucleotides homologous to the target sequence, controlled by a promoter, preferably by the U6 promoter;

[0187] -Chimeric gRNA scaffold, and

[0188] -AAV 3'-inverted terminal repeat (3'-ITR) sequence.

[0189] Alternatively, the viral vector containing donor DNA comprises:

[0190] -AAV 5'-inverted terminal repeat (5'-ITR) sequence;

[0191] - The reverse target sequence linked to its adjacent motif (PAM) sequence in the pre-interstitial region;

[0192] - Clipping acceptor sequence;

[0193] - One or more albumin exons, preferably selected from one or more exons of exon 10, exon 11, exon 12, exon 13 and exon 14;

[0194] - Ribosomal skipping sequence, preferably T2A,

[0195] -Exogenous DNA sequence, preferably the coding sequence of the human BDD F8 gene;

[0196] - Transcription termination sequence;

[0197] - An additional reverse targeting sequence linked to its adjacent motif (PAM) sequence in the anterior interstitial region; and

[0198] -AAV 3'-inverted terminal repeat (3'-ITR) sequence

[0199] or

[0200] The viral vector containing donor DNA comprises:

[0201] -AAV 5'-inverted terminal repeat (5'-ITR) sequence;

[0202] - The reverse target sequence linked to its adjacent motif (PAM) sequence in the pre-interstitial region;

[0203] - Clipping acceptor sequence;

[0204] - One or more albumin exons, preferably selected from one or more exons of exons 13 and 14;

[0205] - Ribosomal skipping sequence, preferably T2A,

[0206] -Exogenous DNA sequence, preferably the coding sequence of the human BDD F8 gene;

[0207] - Transcription termination sequence;

[0208] - An additional reverse targeting sequence linked to its adjacent motif (PAM) sequence in the anterior interstitial region; and

[0209] -AAV 3'-inverted terminal repeat (3'-ITR) sequence.

[0210] Appropriately, when the vector does not contain a gRNA expression cassette, the cassette is contained within a vector containing nucleic acid expressing a nuclease.

[0211] The above-described elements can be arranged in the order defined above, from 5' to 3'; however, as those skilled in the art will understand, other orders are equally appropriate.

[0212] The vector can also contain additional viral sequences, such as additional AAV sequences.

[0213] Preferably, the vector comprising the donor nucleic acid and the complementary oligonucleotide comprises or has substantially 95% identity with a sequence comprising the following sequences: SEQ ID NO:29, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:33, SEQ ID NO:26, SEQ ID NO:20, SEQ ID NO:27, SEQ ID NO:2, SEQ ID NO:28 and SEQ ID NO:29.

[0214] In another embodiment, the vector containing the donor nucleic acid comprises the following sequences or has substantially 95% identity with sequences containing the following sequences: SEQ ID NO:110, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:20 and SEQ ID NO:29.

[0215] Another object of the present invention is to include the construct, vector or vector system or host cell of the system as defined above.

[0216] Another object of the present invention is to include viral particles comprising the constructs, vectors, vector systems or systems as defined above.

[0217] Appropriately, viral vectors as defined herein encompass viral vector particles.

[0218] The term “virus particle” or “viral particle” is intended to refer to the extracellular form of a nonpathogenic virus, particularly a viral vector, which consists of genetic material made of DNA or RNA surrounded by a protein coat called a capsid, and in some cases, the envelope is derived from a portion of the host cell membrane and includes viral glycoproteins.

[0219] As used in this article, viral vector also refers to viral vector particles.

[0220] The viral vectors covered by this invention are suitable for gene therapy.

[0221] Preferably, the viral particles contain the capsid protein of AAV.

[0222] Preferably, the viral particles contain capsid proteins of one or more serotypes of AAV selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVSH19, and AAVPHP.B; preferably from serotypes AAV2 or AAV8.

[0223] Another object of the present invention is a pharmaceutical composition comprising one of the following: a system as defined above; one or more carriers; a host cell or viral particle; and a pharmaceutically acceptable delivery vehicle.

[0224] Another object of the present invention is a kit comprising: a DNA construct, system, or one or more vectors, host cells, or viral particles, or a pharmaceutical composition as defined above, in one or more containers, optionally further comprising instructions or packaging materials describing how to administer the nucleic acid construct, vector, host cell, viral particle, or pharmaceutical composition to a patient.

[0225] The system or one or more carriers or host cells or viral particles as defined above, or the pharmaceutical composition as defined above, are preferably used as pharmaceuticals, preferably for use in the treatment of the diseases mentioned herein, and preferably for use in the treatment of the following diseases: liver diseases; lysosomal storage diseases, including mucopolysaccharidosis (such as MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVI, MPSVII), sphingolipid storage diseases (Fabry disease, Gaucher disease, Niemann-Pick disease, GM1 ganglioside storage diseases), lipofuscin storage diseases (Barton disease, etc.), and mucolipid storage diseases; and other diseases in which the liver can be used as a factory for the production and / or secretion of therapeutic proteins, such as diabetes, gyral atrophy of the choroid and retina, adenosine monophosphate deficiency, hemophilia A and B, ALA dehydrase deficiency, and adrenoleukodystrophy.

[0226] The system or one or more vectors or host cells or viral particles as defined above, or the pharmaceutical composition as defined above, may be used for the treatment of diseases in which both the mutant and wild-type alleles are replaced by the correct copy of the gene provided by the donor DNA, or for the treatment of recessive and common diseases caused by loss of function, preferably selected from: hemophilia; diabetes; lysosomal storage diseases, including mucopolysaccharidosis such as MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVI, and MPSVII; sphingolipid storage diseases such as Fabry disease, Gaucher disease, Niemann-Pick disease, and GM1 ganglioside storage diseases; lipofuscin storage diseases such as Barton's disease; and mucolipid storage diseases; choroidal and retinal gyral atrophy; adenosine monosuccinate deficiency; hemophilia A and B; ALA dehydratase deficiency; and adrenoleukodystrophy.

[0227] Therefore, the system as defined above, or one or more carriers or host cells or viral particles, or the pharmaceutical composition as defined above, may be used to treat: hemophilia; diabetes; lysosomal storage diseases, including mucopolysaccharidosis such as MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVI, and MPSVII; sphingolipid storage diseases such as Fabry disease, Gaucher disease, Niemann-Pick disease, and GM1 ganglioside storage diseases; lipofuscin storage diseases such as Barton's disease; and mucolipid storage diseases; choroidal and retinal gyral atrophy, adenosine monosuccinate deficiency, hemophilia A and B, ALA dehydratase deficiency, or adrenoleukodystrophy.

[0228] Another object of the present invention is a construct for generating viral particles as defined above.

[0229] Another object of the present invention is a method for treating a subject affected by a disease mentioned herein (preferably a hereditary disease caused by loss of gene function), the method comprising administering to the subject an effective amount of a carrier system or vector or host cell or viral particle or pharmaceutical composition as defined above. Preferably, the disease is a lysosomal storage disease, such as mucopolysaccharidosis (MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVI, MPSVII) or hemophilia A or B.

[0230] Preferably, the objective of this invention is the sequence mentioned herein.

[0231] Preferably, the donor DNA cassette element and / or gRNA expression cassette element and / or promoter sequence and / or U6 promoter for gRNA expression and / or gRNA and / or gRNA target site and / or reverse target sequence and / or Cas9 and / or exogenous DNA sequence and / or posttranscriptional regulatory element and / or transcription termination sequence and / or splice acceptor sequence and / or ribosome jumping sequence are the sequences depicted in SEQ ID NO:1-109.

[0232] Another object of the present invention is a DNA construct comprising a donor nucleic acid as defined above or herein and / or a complementary strand oligonucleotide homologous to a target sequence and / or a nucleic acid encoding a nuclease that recognizes the target sequence.

[0233] In one embodiment, the method of the present invention is performed in vitro or outside the body.

[0234] In one embodiment, in the method of the present invention, the cells are isolated cells from a subject or patient.

[0235] The sequence of albumin is preferably described using accession number AC140220.4 (GeneBank, NCBI, database; latest version) or accession number NC_000004.12.

[0236] The present invention also provides pharmaceutical compositions comprising nucleic acids or nucleotide sequences as defined above or vectors as defined above, as well as pharmaceutically acceptable diluents and / or excipients and / or carriers.

[0237] Preferably, the composition further comprises a therapeutic agent, preferably selected from the group consisting of enzyme replacement therapy and small molecule therapy.

[0238] Preferably, the pharmaceutical composition is administered via a route selected from the group consisting of: parenteral, intravenous (e.g., via the temporal vein), intraperitoneal, intratumoral, intrahepatic, or any combination thereof. Preferably, the carrier of the present invention is administered via an intravenous or parenteral route.

[0239] The present invention also provides a carrier as defined above for medical use, wherein the carrier is administered via a route selected from the group consisting of: parenteral, intravenous (e.g., via the temporal vein), intraperitoneal, intratumoral, intrahepatic, or any combination thereof. Preferably, the carrier of the present invention is administered via an intravenous or parenteral route.

[0240] In a preferred embodiment of the present invention:

[0241] - If the target sequence is located in intron 9 of the albumin gene, then albumin exons 10, 11, 12, 13 and 14 or fragments thereof are present;

[0242] - If the target sequence is located in intron 11 of the albumin gene, then albumin exons 12, 13 and 14 or fragments thereof are present.

[0243] - If the target sequence is located in intron 12 of the albumin gene, then albumin exons 13 and 14 or fragments thereof are present.

[0244] - If the target sequence is located in intron 13 of the albumin gene, then albumin exon 14 or a fragment thereof is present; or

[0245] - If the target sequence is located in intron 14 of the albumin gene, then there is no albumin exon or fragment thereof.

[0246] In this invention, a 3XFLAG sequence may be present. Preferably, the 3XFLAG sequence comprises SEQ ID NO:56 or 62 or has a sequence that is substantially identical to SEQ ID NO:56 or 62 by at least 95%.

[0247] In this invention, "at least 80% identity" means that the identity can be at least 80%, or 85%, or 90%, or 95%, or 100% of the sequence. This applies to all mentioned identity percentages. In this invention, "at least 95% identity" means that the identity can be at least 95%, 96%, 97%, 98%, 99%, or 100% of the sequence. This applies to all mentioned identity percentages. In this invention, "at least 98% identity" means that the identity can be at least 98%, 99%, or 100% of the sequence. This applies to all mentioned identity percentages. Preferably, the identity percentage refers to the full length of the sequence.

[0248] The present invention also includes nucleic acid sequences derived from the nucleotide sequences mentioned herein, such as functional fragments, mutants, variants, derivatives, analogs, and sequences having at least 80% identity with the sequences mentioned herein. Invention Details

[0250] definition

[0251] As used herein, the terms “comprising,” “comprises,” and “comprised of” are synonymous with “including” or “includes”; or “containing” or “contains”, and are inclusive or open-ended, and do not exclude additional, unlisted members, elements, or steps. The terms “comprising,” “comprises,” and “comprised of” also include the term “consisting of.”

[0252] In this invention, "at least 80% identity" means that the identity can be at least 80%, or 85%, or 90%, or 95%, or 100% of the sequence. This applies to all mentioned identity percentages. In this invention, "at least 95% identity" means that the identity can be at least 95%, 96%, 97%, 98%, 99%, or 100% of the sequence. This applies to all mentioned identity percentages. In this invention, "at least 98% identity" means that the identity can be at least 98%, 99%, or 100% of the sequence. This applies to all mentioned identity percentages. Preferably, the identity percentage refers to the full length of the sequence.

[0253] The present invention also includes nucleic acid sequences derived from the nucleotide sequences mentioned herein, such as functional fragments, mutants, variants, derivatives, analogs, and sequences having at least 80% identity with the sequences mentioned herein, provided that such fragments, mutants, variants, derivatives, and analogs retain the function of the sequences from which they are derived.

[0254] Attached Figure

[0255] Figure 1: In vivo integration and expression of the DsRed transgene into the 3'mAlb locus. Wild-type mice received a mixture of AAV8-SpCas9 and AAV8-donor-gRNA (or -scRNA as a negative control) via the temporal vein at 1 day of age (p1). (A) Schematic diagram of the HITI construct and its integration into the 3' mouse albumin locus. (B) Representative insertion / deletion analysis performed by T7 endonuclease (T7) cleavage assay. Expected band sizes and mean insertion / deletion frequencies (n=5) are depicted. (C) PCR of DNA extracted from liver samples using specific primer combinations shows precise 5' (left) and 3' (right) ligation products at the 3'mAlb locus. Black arrows indicate expected band sizes. (D) Representative fluorescence microscopy imaging of frozen liver sections from animals treated with n=5 gRNA and n=5 scRNA at 20x magnification. gRNA = HITI donor - gRNA + SpCas9; scRNA = HITI donor - scRNA + SpCas9. The right figure reports the percentage of Ds-Red positive hepatocytes.

[0256] Figure 2: Integration of AAV-HITI into 3' albumin in newborn mice improved the phenotype of a mouse model of MPSVI. (A) Schematic diagram of the AAV-gRNA-HITI donor and AAV-Cas9 construct. SAS: Synthetic splice acceptor signal; Exon 14: Exon 14 of mouse albumin; T2A: Thoseea asigna virus 2A jumping peptide; spA: Synthetic bovine growth hormone polyadenylate. (B) Serum arylsulfatase B (ARSB) activity measured in normal (NR), untreated MPSVI mice (AF NT), and gRNA-treated MPSVI mice (AF gRNA). Values ​​are reported on a logarithmic scale. (C) Urinary glycosaminoglycans (GAG) measured in normal (NR), untreated MPSVI mice (AF NT), and gRNA-treated MPSVI mice (AF gRNA). Values ​​are reported as a percentage of age-matched scrambled controls.

[0257] Figure 3HITI-mediated integration of F8 codopV3 at the mouse 3'Alb (mAlb) locus in neonatal hemophilia mice. (A) Schematic diagram of the construct. U6 = U6 promoter; gRNA = gRNA expression cassette; HLP = heterozygous liver promoter; Cas9 = Sp Cas9 coding sequence; pA = polyadenylation signal; SAS = synthetic splice acceptor; Ex 14 = mouse albumin exon 14; T2A = Thosea asigna virus 2A jumping peptide; F8 = CodopV3 coding sequence; pA = polyadenylation signal. (B) Colorimetric assays of the following plasma samples: AF = affected untreated hemophilia mice; NR = unaffected controls; HITI gRNA = affected animals treated with Cas9+U6 gRNA expression cassette and HITI donor; HITI scRNA = affected animals treated with Cas9+U6 scRNA expression cassette and HITI donor. Each point corresponds to a different animal. F8 activity is reported in International Units (IU / dl).

[0258] Figure 4 Serum albumin levels. Serum albumin levels were measured on p360 after treatment in all animals, both those treated with and untreated with AAV-HITI. AF gRNA = affected animals treated with AAV-HITI guided (gRNA) vectors; AF scRNA = affected animals treated with AAV-HITI scrambling RNA (scRNA) vectors; NR = unaffected, untreated animals. Each bar corresponds to the albumin level of a single animal. Serum albumin is expressed in mg albumin / ml serum.

[0259] Figure 5 : Alpha-fetoprotein (AFP) level in mice. AFP levels were measured in serum samples collected by p360 after treatment. AFgRNA = affected animals treated with AAV-HITI guided (gRNA) vector; AFscRNA = affected animals treated with AAV-HITI scrambling RNA (scRNA) vector; AF = affected untreated animals; NR = unaffected untreated animals. Each bar corresponds to the AFP level of a single animal. AFP levels are expressed as ng AFP / ml serum.

[0260] Figure 6 CAST-seq analysis of AAV-HITI samples.

[0261] Visual representation of CAST-seq analysis of genomic DNA extracted from liver samples of MPSVI mice treated with three different AAV-HITI gRNAs.

[0262] Figure 7 Dose response of AAV-HITI to MPSVI mice.

[0263] Serum active ARSB levels are shown. The figure below reports treatment, genotype, and time points. Each point represents one mouse, and the mean level is reported within each bar (above the bar for LD treatment). Normal levels of ARSB-expressing unaffected mice are indicated by dashed lines and reported as mean ± standard error of mean (from Alliegro & Ferra et al., 2016). NT = untreated; HD = high dose; MD = moderate dose; LD = low dose; AF = affected or Arsb - / - Mice; p30 = age 30 days.

[0264] Figure 8 Evaluation of insertions and deletions at the 3'ALB locus.

[0265] Representative insertion / deletion analysis by T7 endonuclease (T7) cleavage assay. Expected band size is indicated by a black arrow. The percentage of insertions / deletions is reported below each gRNA lane and shown as mean ± standard error of mean (n = 3 independent experiments). Molecular weight markers are 100 bp markers. scRNA = scrambled RNA; + = sample treated with T7 enzyme; - = sample not treated with T7 enzyme; SEM = standard error of mean.

[0266] Figure 9 HITI-mediated in vitro integration at the 3'Alb or 3'ALB locus.

[0267] Quantification of DsRed-positive (DsRed+) cells after integration of donor DNA carrying a promoter-deficient DsRed coding sequence at the 3'Alb or 3'ALB locus. The number of DsRed+ cells resulting from gRNA-induced integration was normalized against samples receiving scrambling RNA (scRNA) and reported as a percentage of Cas9-linked EGFP-positive cells. Cell lines, gRNAID, and targeting introns of Alb or ALB are reported below the figure. Each dot represents a biological replicate of transfected cells. scRNA = scrambling RNA; HEPA 1-6 = mouse hepatocellular carcinoma cell lines 1-6; HUH7 = human hepatocellular carcinoma cell line 7; Alb = mouse albumin; intr = intron; ALB = human albumin.

[0268] Figure 10: Molecular characterization of AAV-HITI at the target and off-target sites in mice. A) Percentage of insertions / deletions at the target site obtained by Illumina-seq NGS analysis. Mice treated with AAV-HITI gRNA showed 29% insertions / deletions at the target site, while the percentage of insertions / deletions was close to zero in mice treated with AAV-HITI scRNA. B) Alignment of reads generated by Illumina-seq at the target site to detect possible AAV genome integration. Reads containing ITR sequences were enriched when using the AAV-HITI or AAV-Cas9 genome as a reference. C) NGS off-target analysis of the top 10 predicted off-target sites in DNA samples from mice derived from AAV-HITI gRNA and AAV-HITI scRNA showed that the inventors' chosen gRNA was specific for the target site (mouse albumin intron 13).

[0269] Albumin gene

[0270] The albumin gene is a target genomic locus recognized by the gRNA of this invention so that a foreign DNA sequence to be expressed can be inserted under the albumin promoter.

[0271] The sequence of albumin is preferably described using the following accession number AC140220.4 or the following accession number NC_000004.12.

[0272] The albumin gene (ENSMUSG00000029368) is located on chromosome 5 and has three alternative transcriptional variants, only one of which (ENSMUST00000031314.10, containing 15 exons) encodes albumin (P07724, 608 amino acids).

[0273] Albumin is abundant in blood plasma and is essential for maintaining swelling pressure, which is crucial for its role as a carrier protein for various blood molecules such as steroids and fatty acids. This gene is primarily expressed in the liver, where the encoded protein undergoes proteolytic processing before being secreted into the plasma. [Provided by RefSeq, October 2015]

[0274] Therapeutic genes and proteins

[0275] The therapeutic gene of this invention is a gene responsible for one or more genetic diseases, such as lysosomal storage diseases, including mucopolysaccharidosis (MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVII), sphingolipid storage diseases (Fabry disease, Gaucher disease, Niemann-Pick disease, GM1 ganglioside storage disease), lipofuscin storage diseases (Barton disease, etc.) and mucolipid storage diseases, gyral atrophy of the choroid and retina, adenosine monosuccinate deficiency, hemophilia A and B, ALA dehydrase deficiency, and adrenoleukodystrophy.

[0276] The therapeutic genes particularly preferred by the present invention are those that can be expressed by liver cells to correct defects in the same or other tissues.

[0277] Suitablely, according to the present invention, the liver can be used as a factory for producing and secreting therapeutic proteins to correct genetic defects within the liver or affecting different tissues.

[0278] The therapeutic gene of this invention is also a gene that exhibits loss of function in recessive diseases (autosomal or sex-linked).

[0279] Factor VIII

[0280] The factor VIII gene (ENSG00000185010, gene synonyms: FVIII, F8, DXS1253E, F8C, or HEMA) is located on the X chromosome (Xq28) and encodes coagulation factor VIII, which is involved in the intrinsic pathway of blood clotting. Factor VIII is a cofactor of factor IXa, which converts factor X to its activated form Xa in the presence of Ca²⁺ and phospholipids. This gene produces two alternatively spliced ​​transcripts. Transcriptional variant 1 (ENST00000360256.9, 26 exons) encodes a large glycoprotein, isotype a, which circulates in plasma and is associated with von Willebrand factor as a non-covalent complex. This protein undergoes multiple cleavage events. Transcriptional variant 2 (ENST00000330287.10, 5 exons) encodes a putative small protein, isotype b, which is primarily composed of the phospholipid-binding domain of factor VIIIc. This binding domain is essential for coagulation activity. At least seven alternative transcripts have been annotated (Ensembl.org). Defects in this gene result in hemophilia A, a common recessive X-linked coagulation disorder. [Provided by Ref Seq, July 2008]

[0281] The sequence of factor VIII is preferably described by the following accession number NM_000132.4.

[0282] Several modifications to factor VIII have been engineered to improve its stability and activity, such as those described in Miao, HZ et al., Bioengineering of coagulation factor VIII for improved secretion, Blood (2004). In addition to the deletion of the B domain (where amino acids 740 to 1649 of the WT F8 protein are deleted), linkers have been engineered to further improve FVIII secretion by mimicking some commonly occurring post-translational modifications, such as the N6 linker described in Miao, HZ et al., Bioengineering of coagulation factor VIII for improved secretion, Blood (2004), and Ward et al., Codon optimization of human factor VIII cDNAs leads to high-level expression, Blood (2011).

[0283] Suitablely, segments of the factor VIII encoded sequence are within the scope of this invention.

[0284] Modification factor VIII is also within the scope of this invention.

[0285] Suitable, the codon-optimized form of the factor VIII coding sequence or a fragment thereof, such as the BDD factor VIII coding sequence, is within the scope of this invention.

[0286] Arylsulfatase B (ARSB)

[0287] The gene encoding arylsulfatase B (ARSB) (ENSG00000113273) is located on chromosome 5 and at least seven alternative transcripts are annotated (Ensembl.org). Isotype 1 (ENST00000264914.10, 8 exons, corresponding to RefSeq NM_000046.5) encodes a 533-amino acid protein (P15848-1). The arylsulfatase B encoded by this gene belongs to the sulfatase family. The arylsulfatase B homodimer hydrolyzes the sulfate groups of N-acetyl-D-galactosamine, chondroitin sulfate, and dermatan sulfate. This protein is targeted by lysozyme. Mucopolysaccharidosis type VI is an autosomal recessive lysosomal storage disorder caused by arylsulfatase B deficiency. (Provided by RefSeq, December 2016).

[0288] The sequence of arylsulfatase B (ARSB) is preferably described using the following accession number NM_000046.5.

[0289] DNA construct

[0290] Exogenous DNA sequence

[0291] The aforementioned exogenous DNA sequence comprises a fragment of DNA from the genomic DNA to be incorporated into the target genome. In some embodiments, the exogenous DNA comprises at least a portion of a gene. The exogenous DNA may comprise a coding sequence, such as cDNA associated with a wild-type gene or cDNA associated with a “codon-optimized” sequence of a factor to be expressed. In some embodiments, the exogenous DNA comprises at least an exon of a gene. In some embodiments, the exogenous DNA comprises an enhancer element of a gene. In some embodiments, the exogenous DNA comprises a discontinuous sequence of a gene, the discontinuous sequence comprising the 5' portion of a gene fused to the 3' portion of the gene. In some embodiments, the exogenous DNA comprises a wild-type gene sequence. In some embodiments, the exogenous DNA comprises a mutated gene sequence. In some embodiments, the exogenous DNA comprises a wild-type gene sequence. In some embodiments, the exogenous DNA sequence comprises a reporter gene. In some embodiments, the reporter gene is selected from at least one of Discosoma Red (Dsred), green fluorescent protein (GFP), red fluorescent protein (RFP), luciferase, β-galactosidase, and β-glucuronidase. In some embodiments, the foreign DNA sequence comprises a gene transcription regulatory element, which may, for example, comprise an enhancer sequence. In some embodiments, the foreign DNA sequence comprises one or more exons or fragments thereof. In some embodiments, the foreign DNA sequence comprises one or more introns or fragments thereof. In some embodiments, the foreign DNA sequence comprises at least a portion of a 3' untranslated region or a 5' untranslated region. In some embodiments, the foreign DNA sequence comprises an artificial DNA sequence. In some embodiments, the foreign DNA sequence comprises a nuclear localization sequence and / or a nuclear export sequence. In some embodiments, the foreign DNA sequence comprises a signal peptide sequence. In some embodiments, the foreign DNA sequence comprises a segment of nucleic acid to be integrated into a target genomic locus. In some embodiments, the foreign DNA sequence comprises one or more polynucleotides of interest. In some embodiments, the foreign DNA sequence comprises one or more expression cassettes. In some embodiments, such expression cassettes comprise the foreign DNA sequence of interest, polynucleotides encoding selection markers and / or reporter genes, and regulatory components affecting expression. In some embodiments, the foreign DNA sequence comprises genomic nucleic acids. Genomic nucleic acids are derived from animals, mice, humans, non-humans, rodents, rats, hamsters, rabbits, pigs, bovids, deer, sheep, goats, chickens, cats, dogs, ferrets, primates (e.g., marmosets, rhesus monkeys), domesticated or agricultural mammals, birds, bacteria, archaea, viruses, or any other organism of interest or a combination thereof. Any exogenous DNA sequence of suitable size is integrated into the target genome.In some embodiments, the length of the foreign DNA sequence integrated into the genome is less than 0.5, about 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 kilobases (kb). In some embodiments, the length of the foreign DNA sequence integrated into the genome is at least about 0.5 kb, 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, or 5 kb.

[0292] Genome insertion site

[0293] The double-strand break (DSB) site can be specifically introduced using any suitable technique, such as the CRISPR / Cas9 system and the guide RNA disclosed herein. In this invention, the DSB is introduced into introns 9, 11, 12, 13, or 14 of the albumin gene. Exemplary genomic insertion sites are located at position 733 of intron 9, position 152 of intron 11, position 538 of intron 12, position 927 of intron 12, position 173 of intron 13, position 456 of intron 13, or position 123 of intron 14 of the human albumin gene, wherein the position is relative to the first nucleotide of each intron.

[0294] The nuclease is preferably directed to the insertion site via a gRNA comprising a sequence selected from SEQ ID NO:1-2, SEQ ID NO:9-18 or a sequence composed of SEQ ID NO:1-2, SEQ ID NO:9-18.

[0295] Ribosome jumping sequence: 2A self-cleaving peptide

[0296] The ribosome skipping sequence is used in this paper as a synonym for 2A self-cleaving peptide or 2A peptide.

[0297] These are 18-22 amino acid-long peptides that can induce the cleavage of recombinant proteins in cells. 2A peptides originate from the 2A region of the viral genome.

[0298] Four members of the 2A peptide family are frequently used in life science research. They are P2A, E2A, F2A, and T2A. F2A is derived from foot-and-mouth disease virus 18; E2A is derived from equine rhinitis virus A; P2A is derived from porcine chezinvirus-1 2A; and T2A is derived from Thoseaasigna virus 2.

[0299]

[0300] Any ribosomal jumping sequence can be used within the scope of this invention. T2A is preferred. The ribosomal jumping peptide, such as peptide 2A, is preferably located between an albumin exon and a foreign DNA sequence.

[0301] Splice acceptor sequence

[0302] RNA splicing is a form of RNA processing in which newly prepared precursor messenger RNA (premRNA) transcripts are converted into mature messenger RNA (mRNA). During splicing, introns (non-coding regions) are removed, and exons (coding regions) are joined together.

[0303] Within an intron, a donor site (at the 5' end of the intron), a branching site (near the 3' end of the intron), and an acceptor site (at the 3' end of the intron) are required for splicing. The splice donor site consists of a nearly invariant sequence GU within a large, less highly conserved region at the 5' end of the intron. The splice acceptor site at the 3' end of the intron terminates the intron with a nearly invariant AG sequence. Upstream of the AG (in the 5' direction) is a region with high pyrimidine (C and U) content, or a polypyrimidine bundle. Further upstream of the polypyrimidine bundle is the branching point.

[0304] "Splice acceptor sequence" is a nucleotide sequence that can act as an acceptor site at the 3' end of an intron. The common sequences and frequencies of human splice site regions are described in Ma, SL et al., 2015. PLoS One, 10(6), p.e0130729.

[0305] Suitable, the splice acceptor sequence may contain a nucleotide sequence (Y). n NYAG, where n is 10-20, or a variant having at least 90% or at least 95% sequence identity. Suitably, the splice acceptor sequence may contain sequence (Y). n NCAG, where n is 10-20, or a variant having at least 90% or at least 95% sequence identity.

[0306] Adjustment element

[0307] The constructs of this invention may include one or more regulatory elements that can function pre- or post-transcriptionally. One or more regulatory elements may promote expression in the cells of this invention.

[0308] A "regulatory element" is any nucleotide sequence that promotes peptide expression, for example, by increasing transcript expression or enhancing mRNA stability. Suitable regulatory elements include, for example, promoters, enhancer elements, posttranscriptional regulatory elements, and polyadenylation sites.

[0309] The present invention also relates to constructs that may include regulatory elements that function in a intended host cell in which a vector comprising the construct is to be expressed. Those skilled in the art can select regulatory elements for suitable host cells, such as mammalian or human host cells. Regulatory elements include, for example, promoters, transcription termination sequences, translation termination sequences, enhancers, signal peptides, degradation signals, and polyadenylation elements.

[0310] The constructs of this invention may optionally contain transcription termination sequences, translation termination sequences, signal peptide sequences, internal ribosome entry sites (IRES), enhancer elements, and / or post-transcriptional regulatory elements, such as the marmot hepatitis virus (WHV) post-transcriptional regulatory element (WPRE). The transcription termination region is typically obtained from the 3' untranslated region of a eukaryotic or viral gene sequence. The transcription termination sequence may be located downstream of the coding sequence to provide effective termination. In the systems of this invention, a transcription termination site is typically included.

[0311] promoter

[0312] The nucleic acid constructs of the present invention may include a promoter sequence operatively linked to a nucleotide sequence encoding a desired polypeptide. The term "operatively linked" means that the portions (e.g., transgenes and promoters) are linked together in a manner that allows both to perform their functions substantially unhindered.

[0313] The promoters used in this invention can be ubiquitous promoters, meaning that their driver genes are expressed in a wide range of cells and tissues. Other promoters used in this invention are tissue-specific promoters, which exhibit selective activity in one or a group of tissues, but low or no activity in other tissues. Promoters may exhibit inducible expression in response to the presence of another factor (e.g., a factor present in the host cell).

[0314] When a carrier containing the construct is applied for treatment, it is preferable that the promoter is functional in the target cells (e.g., liver cells).

[0315] In some embodiments, the promoter is a ubiquitous promoter or a liver-specific promoter, preferably a hepatocyte-specific promoter. Promoters contemplated for use in this invention include, but are not limited to, natural gene promoters or fragments thereof, such as the cytomegalovirus (CMV) promoter (KF853603.1, 149-735 bp), the U6 promoter [37,38], the thyroxine-binding globulin (TBG) promoter, and the heterozygous liver-specific promoter (HLP). However, any suitable promoter known in the art may be used. In a preferred embodiment, the promoter is a CMV, HLP, or U6 promoter.

[0316] In a preferred embodiment, the promoter is the U6 promoter, such as the promoter of SEQ ID NO:27 or a fragment thereof.

[0317] Preferably, the promoter nucleic acid sequence has at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide identity with SEQ ID NO:27, 46, 59, or 61 or fragments thereof, and preferably wherein the promoter substantially retains the natural function of the promoter of SEQ ID NO:27, 46, 59, or 61.

[0318] Promoters can be incorporated into the construct using standard techniques known in the art. Multiple copies of the promoter or multiple promoters can be used in the construct of the present invention. In one embodiment, the promoter can be located at approximately the same distance from the transcription start site as it is in its natural genetic environment. Some variation in this distance is permissible without significantly reducing promoter activity.

[0319] polyadenylation sequence

[0320] The nucleic acid constructs of the present invention may contain a polyadenylated sequence. Suitably, the transgene is operatively linked to the polyadenylated sequence. The polyadenylated sequence can be inserted downstream of the transgene to improve transgene expression.

[0321] Polyadenylation sequences typically contain a polyadenylation signal, a polyadenylation site, and a downstream element: the polyadenylation signal contains a sequence motif recognized by the RNA cleavage complex; the polyadenylation site is a cleavage site that adds a multi-A tail to the mRNA; and the downstream element is a GT-rich region that is usually located just downstream of the polyadenylation site, which is important for efficient processing.

[0322] In some implementations, the polyadenylation sequence is a bovine growth hormone (bGH) polyadenylation sequence or an SV40 polyadenylation sequence; or a fragment thereof that retains the natural function of the polyadenylation sequence.

[0323] In a preferred embodiment, the polyadenylation sequence is a bovine growth hormone (bGH) polyadenylation sequence, and most preferably a short synthetic polyadenylation.

[0324] The preferred polyadenylation sequence of the present invention is SEQ ID NO:26, SEQ ID NO:37, SEQ ID NO:48, or SEQ ID NO:65.

[0325] In some embodiments, the polyadenylated sequence comprises or consists of a nucleic acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide identity with SEQ ID NO:26, SEQ ID NO:37, SEQ ID NO:48, or SEQ ID NO:65, preferably wherein the polyadenylated sequence substantially retains the native function of the polyadenylated sequence of SEQ ID NO:26, SEQ ID NO:37, SEQ ID NO:48, or SEQ ID NO:65.

[0326] Posttranscriptional regulatory elements

[0327] The nucleic acid constructs of the present invention may include post-transcriptional regulatory elements. Suitably, the protein-coding sequence is operatively linked to one or more additional post-transcriptional regulatory elements that may improve gene expression.

[0328] The constructs of the present invention may include a post-transcriptional regulatory element (WPRE) of marmot hepatitis virus.

[0329] Suitable WPRE sequences will be well known to those skilled in the art (see, for example, Zufferey et al. (1999) Journal of Virology 73:2886-2892; Zanta-Boussif et al. (2009) Gene Therapy 16:605-619). Suitablely, the WPRE is either a wild-type WPRE or a mutant WPRE. For example, the WPRE can be mutated to eliminate the translation of the marmot hepatitis virus X protein (WHX), for example by mutating the WHX ORF translation start codon.

[0330] Preferably, the WPRE contains or substantially has a sequence that is at least 95% identical to SEQ ID NO:25.

[0331] KOZAK Sequence

[0332] The nucleic acid construct of the present invention may contain a Kozak sequence. Suitably, the protein-coding sequence is operatively linked to the Kozak sequence. The Kozak sequence may be inserted before the start codon to improve translation initiation.

[0333] Suitable Kozak sequences are well known to those skilled in the art (see, for example, Kozak (1987) Nucleic Acids Research 15:8125-8148).

[0334] Guide RNA

[0335] Guide RNA (gRNA) imparts target sequence specificity to RNA-guided nucleases. Guide RNA is a short, non-coding RNA sequence that binds to a complementary target DNA sequence. For example, in the CRISPR / Cas9 system, the guide RNA first binds to the Cas9 enzyme, and the gRNA sequence guides the resulting complex to a specific location on the DNA via base pairing, where Cas9 performs its nuclease activity by cleaving the target DNA strand.

[0336] The term "guide RNA" encompasses any suitable gRNA that can be used with any RNA-guided nuclease, not just those gRNAs that are compatible with specific nucleases such as Cas9.

[0337] Guide RNA can comprise a trans-activating CRISPR RNA (tracrRNA) that provides a stem-loop structure and a target-specific CRISPR RNA (crRNA) designed to cleave the target site of the gene of interest. The tracrRNA and crRNA can be annealed, for example by heating them at 95°C for 5 minutes and then slowly cooling them to room temperature for 10 minutes. Alternatively, the guide RNA can be a single guide RNA (sgRNA) consisting of both crRNA and tracrRNA as a single construct.

[0338] Guide RNA can contain a 3' end that forms a scaffold for nuclease binding and a 5' end that can be programmed to target different DNA sites. For example, the targeting specificity of CRISPR-Cas9 can be determined by a 15-25 bp sequence at the 5' end of the guide RNA. The desired target sequence is typically preceding the pre-intermediate adjacent motif (PAM), a short DNA sequence, usually 2-6 bp in length, following the DNA region targeted for cleavage by a CRISPR system such as CRISPR-Cas9. The PAM is essential for Cas nuclease cleavage and is typically found 3-4 bp downstream of the cleavage site. After the guide RNA pairs with the target bases, Cas9 mediates a double-strand break approximately 3 nt upstream of the PAM.

[0339] Many tools exist for designing guide RNAs (e.g., Cui, Y. et al., 2018. Interdisciplinary Sciences: Computational Life Sciences, 10(2), pp. 455-465). For example, COSMID is a network-based tool for identifying and validating guide RNAs (Cradick TJ et al. Mol Ther-Nucleic Acids. 2014; 3(12):e214).

[0340] Chimeric RNA scaffold

[0341] Chimeric gRNA scaffolds are dual RNA structures that guide the Cas9 endonuclease to introduce site-specific double-strand breaks in target DNA, and are presumed to enhance the efficiency of Cas nucleases (Martin Jinek et al. 2012 A programmable dual RNA-guided DNAendonuclease in adaptive bacterial immunity). In this invention, the preferred chimeric RNA scaffold of SEQ ID NO:28 or 60 is used.

[0342] RNA-guided gene editing

[0343] The vector system of this invention can be used to deliver exogenous DNA sequences into cells. Subsequently, the exogenous DNA sequence can be introduced into the cellular genome at a double-strand break (DSB) site via non-homologous end joining (NHEJ). The DSB site can be specifically introduced using any suitable technique, such as by using an RNA-guided gene editing system.

[0344] "RNA-guided gene editing systems" can be used to introduce DSBs and typically contain guide RNA and RNA-guided nucleases. The CRISPR / Cas9 system is a commonly used example of an RNA-guided gene editing system, but other RNA-guided gene editing systems can also be used.

[0345] nuclease

[0346] Nucleases that recognize target sequences are known to those skilled in the art and include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), clustered regularly spaced short palindromic repeats (CRISPR) nucleases, and meganucleases. Nucleases found in the compositions and that can be used in the methods disclosed herein are described in more detail below.

[0347] Zinc finger nucleases (ZFNs)

[0348] "Zinc finger nucleases" or "ZFNs" are fusions between the cleavage domain of FokI and a DNA recognition domain containing three or more zinc finger motifs. Heterodimerization of two individually ZFNs at specific locations in the DNA with precise orientation and spacing results in double-strand breaks. In some cases, the ZFN fuses the cleavage domain to the C-terminus of each zinc finger domain. To allow the two cleavage domains to dimerize and cleave the DNA, the two individually ZFNs bind to opposite DNA strands with their C-termini spaced apart. In some cases, the linker sequence between the zinc finger domain and the cleavage domain requires a 5' edge spacing of approximately 5-7 bp at each binding site. Exemplary ZFNs that can be used in this invention include, but are not limited to, Urnov et al., Nature Reviews Genetics, 2010, 11:636-646; Gaj et al., Nat. Methods, 2012, 9(8):805-7; US Patent Nos. 6,534,261, 6,607,882, 6,746,838, 6,794,136, 6,824,978, 6,866,997, 6,933,113, 6,979,539, 7,013,219, and 7 Those described in U.S. Patent Application Publications Nos. 030,215, 7,220,719, 7,241,573, 7,241,574, 7,585,849, 7,595,376, 6,903,185, 6,479,626, and U.S. Patent Application Publications Nos. 2003 / 0232410 and 2009 / 0203140. In some embodiments, the ZFN is a zinc finger nicking enzyme, and in some embodiments, the zinc finger nicking enzyme is an engineered ZFN that induces site-specific single-strand DNA breaks or nicks. Descriptions of zinc finger nicking enzymes can be found, for example, Ramirez et al., Nucl Acids Res, 2012, 40(12):5560-8; Kim et al., Genome Res, 2012, 22(7):1327-33.

[0349] TALEN

[0350] “TALEN” or “TAL effector nuclease” is an engineered transcription activator-like effector nuclease containing a central domain of a DNA-binding tandem repeat sequence, a nuclear localization signal, and a C-terminal transcription activation domain. In some cases, the DNA-binding tandem repeat sequence is 33-35 amino acids long and contains two hypervariable amino acid residues at positions 12 and 13 that recognize one or more specific DNA base pairs. TALENs are generated by fusing the TAL effector DNA-binding domain with a DNA cleavage domain. For example, TALE proteins can be fused with nucleases such as wild-type or mutant FokI endonucleases or the catalytic domain of FokI. Several mutations have been performed on FokI for use in TALENs, which, for example, improve cleavage specificity or activity. Such TALENs are engineered to bind any desired DNA sequence. TALENs are commonly used to generate genetic modifications by creating double-strand breaks in a target DNA sequence, which then undergo NHEJ or HDR. In some cases, a single-stranded donor DNA repair template is provided to facilitate HDR. Detailed descriptions of TALEN and its use in gene editing can be found, for example, in U.S. Patent Nos. 8,440,431; 8,440,432; 8,450,471; 8,586,363; and 8,697,853; Scharenberg et al., Curr Gene Ther, 2013, 13(4):291-303; Gaj et al., Nat Methods, 2012, 9(8):805-7; Beurdeley et al., Nat Commun, 2013, 4:1762; and Joung and Sander, Nat Rev Mol Cell Biol, 2013, 14(l):49-55.

[0351] Guided nuclease

[0352] A "DNA-guided nuclease" is a nuclease that uses complementary nucleotides of single-stranded DNA to guide the nuclease to the correct location in the genome by hybridization with another nucleic acid (e.g., a target nucleic acid in the cell's genome). In some embodiments, the DNA-guided nuclease comprises an Argonaute nuclease. In some embodiments, the DNA-guided nuclease is selected from TtAgo, PfAgo, and NgAgo. In some embodiments, the DNA-guided nuclease is NgAgo.

[0353] Meganuclease

[0354] "Meganuclease" is a rare cleaving endonuclease or homing endonuclease that is highly specific in some implementations and recognizes DNA target sites with a length range of at least 12 base pairs, for example, 12 to 40 base pairs or 12 to 60 base pairs.

[0355] This document contemplates the use of any meganuclease, including but not limited to I-Scel, I-Scell, I-SceIII, I-SceIV, I-SceV, I-SceVI, I-SceVII, I-CeuI, I-CeuAIIP, I-CreI, I-Crepsb1P, I-Crepsb2P, I-Crepsb3P, I-Crepsb4P, I-TliI, I-PpoI, PI-PspI, F-Scel, F-Scell, F-SuvI, F-TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoI, I-CpaI, I-CpaII, I-CsmI, I-CvuI, I-CvuAIP, I-DdiI, I-DdiII, I-DirI, I-DmoI, I-HmuI, I-HmuII, I-HsNIP, I-LlaI, I-MsoI, I-NaaI, I-NanI, I-NcIIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, I-PakI, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-PgrIP, 1-PobIP, I-PorI, I-PorIIP, I-PbpIP, I-SpBetaIP, I-ScaI, I-SexIP, 1-SneIP, I-SpomI, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp6803I, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I-TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, 1-ZbiIP, PI-MtuI, PI-MtuHIP, PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, Pl-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, PI-THII, I-CreI meganuclease, I-CeuI meganuclease, I-MsoI meganuclease, I-Scel meganuclease or any active variant, fragment, mutant or derivative thereof.

[0356] CRISPR

[0357] The CRISPR (clustered regularly spaced short palindromic repeats) / Cas (CRISPR-associated proteins) nuclease system is an engineered nuclease system based on bacterial systems used for genome engineering. It is partly based on the adaptive immune response of many bacteria and archaea. When a virus or plasmid invades a bacterium, a segment of the invader's DNA is converted into CRISPR RNA (crRNA) through an "immune" response. The crRNA is then associated with another type of RNA, called tracrRNA, via a partially complementary region to guide a Cas (e.g., Cas9) nuclease to a region homologous to the crRNA in the target DNA, called the "interstitial region." The Cas (e.g., Cas9) nuclease cleaves the DNA to produce blunt ends at double-strand breaks at sites specified by a 20-nucleotide complementary strand sequence contained within the crRNA transcript. In some implementations, the Cas (e.g., Cas9) nuclease requires both crRNA and tracrRNA for site-specific DNA recognition and cleavage. The system has now been engineered such that, in some implementations, crRNA and tracrRNA are combined into a single molecule (“single guide RNA” or “sgRNA”), and the crRNA equivalent portion of the single guide RNA is engineered to guide a Cas (e.g., Cas9) nuclease to target any desired sequence (see, for example, Jinek et al. (2012) Science 337:816-821; Jinek et al. (2013) eLife 2:e00471; Segal (2013) eLife2:e00563).

[0358] As used herein, tracRNA is also defined as scaffold gRNA. Therefore, the CRISPR / Cas system can be engineered to generate double-strand breaks at desired targets in the cell's genome and utilize the cell's endogenous mechanisms to repair the induced breaks via homologous directed repair (HDR) or non-homologous end joining (NHEJ). In some embodiments, the Cas nuclease has DNA cleavage activity. In some embodiments, the Cas nuclease directs the cleavage of one or both strands at a location in the target DNA sequence. For example, in some embodiments, the Cas nuclease is a nicking enzyme having one or more inactivating catalytic domains that cleave the single strand of the target DNA sequence. Non-restrictive examples of Cas nucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Cpf1, C2c3, C2c2 and C2c1, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, and C Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Cpf1, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, their homologs, their variants, their mutants, and their derivatives. Three main types of Cas nucleases (types I, II, and III) and 10 subtypes exist, including 5 type I, 3 type II, and 2 type III proteins (see, e.g., Hochstrasser and Doudna, Trends Biochem Sci, 2015:40(l):58-66). Type II Cas nucleases include, but are not limited to, Cas1, Cas2, Csn2, and Cas9. These Cas nucleases are known to those skilled in the art. For example, the amino acid sequence of the wild-type Cas9 polypeptide from *Streptococcus pyogenes* is listed, for example, in NBCI Ref.Seq.No. NP 269215, and the amino acid sequence of the wild-type Cas9 polypeptide from *Streptococcus thermophilus* is listed, for example, in NBCI Ref.Seq.No. WP_011681470. In some embodiments, the Cas nuclease, for example, the Cas9 polypeptide, is derived from multiple bacterial species. “Cas9” refers to an RNA-guided double-stranded DNA-binding nuclease or cleavage enzyme protein. The wild-type Cas9 nuclease has two functional domains that cleave different DNA strands, for example, RuvC and HNH. When both functional domains are active, Cas9 can induce double-strand breaks in genomic DNA (target DNA).In some embodiments, the Cas9 enzyme comprises one or more catalytic domains derived from Cas9 proteins of bacteria belonging to the group consisting of: Corynebacterium, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, and Campylobacter. In some implementations, Cas9 is a fusion protein, for example, with two catalytic domains derived from different bacterial species. Useful variants of the Cas9 nuclease contain a single inactive catalytic domain, such as RuvC. - or HNH -The Cas9 nuclease is a single-stranded enzyme or nicking enzyme. In some embodiments, the Cas9 nicking enzyme has only one active functional domain and, in some implementations, cleaves only one strand of the target DNA, resulting in a single-strand break or nick. In some implementations, a mutant Cas9 nuclease having at least the D10A mutation is a Cas9 nicking enzyme. In other implementations, a mutant Cas9 nuclease having at least the H840A mutation is a Cas9 nicking enzyme. Other examples of mutations present in Cas9 nicking enzymes include, but are not limited to, N854A and N863A. Double-strand breaks are introduced using a Cas9 nicking enzyme if at least two DNA-targeting RNAs targeting opposite DNA strands are used. Double-nicking induced double-strand breaks are repaired via NHEJ or HDR. This gene-editing strategy favors HDR and reduces the frequency of insertion / deletion mutations at off-target DNA sites. In some implementations, the Cas9 nuclease or nicking enzyme is codon-optimized for the target cell or target organism. In some implementations, the Cas nuclease is a Cas9 polypeptide containing two silent mutations (D10A and H840A) of the RuvCl and HNH nuclease domains, referred to as dCas9. In one embodiment, the dCas9 polypeptide from *Streptococcus pyogenes* contains at least one mutation at positions D10, G12, G17, E762, H840, N854, N863, H982, H983, A984, D986, A987, or any combination thereof. Descriptions of such dCas9 polypeptides and variants thereof are provided, for example, in International Patent Publication No. WO 2013 / 176772. In some embodiments, the dCas9 enzyme contains a mutation at D10, E762, H983, or D986, and a mutation at H840 or N863. In some cases, the dCas9 enzyme contains a D10A or D10N mutation. Furthermore, the dCas9 enzyme optionally contains mutations H840A, H840Y, or H840N. In some embodiments, the dCas9 enzyme of the present invention comprises D10A and H840A; D10A and H840Y; D10A and H840N; D10N and H840A; D10N and H840Y; or D10N and H840N substitutions. The substitutions may optionally be conserved or non-conserved substitutions to render the Cas9 polypeptide inactive and capable of binding to target DNA. For genome editing methods, in some embodiments, the Cas nuclease comprises a Cas9 fusion protein, such as a polypeptide containing the catalytic domain of the IIS-type restriction enzyme Fok1 linked to dCas9. The FokI-dCas9 fusion protein (fCas9) can use two guide RNAs to bind to a single strand of target DNA to produce a double-strand break.

[0359] Target sequence

[0360] The target sequence described herein is a nucleic acid sequence that is recognized and cleaved by a nuclease. In some embodiments, the target sequence is about 9 to about 12 nucleotides in length, about 12 to about 18 nucleotides in length, about 18 to about 21 nucleotides in length, about 21 to about 40 nucleotides in length, about 40 to about 80 nucleotides in length, or any combination of subranges (e.g., 9-18, 9-21, 9-40, and 9-80 nucleotides). In some embodiments, the target sequence contains a nuclease binding site. In some embodiments, the target sequence contains a cleavage / breaking site. In some embodiments, the target sequence contains a pre-intermediate adjacent motif (PAM) sequence. In some embodiments, the target nucleic acid sequence (e.g., the pre-intermediate region) is 20 nucleotides long. In some embodiments, the target nucleic acid is less than 20 nucleotides long. In some embodiments, the target nucleic acid is at least 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid is at most 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid sequence is 16, 17, 18, 19, 20, 21, 22 or 23 bases at the 5' end immediately adjacent to the first nucleotide of the PAM. In some embodiments, the target nucleic acid sequence is 16, 17, 18, 19, 20, 21, 22 or 23 bases at the 3' end immediately adjacent to the last nucleotide of the PAM. In some embodiments, the target nucleic acid sequence is the 20 bases at the 5' of the first nucleotide immediately adjacent to the PAM. In some embodiments, the target nucleic acid sequence is the 20 bases at the 3' of the last nucleotide immediately adjacent to the PAM. In some embodiments, the target nucleic acid sequence is at the 5' or 3' of the PAM. In some embodiments, the targeting sequence comprises a nucleic acid sequence present in the target nucleic acid that binds to a nucleic acid targeting segment of the complementary strand nucleic acid. For example, in some embodiments, the targeting sequence comprises a sequence of the complementary strand nucleic acid designed to have base pairing with it. The targeting sequence comprises a cleavage site of a nuclease. In some embodiments, the targeting sequence is adjacent to the cleavage site of a nuclease. In some embodiments, the nuclease cleaves the nucleic acid at a site inside or outside the nucleic acid sequence present in the target nucleic acid that binds to the nucleic acid targeting sequence of the complementary strand. In some embodiments, the cleavage site comprises the location in which the nuclease produces a single-strand break or a double-strand break in the nucleic acid.For example, the formation of a nuclease complex comprising a complementary strand of nucleic acid that hybridizes to and complexes with a protease recognition sequence results in cleavage of one or both strands of the nucleic acid sequence present in the target nucleic acid and bound to the spacer region of the complementary strand (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 19, 20, 23, 50 or more base pairs). In some embodiments, the cleavage site is on only one strand of the nucleic acid or on both strands. In some embodiments, the cleavage site is at the same location on both strands of the nucleic acid (producing blunt ends) or at different locations on each strand (producing staggered ends). In some embodiments, site-specific cleavage of the target nucleic acid by the nuclease occurs at a location determined by the base pairing complementarity between the complementary strand of the nucleic acid and the target nucleic acid. In some embodiments, site-specific cleavage of the target nucleic acid by the nuclease protein occurs at a location in the target nucleic acid determined by a short motif called a preinterspace neighbor motif (PAM). For example, the PAM is flanked by the nuclease recognition sequence at the 3' end of the recognition sequence. In some cases, cleavage produces blunt ends. In others, cleavage produces staggered or sticky ends with 5' protrusions. In still others, cleavage produces staggered or sticky ends with 3' protrusions. Orthologs of various nuclease proteins utilize different PAM sequences. For example, in some embodiments, different Cas proteins recognize different PAM sequences. For instance, in *Streptococcus pyogenes*, the PAM is a sequence containing the sequence 5'-XRR-3' in the target nucleic acid, where R is A or G, X is any nucleotide, and X is immediately adjacent to the 3' of the target nucleic acid sequence targeted by the spacer sequence. The PAM sequence of *Streptococcus pyogenes* Cas9 (SpyCas9) is 5'-XGG-3', where X is any DNA nucleotide and is immediately adjacent to the 3' of the nuclease recognition sequence on the non-complementary strand of the target DNA. The PAM of Cpf1 is 5'-TTX-3', where X is any DNA nucleotide and is immediately adjacent to the 5' of the nuclease recognition sequence. Preferably, the Cas9 / sgRNA complex introduces a DSB three base pairs upstream of the PAM sequence in the genomic target sequence, resulting in two blunt ends. An identical Cas9 / sgRNA target sequence is then loaded backwards onto the donor DNA. The targeted genomic locus and the donor DNA are cleaved by the Cas9 / gRNA, and the linearized donor DNA is integrated into the target site via the NHEJ DSB repair pathway. If the donor DNA is integrated in the correct orientation, the linker sequence is protected from further cleavage by the Cas9 / gRNA. If the donor DNA is integrated in the opposite orientation, the Cas9 / gRNA will excise the integrated donor DNA due to the presence of an intact Cas9 / gRNA target site.

[0361] In an embodiment of the present invention, PAM has a sequence selected from TGG, AGG, GGG, and CGG.

[0362] carrier

[0363] The present invention also relates to vectors comprising nucleic acid constructs as described herein.

[0364] Therefore, such vectors can contain any of the elements described above regarding the construct. In particular, such vectors can contain one or more regulatory elements, including, for example, promoters, transcription termination sequences, translation termination sequences, enhancers, signal peptides, degradation signals, and polyadenylation elements, especially as defined above.

[0365] This invention covers vectors suitable for delivering and expressing nucleic acids into cells for gene therapy.

[0366] The vectors of this invention include viral and non-viral vectors.

[0367] Non-viral vectors include non-viral agents commonly used to introduce or maintain nucleic acids into cells. These agents particularly include polymer-based, particle-based, lipid-based, peptide-based delivery media or combinations thereof, such as cationic polymers, micelles, liposomes, exosomes, microparticles, and nanoparticles including lipid nanoparticles (LNPs).

[0368] In viral delivery, genetically engineered viruses, including adeno-associated viruses (AAVs), are among the most popular tools for gene delivery. The concept of virus-based gene delivery involves engineering viruses to express genes of interest or regulatory sequences such as promoters and introns. Depending on the specific application and virus type, most viral vectors contain mutations that inhibit their ability to replicate freely in the host as wild-type viruses. Viruses from several different families have been modified to produce viral vectors for gene delivery. These viruses include retroviruses, lentiviruses, adenoviruses, AAVs, herpesviruses, baculoviruses, piconeviruses, and alphaviruses.

[0369] The viral vector of the present invention can be derived from non-pathogenic parvoviruses such as adeno-associated virus (AAV), retroviruses such as gamma retrovirus, foam virus and lentivirus, adenovirus, poxvirus and herpesvirus.

[0370] The viruses particularly preferred according to the present invention are lentiviruses and adeno-associated viruses.

[0371] According to a process called viral transduction, viral vectors are essentially able to penetrate cells and deliver nucleic acids of interest into the cells.

[0372] As used herein, the term "viral vector" refers to a non-replicating, non-pathogenic virus engineered for the delivery of genetic material into cells. Viral genes essential for replication and virulence are replaced by expression cassettes of the transgene of interest. Thus, the viral vector genome contains a transgene expression cassette flanked by the viral sequence required to generate the viral vector.

[0373] The term “viral particle” or “viral particle” is intended to refer to a non-pathogenic virus, particularly the extracellular form of a viral vector, which contains genetic material made of DNA or RNA surrounded by a protein coat (called a capsid), and in some cases, an envelope derived from the host cell membrane and including viral glycoproteins.

[0374] As used in this article, viral vector also refers to viral vector particles.

[0375] The viral vectors covered by this invention are suitable for gene therapy.

[0376] Viral particles can be obtained, for example, using vectors capable of containing genes of interest and helper cells capable of providing viral structural proteins and enzymes to allow the production of vector-containing infectious viral particles.

[0377] Adeno-associated virus (AAV)

[0378] Adeno-associated viruses (AAVs) are a family of viruses that differ in nucleotide and amino acid sequences, genomic structure, pathogenicity, and host range. This diversity provides opportunities to develop different therapeutic applications using viruses with different biological characteristics.

[0379] Ideal adeno-associated virus (AAV)-based vectors for gene delivery must be efficient, cell-specific, modulated, and safe. Delivery efficiency can determine the efficacy of a therapy. Current efforts aim to achieve cell-type-specific infection and gene expression using AAV vectors. Furthermore, AAV vectors are being developed to modulate the expression of genes of interest, as treatment may require long-term or modulated expression.

[0380] Adeno-associated virus (AAV) is a small virus that infects humans and some other primate species. It is currently unclear whether AAV causes disease and therefore elicits a very mild immune response. Gene therapy vectors using AAV can infect both dividing and quiescent cells and persist in an extrachromosomal state without integrating into the host cell's genome. These characteristics make AAV a very attractive candidate for generating viral vectors for gene therapy and for creating syngeneic human disease models.

[0381] Wild-type AAV has attracted considerable interest from gene therapy researchers due to many characteristics. Most notably, the virus is remarkably lacking in pathogenicity. It can also infect non-dividing cells and possesses the ability to stably integrate into the host cell genome at a specific site on human chromosome 19 (designated AAVS1). However, the development of AAV as a gene therapy vector has eliminated this integration ability by removing the rep and cap from the vector's DNA. After the single-stranded vector DNA is converted into double-stranded DNA by the host cell's DNA polymerase complex, the desired gene, along with the promoter driving gene transcription, is inserted between ITRs that facilitate the formation of polymorphs in the cell nucleus. AAV-based gene therapy vectors form free polymorphs in the host cell nucleus. In non-dividing cells, these polymorphs remain intact throughout the host cell's lifetime. In dividing cells, AAV DNA is lost through cell division because the free DNA does not replicate with the host cell DNA. Random integration of AAV DNA into the host genome is detectable, but occurs very infrequently. AAV also exhibits very low immunogenicity, appearing to be limited to the production of neutralizing antibodies, while inducing undefined cytotoxic responses. This characteristic, along with the ability to infect quiescent cells, makes AAV particularly suitable for human gene therapy.

[0382] The AAV genome consists of single-stranded deoxyribonucleic acid (ssDNA) of either sense or negative sense, approximately 4.7 kilobases in length. The genome contains inverted terminal repeats (ITRs) at both ends of the DNA strand and two open reading frames (ORFs): rep and cap. The former consists of four overlapping sequences encoding the Rep protein, required for the AAV life cycle, while the latter contains overlapping nucleotide sequences of capsid proteins: VP1, VP2, and VP3, which interact to form an icosahedral symmetric capsid.

[0383] Inverted terminal repeat (ITR) sequences are named for their symmetry, which has proven essential for efficient proliferation of the AAV genome. Another property of these sequences is their ability to form hairpins, which facilitates so-called self-initiation, allowing for the primase-independent synthesis of the second DNA strand. ITRs have also been shown to be necessary for efficient capsidation of AAV DNA, along with the production of fully assembled deoxyribonuclease-resistant AAV particles.

[0384] Regarding gene therapy, the ITR appears to be the only required cis sequence adjacent to the therapeutic gene: capable of trans-delivering both the cap and rep gene. Based on this hypothesis, numerous methods have been developed for efficiently generating recombinant AAV (rAAV) vectors containing reporter or therapeutic genes.

[0385] AAV vectors contain an AAV capsid capable of transducing target cells of interest. The AAV capsid can be derived from one or more natural or artificial AAV serotypes.

[0386] AAV can be referred to by its serotype. A serotype corresponds to a variant subspecies of AAV, which possesses unique reactivity that can be used to distinguish it from other variant subspecies due to the expression profile of its capsid surface antigens. Typically, AAV carrier particles with a specific AAV serotype do not effectively cross-react with neutralizing antibodies specific to any other AAV serotype.

[0387] All known serotypes can infect cells from a wide variety of tissue types. Tissue specificity is determined by the capsid serotype, and pseudotyping of AAV vectors to alter their tropism range affects their use in therapy.

[0388] The inverted terminal repeat (ITR) sequence used in the AAV vector system of the present invention can be any AAV ITR. The ITRs used in the AAV vector can be the same or different. For example, the vector can contain an ITR of AAV serotype 2 and an ITR of AAV serotype 5. In one embodiment of the vector of the present invention, the ITR is derived from AAV serotype 2, 4, 5 or 8. In the present invention, the ITR of AAV serotype 2 is preferred. AAV ITR sequences are well known in the art (e.g., for ITR2, see GenBank accession number AF043303.1; NC_001401.2; J01901.1; JN898962.1; for ITR5, see GenBank accession number NC_006152.1).

[0389] Serotype 2 (AAV2) is the most widely examined to date. AAV2 exhibits a natural tropism for skeletal muscle, neurons, vascular smooth muscle cells, and hepatocytes.

[0390] Three cellular receptors have been described for AAV2: heparan sulfate proteoglycan (HSPG), avβ5 integrin, and fibroblast growth factor receptor 1 (FGFR-1). The former functions as the primary receptor, while the latter two have co-receptor activity and enable AAV to enter cells via receptor-mediated endocytosis. HSPG functions as the primary receptor, but its abundance in the extracellular matrix can clear AAV particles and impair infection efficiency.

[0391] Although AAV2 is the most popular serotype in various AAV-based studies, other serotypes have been shown to be effective gene delivery vectors. For example, AAV6 performs much better in infecting airway epithelial cells, AAV7 shows very high transduction rates in mouse skeletal muscle cells (similar to AAV1 and AAV5), AAV8 performs well in transducing hepatocytes and photoreceptors, and AAV1 and AAV5 have shown great effectiveness in gene delivery to vascular endothelial cells. In the brain, most AAV serotypes exhibit neuronal tropism, while AAV5 also transduces astrocytes. The hybrid AAV6, a conjugate of AAV1 and AAV2, also shows lower immunogenicity than AAV2.

[0392] Serotypes can differ in the receptors they bind to. For example, AAV4 and AAV5 transduction can be inhibited by soluble sialic acid (which has a different form for each of these serotypes), and AAV5 has been shown to enter cells via platelet-derived growth factor receptors.

[0393] Methods for preparing viruses and viral particles containing heterologous polynucleotides or constructs are known in the art. In the case of AAV, cells can be co-infected or transfected with adenovirus or a polynucleotide construct containing adenovirus genes suitable for AAV helper functions. Examples of materials and methods are described, for example, in U.S. Patent Nos. 8,137,962 and 6,967,018. The AAV virus or AAV vector of the present invention can be any AAV serotype, including but not limited to serotypes AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10 and AAV11, AAV-PhP.B and AAV-PhP.eB.

[0394] In some implementations, serotypes AAV2, AAV5, AAV7, AAV8, or AAV9 are used. Preferably, AAV2-8 is used.

[0395] Suitablely, the AAV genome is derivatized for the purpose of administration to a patient. Such derivatization is standard in the art, and the present invention covers the use of any known derivatives of the AAV genome, as well as derivatives that can be produced by applying techniques known in the art. The AAV genome can be a derivative of any naturally occurring AAV. Suitablely, the AAV genome is a derivative of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or AAV11.

[0396] Derivatives of the AAV genome include any truncated or modified form of the AAV genome that allows for the in vivo expression of transgenes derived from the AAV vector of the present invention. In one embodiment, the AAV serotype provides one or more tyrosine-to-phenylalanine (YF) mutations on the capsid surface.

[0397] The DNA construct described above can be used to generate the AAV vector of the present invention. The AAV vector can be generated, for example, by triple transfection of production cells (such as HEK293 cells), a method known in the art, wherein a plasmid containing the gene of interest is transfected into the production cells along with two additional plasmids, and viral particles are then generated therein.

[0398] plasmid

[0399] Plasmids used to generate viral vectors as defined herein are also within the scope of this invention.

[0400] Plasmids may contain DNA constructs as described above. Plasmids also typically contain backbone elements usually required for large-scale plasmid production in bacteria, such as bacterial origins of replication, bacterial promoters, and antibiotic resistance genes.

[0401] The use of the plasmid for generating the vector according to the invention is within the scope of this invention.

[0402] Vectors (e.g., AAV vectors) can be generated, for example, by triple transfection of production cells (such as HEK293 cells), a method known in the art, in which a plasmid containing the DNA construct of interest is transfected into the production cells along with two additional plasmids, and viral particles are then generated therein.

[0403] HITIDNA Genome Editing System

[0404] As used herein, a “genome editing system” is a system containing all the components necessary for editing a genome, preferably using the constructs or vectors of the present invention.

[0405] In this invention, the genome editing system comprises: a donor nucleic acid containing a foreign DNA sequence and optionally one or more exons of an albumin gene; a complementary oligonucleotide homologous to a target sequence, such as a gRNA homologous to a target sequence within the albumin gene, preferably within introns 12, 13, or 14 of the albumin gene as defined herein; and a nuclease that recognizes the target sequence.

[0406] Suitable, the genome editing system of the present invention comprises the nucleotide sequence, DNA construct, vector (e.g., non-viral or viral vector) and / or viral particles of the present invention.

[0407] host cells

[0408] This invention also relates to host cells comprising the viral vector of the invention. The host cell may be a cultured cell or a primary cell (i.e., directly isolated from an organism such as the human body). The host cell may be an adherent cell or a suspension cell (i.e., a cell grown in a suspension). Suitable host cells are known in the art and include, for example, DH5α, E. coli cells, Chinese hamster ovary cells, monkey VERO cells, COS cells, HEK293 cells, etc. The cell may be a human cell or a cell from another animal. In one embodiment, the cell is a retinal cell, particularly a photoreceptor cell, RPE cell, or cone cell. The cell may also be a liver cell, particularly a hepatocyte. Based on the teachings herein, the selection of a suitable host is considered to be within the capabilities of those skilled in the art. Preferably, the host cell is an animal cell, and most preferably a human cell. The cell may express the nucleotide sequence provided in the viral vector of the invention.

[0409] Those skilled in the art are familiar with standard methods for incorporating polynucleotides or vectors into host cells, such as transfection, lipid transfection, electroporation, microinjection, viral infection, heat shock, transformation after membrane chemical permeation, or cell fusion.

[0410] As used herein, the term "host cell or genetically engineered host cell" refers to a host cell that has been transduced, transformed, or transfected with the viral vector of the present invention.

[0411] Composition

[0412] Pharmaceutical compositions within the scope of this invention comprise the system of the invention, one or more carriers, host cells, or viral particles in combination with pharmaceutically acceptable carriers, diluents, excipients, or adjuvants. The choice of drug carrier, excipient, or diluent can be made with regard to the intended route of administration and standard pharmaceutical practice. Pharmaceutical compositions may contain any suitable binder, lubricant, suspending agent, coating agent, solubilizer, or other carrier, excipient, or diluent, or other carrier agents that can facilitate or increase viral entry into target sites (such as, for example, lipid delivery systems). The carrier can be administered in vivo or ex vivo.

[0413] A pharmaceutical composition containing a certain amount of the compound suitable for parenteral administration constitutes a preferred embodiment of the invention. For parenteral administration, the composition may preferably be used in the form of a sterile aqueous solution, which may contain other substances, such as sufficient salts or monosaccharides, to make the solution isotonic with blood. In a preferred embodiment, the carrier or pharmaceutical composition is delivered systemically, for example by intravenous injection.

[0414] The methods of this invention can be used in humans and other animals. As used herein, the terms "patient" and "subject" are used interchangeably and are intended to include such human and non-human species. Similarly, the in vitro methods of this invention can be obtained in cells of such human and non-human species.

[0415] Reagent test kit

[0416] This invention also relates to kits containing the DNA constructs, systems, one or more vectors, host cells, or viral particles of the present invention in one or more containers. The kits of the present invention may optionally contain pharmaceutically acceptable carriers and / or diluents. In one embodiment, the kits of the present invention contain one or more other components, adjuncts, or adjuvants as described herein. In one embodiment, the kits of the present invention contain instructions or packaging materials describing how to administer the kit to the vector system. The containers of the kits may be any suitable material, such as glass, plastic, metal, etc., and may be any suitable size, shape, or configuration. In one embodiment, the viral vector or host cell of the present invention is provided in the kit as a solid. In another embodiment, the viral vector or host cell of the present invention is provided in the kit as a liquid or solution. In one embodiment, the kit comprises ampoules or syringes containing the viral vector or host cell of the present invention in liquid or solution form.

[0417] deliver

[0418] The vectors of the present invention can be administered to patients. The administration can be "in vivo" or "ex vivo." Those skilled in the art will be able to determine the appropriate dose rate. The term "administration" includes delivery via viral or non-viral technologies. Viral delivery mechanisms include, but are not limited to, adenovirus vectors, adeno-associated virus (AAV) vectors, herpesvirus vectors, retrovirus vectors, lentivirus vectors, and baculovirus vectors as described above. Non-viral delivery systems include polymer-based, particle-based, lipid-based, peptide-based delivery media or combinations thereof, such as cationic polymers, micelles, liposomes, exosomes, microparticles, and nanoparticles including lipid nanoparticles (LNPs), DNA transfection such as electroporation. Delivery of one or more therapeutic genes via the vector system according to the present invention can be used alone or in combination with other therapeutic or therapeutic components.

[0419] Any suitable delivery method is contemplated for delivering the compositions of this disclosure. In some embodiments, the individual components of the HITI genome editing system (e.g., gRNA, nuclease, and / or exogenous DNA sequence) are delivered simultaneously or separately in time. The choice of method for genetic modification depends on the type of cells being transformed and / or the environment in which the transformation occurs (e.g., in vitro, ex vivo, or in vivo). A general discussion of these methods can be found in Ausubel et al., Short Protocols in Molecular Biology, 3rd Edition, Wiley & Sons, 1995.

[0420] The term “contacting cells” encompasses all delivery methods disclosed herein. In some embodiments, methods such as those disclosed herein involve contacting target DNA with one or more nucleic acids or introducing one or more nucleic acids into cells (or cell populations), said one or more nucleic acids comprising nucleotide sequences encoding complementary strand nucleic acids (e.g., gRNA), site-modified polypeptides (e.g., Cas proteins), or their encoding nucleic acids and / or exogenous DNA sequences.

[0421] Methods of genome DNA editing

[0422] The term “genome editing” refers to a type of genetic engineering in which one or more nucleases and / or nickases are used to insert, replace or remove DNA from a target DNA (e.g., the genome of a cell).

[0423] This document provides homology-independent targeted integration (HITI) methods and compositions for altering nucleic acids, such as genomic DNA, including genomic DNA in dividing, non-dividing, or terminally differentiated cells. At least in some embodiments, the methods of this document are homology-independent, using non-homologous end joining to insert exogenous DNA into target DNA, such as the genomic DNA of a cell, such as a dividing, non-dividing, or terminally differentiated cell. In some embodiments, the methods of this document include a method of integrating an exogenous DNA sequence into the genome of a dividing or non-dividing cell, the method comprising contacting the non-dividing cell with a composition comprising one or more targeting constructs, the targeting construct comprising an exogenous DNA sequence and a target sequence, a complementary oligonucleotide homologous to the target sequence, and a nuclease, wherein the exogenous DNA sequence contains at least one nucleotide difference compared to the genome, and the target sequence is recognized by the nuclease. In some embodiments of the HITI methods disclosed herein, the exogenous DNA sequence is a fragment of DNA containing a desired sequence in the genome of a target cell or host cell to be inserted. At least a portion of the foreign DNA sequence has a sequence homologous to a portion of the genome of the target cell or host cell, and at least a portion of the foreign DNA sequence has a sequence dislogged from a portion of the genome of the target cell or host cell. For example, in some embodiments, the foreign DNA sequence may include a portion of the host cell genomic DNA sequence in which a mutation exists. Thus, when the foreign DNA sequence is integrated into the genome of the host cell or target cell, the mutation found in the foreign DNA sequence is carried into the host cell or target cell genome. In some embodiments of the HITI method disclosed herein, the flanking element of the foreign DNA sequence is at least one target sequence. In some embodiments, the flanking element of the foreign DNA sequence is two target sequences. The target sequence contains a specific DNA sequence recognized by at least one nuclease. In some embodiments, the target sequence is recognized by the nuclease in the presence of a complementary oligonucleotide having a sequence homologous to the target sequence. In some embodiments, in the HITI method disclosed herein, the target sequence contains a nucleotide sequence that is recognized and cleaved by a nuclease. Nucleases that recognize target sequences are known to those skilled in the art and include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly spaced short palindromic repeats (CRISPR) nucleases. In some embodiments, a ZFN comprises a zinc finger DNA-binding domain and a DNA cleavage domain fused together to produce a sequence-specific nuclease. In some embodiments, a TALEN comprises a TAL effector DNA-binding domain and a DNA cleavage domain fused together to produce a sequence-specific nuclease.In some implementations, CRISPR nucleases are naturally occurring nucleases that recognize DNA sequences homologous to clustered, regularly spaced short palindromic repeats typically found in prokaryotic DNA. CRISPR nucleases include, but are not limited to, Cas9, Cpf1, C2c3, C2c2, and C2c1. Conveniently, the Cas9 of the present invention is a variant with reduced off-target activity, such as SpCas9 D10A (Ran, FA et al., Genome engineering using the CRISPR-Cas9 system. Nat Protoc, 2013.8(11): pp. 2281-2308) (with RuvC domain cleavage activity inactivated), SpCas9 N863A (Ran, FA et al., Genome engineering using the CRISPR-Cas9 system. Nat Protoc, 2013.8(11): pp. 2281-2308) (with HNH domain cleavage activity inactivated), and SpCas9-HF1 (Kleinstiver, BP et al., High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide). off-target effects. Nature, 2016, 529(7587): 490-5 (reducing Cas9 binding energy through protein engineering), eSpCas9 (laymaker, IM et al., Rationally engineered Cas9 nucleases with improved specificity. Science, 2016, 351(6268): 84-8) (reduction of positive charge of Cas9), EvoCas9 (asini, A. et al., A highly specific SpCas9 variant is identified by in vivoscreening in yeast. Nat Biotechnol, 2018, 36(3): 265-271) (mutation of REC3 domain), KamiCas9 (Merienne, N. et al., The Self-Inactivating KamiCas9 System for the Editing of CNSDisease Genes. Cell Rep, 2017, 20(12): 2980-2991) (cas9 knockout after expression).

[0424] In some embodiments, the HITI DNA genome editing method disclosed herein is capable of introducing exogenous DNA sequences into a host genome or a target genome. In some embodiments, the insertion comprises a specific number of nucleotides ranging from 1 to 4,700 base pairs, such as 1-10, 5-20, 15-30, 20-50, 40-80, 50-100, 100-1000, 500-2000, or 1000-4,700 base pairs. In some embodiments, the method includes the removal of at least one gene or a fragment thereof from the host genome or the target genome, such as one or more exons or fragments thereof. In some embodiments, the method includes introducing a exogenous gene (also defined herein as an exogenous DNA sequence or a gene of interest) or a fragment thereof into the host genome or the target genome. The HITI genome editing method disclosed herein has increased capability in altering genomic DNA in both dividing and non-dividing cells. Non-dividing cells include, but are not limited to: cells in the central nervous system, including neurons, oligodendrocytes, microglia, and ependymal cells; sensory transduction cells; autonomic neurons; supporting cells of sensory organs and peripheral neurons; cells in the retina, including photoreceptors, rod cells, and cone cells; cells in the kidney, including parietal cells, glomerular podocytes, proximal tubule brush border cells, thin-walled segment cells of the loop of Henry, distal tubule cells, and collecting duct cells; cells in the hematopoietic lineage, including lymphocytes, monocytes, neutrophils, eosinophils, basophils, and platelets; the preferred non-dividing cells of this invention are liver cells, including hepatocytes, stellate cells, Kupffer cells, and hepatic endothelial cells, preferably hepatocytes. In some embodiments, the HITI genome editing method disclosed herein provides a method for altering genomic DNA in dividing cells, wherein the method has higher efficiency than prior methods disclosed in the art. In some embodiments, donor nucleic acids, complementary oligonucleotides, and / or polynucleotides encoding nucleases for the HITI method described herein are introduced into target cells or host cells via a virus. In some embodiments, the virus infects target cells and expresses the target construct, complementary oligonucleotides, and nucleases, which allows the foreign DNA of the target construct to be integrated into the host genome. In some embodiments, the virus includes Sendai virus, retrovirus, lentivirus, baculovirus, adenovirus, or adeno-associated virus. In some embodiments, the virus is a pseudovirus. In some embodiments, donor nucleic acids, complementary oligonucleotides, and / or polynucleotides encoding nucleases for the HITI method described herein are introduced into target cells or host cells via non-viral gene delivery methods. In some embodiments, non-viral gene delivery methods deliver genetic material (including DNA, RNA, and proteins) into target cells and express donor nucleic acids, complementary oligonucleotides, and nucleases, which allows the foreign DNA of the donor nucleic acid to be integrated into the host genome.In some implementations, non-viral methods include transfection reagents (including nanoparticles) or electroporation for DNA, mRNA, or proteins.

[0425] Methods of treating diseases

[0426] This document also provides methods and compositions for treating diseases, such as genetic diseases. Genetic diseases are those caused by mutations in genetic DNA. In some embodiments, genetic diseases are caused by mutations in genomic DNA. Genetic mutations are known to those skilled in the art and include single-base pair changes or point mutations, insertions, and deletions. In some embodiments, the methods provided herein include methods for treating a genetic disease in a subject with a corresponding need, wherein the genetic disease is caused by a mutated gene having at least one altered nucleotide compared to a wild-type gene, wherein the method includes contacting at least one cell of the subject with a composition comprising a DNA construct, a vector (e.g., a non-viral or viral vector), or a system according to the invention, such that a donor nucleic acid (comprising a foreign DNA sequence and optionally one or more exons of an albumin gene), a complementary oligonucleotide homologous to a target sequence (e.g., gRNA homologous to the target sequence), and a nuclease recognizing the target sequence are introduced into the cell, wherein the target sequence is located in a region selected from introns 9, 11, 12, 13, and 14 of the albumin gene at the 3' end of the albumin gene. Then, donor DNA was inserted into the target locus via NHEJ to reconstruct the albumin gene, and the therapeutic gene was expressed in target cells under the albumin promoter.

[0427] Genetic diseases that can be treated by the methods disclosed herein include, but are not limited to, lysosomal storage diseases, including mucopolysaccharidosis (MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVII), sphingolipid storage diseases (Fabry disease, Gaucher disease, Niemann-Pick disease, GM1 ganglioside storage disease), lipofuscin storage diseases (Barton disease, etc.), and mucolipid storage diseases; other diseases in which the liver can be used as a factory for producing and / or secreting therapeutic proteins, such as diabetes, gyral atrophy of the choroid and retina, adenosine monophosphate deficiency, hemophilia A and B, ALA dehydratase deficiency, and adrenoleukodystrophy.

[0428] The term "genome editing" refers to a type of genetic engineering in which one or more nucleases and / or nickases are used to insert, replace, or remove DNA from a target DNA (e.g., the genome of a cell).

[0429] The term "non-homologous end joining" or "NHEJ" refers to a pathway for repairing double-stranded DNA breaks in which broken ends are directly joined without the need for a homologous template.

[0430] The terms “polynucleotide,” “oligonucleotide,” “nucleic acid,” “nucleotide,” and “nucleic acid molecule” are used interchangeably to refer to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and their polymers in single-stranded, double-stranded, or multi-stranded forms. This term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and / or pyrimidine bases or other natural, chemically modified, biochemically modified, non-natural, synthetic, or derived nucleotide bases. It also includes modifications, such as by methylation and / or by capping, as well as the unmodified form of polynucleotides. More specifically, the terms "polynucleotide," "oligonucleotide," "nucleic acid," and "nucleic acid molecule" include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), any other type of polynucleotide as an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing a non-nucleotide backbone, such as polyamides (e.g., peptide nucleic acids (PNA)) and polymorpholino nucleic acids (commercially available from Anti-Virals, Inc., Corvallis, Oreg., such as Neugene), and other synthetic sequence-specific nucleic acid polymers, provided that the polymer contains nucleobases that allow for base pairing and base stacking configurations, such as those found in DNA and RNA. In some embodiments, nucleic acids may comprise mixtures of DNA, RNA, and analogues thereof. Unless specifically defined, the term includes nucleic acids containing known analogues of natural nucleotides that have similar binding properties to a reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses variants of its conserved modifications (e.g., degenerate codon substitutions), alleles, interspecific homologs, single nucleotide polymorphisms (SNPs), and complementary sequences, as well as explicitly indicated sequences. In particular, degenerate codon substitutions can be achieved by producing sequences in which the third position of one or more selected (or all) codons is replaced by a mixture of bases and / or deoxyinosine residues. The term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene. The term “gene” or “nucleotide sequence encoding a polypeptide” refers to a segment of DNA involved in the production of a polypeptide chain. DNA segments may include regions before and after the coding regions involved in the transcription / translation of the gene product and the regulation of transcription / translation (leader and tail regions), as well as intercalation sequences (introns) between individual coding segments (exons).

[0431] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably herein and refer to polymers of amino acid residues. These terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of corresponding naturally occurring amino acids, as well as to both naturally occurring and non-naturally occurring amino acid polymers. As used herein, these terms include amino acid chains of any length, including full-length proteins, where amino acid residues are linked by covalent peptide bonds.

[0432] A recombinant expression vector is a nucleic acid construct produced through recombination or synthesis, containing a series of specific nucleic acid elements that allow the transcription of a particular polynucleotide sequence within a host cell. Expression vectors can be part of a plasmid, a viral genome, or a fragment of nucleic acid. Typically, an expression vector includes a polynucleotide to be transcribed that is operatively linked to a promoter.

[0433] As used herein, the term "administration" includes oral administration, topical contact, administration as a suppository, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, or subcutaneous administration to a subject. Administration can be performed via any route, including parenteral and transmucosal (e.g., oral, sublingual, palate, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, for example, intravenous, intramuscular, intraarterial, intradermal, subcutaneous, intraperitoneal, intravenous, and intracranial administration. Other delivery methods include, but are not limited to, the use of liposomal formulations, intravenous infusion, and transdermal patches.

[0434] The term "treatment" refers to a method for obtaining a beneficial or desired outcome (including, but not limited to, therapeutic and / or preventative benefits). A therapeutic benefit is any treatment-related improvement or effect on one or more diseases, conditions, or symptoms being treated. Slowing the progression of a disease is considered a therapeutic improvement within the meaning of this invention. For preventative benefits, the composition may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject who reports one or more physiological symptoms of a disease, even if the disease, condition, or symptom may not yet be present. The terms "effective amount" or "sufficient amount" refer to an amount of reagent (e.g., DNA nuclease, etc.) sufficient to achieve a beneficial or desired outcome. A therapeutically effective amount may vary based on one or more of the following: the subject being treated and the disease condition, the subject's weight and age, the severity of the disease condition, the method of administration, etc., which can be readily determined by one of those skilled in the art. A specific amount may vary based on one or more of the following: the specific reagent selected, the target cell type, the location of the target cells in the subject, the dosing regimen to be followed, whether it is administered in combination with other compounds, the timing of administration, and the physical delivery system carrying it.

[0435] The term "pharmaceutically acceptable carrier" refers to a substance that facilitates the administration of an agent (e.g., DNA nuclease) to cells, organisms, or subjects. "Pharmaceutically acceptable carrier" refers to a carrier or excipient that can be included in a composition or formulation without causing significant adverse toxicological effects on the patient. Non-limiting examples of pharmaceutically acceptable carriers include water, NaCl, physiological saline solutions, lactated Ringer's solution, physiological sucrose, physiological glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavorings, and colorings. Those skilled in the art will recognize that other pharmaceutical carriers can be used in this invention.

[0436] Variants, derivatives, analogs and fragments

[0437] In addition to the specific proteins and nucleotides mentioned herein, this invention also covers their variants, derivatives, and fragments.

[0438] In the context of this invention, a “variant” of any given sequence is a sequence in which a particular sequence of residues (whether amino acid residues or nucleic acid residues) has been modified in a manner that causes the polypeptide or polynucleotide in question to retain at least one of its intrinsic functions. Variant sequences can be obtained by adding, deleting, substituting, modifying, replacing, and / or mutating at least one residue present in naturally occurring polypeptides or polynucleotides.

[0439] As used herein with respect to the protein or polypeptide of the present invention, the term "derivative" includes any substitution, variation, modification, replacement, deletion, and / or addition of one (or more) amino acid residues in the sequence, provided that the resulting protein or polypeptide retains at least one of its endogenous functions.

[0440] Typically, amino acid substitutions can be made, such as one, two, or three to ten or twenty substitutions, provided that the modified sequence retains the desired activity or ability. Amino acid substitutions may include the use of non-naturally occurring analogues.

[0441] The proteins used in this invention can also have deletions, insertions, or substitutions of amino acid residues, resulting in silencing changes and functionally equivalent proteins. Intentional amino acid substitutions can be made based on the similarity of residue polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilic properties, as long as endogenous function is preserved. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with similar hydrophilicity values ​​and non-polarized head groups include asparagine, glutamine, serine, threonine, and tyrosine.

[0442] For example, conservative substitutions can be performed according to the table below. Amino acids in the same block in the second column and in the same row in the third column can substitute for each other:

[0443]

[0444] Typically, variants can share some identity with wild-type amino acid sequences or wild-type nucleotide sequences.

[0445] In this document, variant sequences are considered to include amino acid sequences that are at least 50%, 55%, 65%, 75%, 85%, or 90% identical to the subject sequence, suitably at least 95%, 96%, 97%, 98%, or 99%. Although variants may also be considered based on similarity (i.e., amino acid residues having similar chemical properties / functions), in the context of this invention, it is preferred to represent them based on sequence identity.

[0446] In this document, variant sequences are considered to include nucleotide sequences that are at least 50%, 55%, 65%, 75%, 85%, or 90% identical to the subject sequence, suitably at least 95%, 96%, 97%, 98%, or 99%. While variants may also be considered based on similarity, in the context of this invention, it is preferred to represent them based on sequence identity.

[0447] Appropriately, reference to any sequence in the SEQ ID NO detailed herein that has a certain percentage of identity means a sequence that has that percentage of identity over the entire length of the SEQ ID NO.

[0448] Sequence identity comparisons can be performed visually, or more commonly with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate the percentage of identity between two or more sequences.

[0449] The percentage of identity can be calculated on consecutive sequences, that is, by aligning one sequence with another and directly comparing each amino acid or nucleotide in one sequence with its corresponding amino acid or nucleotide in the other sequence, one residue at a time. This is called "ungapped" alignment. Typically, such ungapped alignments are performed only on a relatively small number of residues.

[0450] While this is a very simple and consistent approach, it fails to account for the fact that, for example, in otherwise identical sequence pairs, an insertion or deletion in an amino acid or nucleotide sequence can cause subsequent residues or codons to misalign, potentially leading to a significant reduction in the identity percentage when performing a global alignment. Therefore, most sequence alignment methods are designed to produce optimal alignments that account for possible insertions and deletions without excessively penalizing the overall identity score. This is achieved by inserting “gaps” in the sequence alignment in an attempt to maximize local identity.

[0451] However, these more sophisticated methods assign a "vacancy penalty" to each vacancy in the alignment, so that for the same number of identical amino acids or nucleotides, a sequence alignment with the fewest possible vacancy (reflecting a higher correlation between the two compared sequences) will receive a higher score than a sequence alignment with many vacancyes. Typically, "affine gap costs" are used to charge a relatively high cost for the presence of a vacancy and a smaller penalty for each subsequent residue within the vacancy. This is the most commonly used vacancy scoring system. A high vacancy penalty will naturally result in an alignment with fewer vacancyes. Most alignment programs allow modification of the vacancy penalty. However, when using such software for sequence alignment, it is preferable to use the default values. For example, when using the GCG Wisconsin Bestfit package, the default vacancy penalty for an amino acid sequence is -12 for a vacancy and -4 for each extension.

[0452] Therefore, calculating the maximum percentage of identity first requires generating the best alignment that takes into account the gap penalty. A suitable computer program for performing such alignments is the GCG Wisconsin Bestfit package (University of Wisconsin, USA; Devereux et al. (1984) Nucleic Acids Research 12:387). Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al. (1999) ibid., Chapter 18), FASTA (Atschul et al. (1990) J. Mol. Biol. 403-410), EMBOSS Needle (Madeira, F. et al., 2019. Nucleic acids research, 47(W1), pp. W636-W641), and the GNEWORKS comparison toolset. Both BLAST and FASTA can be used for offline and online searches (see Ausubel et al. (1999) ibid., pp. 7-58-7-60). However, for certain applications, it is best to use the GCG Bestfit program. Another tool, BLAST 2Sequences, can also be used to compare protein and nucleotide sequences (FEMS Microbiol. Lett. (1999) 174(2):247-50; FEMS Microbiol. Lett. (1999) 177(1):187-8).

[0453] Although the final percentage of identity can be measured, the alignment process itself is not typically based on all-or-nothing pairwise comparisons. Instead, a scaled similarity score matrix is ​​usually used, which assigns a score to each pairwise comparison based on chemical similarity or evolutionary distance. A commonly used example of such a matrix is ​​the BLOSUM62 matrix (the default matrix for the BLAST program group). The GCG Wisconsin program typically uses common defaults or a custom symbol comparison table (if provided) (see the user manual for further details). For some applications, it is preferred to use common defaults for the GCG package, or, in the case of other software, a default matrix such as BLOSUM62.

[0454] After the software generates an optimal alignment, it is possible to calculate the sequence identity percentage. The software typically performs this as part of the sequence comparison and produces a numerical result. The sequence identity percentage can be calculated as the percentage of identical residues out of the total number of residues in the stated SEQ ID NO.

[0455] "Fragment" is also a variant, and the term generally refers to a selected region of a polypeptide or polynucleotide of interest, either functionally or, for example, in an assay. Therefore, a "fragment" refers to an amino acid or nucleic acid sequence that is part of a full-length polypeptide or polynucleotide.

[0456] Such variants, derivatives, and fragments can be prepared using standard recombinant DNA techniques such as site-directed mutagenesis. When insertion is to be performed, synthetic DNA encoding the insertion as well as 5' and 3' flanking regions corresponding to the naturally occurring sequence on either side of the insertion site can be prepared. The flanking regions will contain convenient restriction sites corresponding to the sites in the naturally occurring sequence, allowing the sequence to be cleaved with appropriate enzymes and the synthetic DNA to be ligated into the nick. The DNA is then expressed according to the invention to prepare the encoded protein. These methods are merely examples of the many standard techniques known in the art for manipulating DNA sequences, and other known techniques may also be used.

[0457] The present invention will now be described through the following embodiments. Example

[0458] Materials and Methods

[0459] Plasmids used as templates for Cas9

[0460] The plasmid used for AAV vector generation is derived from the pAAV2.1 plasmid containing the inverted terminal repeat sequence of AAV serotype 2.

[0461] The AAV vector plasmid required to generate AAV-SpCas9 contains a heterozygous liver promoter (HLP) and a synthetic pA sequence.

[0462] The AAV vector plasmid required to generate the AAV-gRNA-donor DsRed contains: a U6 promoter, specific gRNA and PAM sequences, and a chimeric gRNA scaffold; the splice acceptor signal, exon 14 of mAlb, T2A adapter, DsRed coding sequence [CDS (NCBI reference MK 301207.1)], prairie hepatitis virus posttranscriptional regulatory element (WPRE), bovine growth hormone polyadenylate (BGHpolyA), and stop codon, all surrounded by the reverse gRNA and PAM sequences.

[0463] The AAV vector plasmid required to generate the AAV-gRNA-donor ARSB contains: the U6 promoter, specific gRNA and PAM sequences, and a chimeric gRNA scaffold; the splice acceptor signal, exon 14 of mAlb, T2A adapter, human ARSB CDS (NCBI reference NM_000046.5), BGH polyA, and stop codon, all surrounded by the reverse gRNA and PAM sequences.

[0464] The AAV vector plasmid required to generate AAV-gRNA-Cas9 contains: a U6 promoter, a specific gRNA and a chimeric gRNA scaffold; a heterozygous liver promoter (HLP), spCas9 and a synthetic pA sequence.

[0465] The AAV vector plasmid required to generate the AAV-donor FVIII contains: splice acceptor signal, exon 14 of mAlb, T2A adapter, codon optimization sequence with human FVIII B domain deletion (published in

[33] ), BGH polyA and stop codon, all surrounded by reverse gRNA and PAM sequences.

[0466] Mouse albumin (mAlb) gRNAs were designed using the Benchling gRNA design tool (www.benchling.com) (Tables 1 and 3). GRNAs with the best predicted on-target and off-target scores were selected, targeting intron 13 of mAb or introns 12, 13, or 14 of human albumin (hALB). The scrambling gRNAs were designed not to align with any sequences in the mouse genome.

[0467] AAV vector generation and characterization

[0468] AAV vectors were generated by triple transfection of HEK293 cells with the TIGEM AAV vector core followed by two rounds of CsCl2 purification

[34] . For each viral formulation, the physical titer (GC / mL) was determined by averaging titers obtained from dot blot analysis

[39] and by PCR quantification using TaqMan (Applied Biosystems, Carlsbad, CA, USA)

[34] . Probes used for dot blot and PCR analysis were designed to anneal to the IRBP promoter of the pAAV2.1-IRBP-SpCas9-spA vector, the HLP promoter of the pAAV2.1-HLP-SpCas9-spA vector, and the bGHpA region of the donor DNA vector. Probe lengths varied between 200 bp and 700 bp.

[0469] HEK293 cell culture and transfection

[0470] HEK293 cells were maintained in DMEM containing 10% fetal bovine serum (FBS) and 2 mM L-glutamine (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). Cells were seeded in 6-well plates (1*10⁻⁶). 6 In 16 hours, the calcium phosphate method (1 to 2 mg / 1*10 cells / well) was used. 6 (1 cell) Transfected with plasmids encoding Cas9 and different gRNAs and donor DNA; change the medium after 4 hours. The maximum transfection material is 3 μg. In all cases, balance the amount of plasmid DNA between wells, using empty vector if necessary.

[0471] Cell fluorescence analysis

[0472] HEK293 cells seeded in 6-well plates were washed once with PBS, dissociated with trypsin and 0.05% EDTA (ThermoFisher Scientific, Waltham, MA, USA), washed twice with PBS, and resuspended in a sorting solution containing PBS, 5% FBS, and 2.5 mM EDTA. Cells were analyzed using appropriate excitation and detection settings for EGFP and DsRed on BD FACS ARIAIII (BD Biosciences, San Jose, CA, USA) equipped with BD FACSDiva software (BD Biosciences). A fluorescence detection threshold was set on untransfected cells, and a minimum of 10,000 cells / sample were analyzed. At least 50,000 GFP+ or GFP+ / DsRed+ cells / samples were sorted for DNA extraction.

[0473] Frozen sections and fluorescence imaging of mouse liver

[0474] To assess DsRed expression in the liver after HITI, C57BL / 6 mice were injected with p1 and sacrificed by cardiac perfusion one month later. A small piece from each liver lobe was dissected and fixed overnight in 4% paraformaldehyde. After fixation, the fragments were infiltrated overnight with 15% sucrose and then overnight with 30% sucrose before being placed in the OCT matrix (Kaltek, Padua, Italy) for cryosectioning. After fixation, the sections were infiltrated with 15% sucrose during the day and 30% sucrose at night before being placed in the OCT matrix (Kaltek, Padua, Italy) for cryosectioning. Liver cryosections were cut into 6 μm thick sections, allocated to glass slides, and mounted with DAPI-supplemented Vectashield (Vector Lab, Peterborough, UK, #H-1200). Then, the frozen sections were analyzed at 20x magnification using appropriate excitation and detection settings under a confocal microscope LSM 700 (Leica Microsystems, Wetzlar, Germany).

[0475] Representation of integrated connectivity

[0476] DNA was extracted from liver tissue using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany), according to the manufacturer's instructions.

[0477] For the T7 lysis assay, 100 ng of DNA was used with specific primers (Table 2) for PCR amplification of the region containing the Cas9 target site in mouse Alb intron 13, yielding a 652 bp PCR product. The PCR product was examined by T7 endonuclease I assay as recommended by the manufacturer. Briefly, the DNA was de-annealed and re-annealed in a thermal cycler using NEBuffer 2 (New England BioLabs, Ipswich, MA, USA) via a slow temperature gradient. The sample was then incubated with 1 μL of T7 endonuclease (NEB, #M0302L) at 37°C for 30 min and analyzed on a 2% agarose gel. The PCR product was also used for Sanger sequencing (Eurofins Genomics, Ebersberg, Germany) and then processed using SYNTHEGO software (https: / / ice.synthego.com / # / ) to analyze insertion / deletion frequencies.

[0478] To detect donor integration into the 3' mouse albumin locus (intron 13 end), PCR amplification was performed using 100 ng of extracted DNA ligated to HITI with specific primers (Table 2). The PCR products were analyzed on a 2% agarose gel and further cloned into PCR-Blunt II-TOPO (Invitrogen, Carlsbad, CA, USA). Single clones were then used for Sanger sequencing (Eurofins Genomics, Ebersberg, Germany) to characterize donor integration.

[0479] Plasma collection and F8 measurement

[0480] Nine blood samples were collected via retroorbital aspiration into a single buffer of 0.109 M trisodium citrate (5T31.363048; BD, Franklin Lakes, NJ, USA). Plasma was collected after the samples were centrifuged at 3000 rpm for 15 minutes at 4°C.

[0481] To evaluate F8 activity, use The SP4FVIII kit (K824094; Chromogenix, Werfen, Milan, Italy) was used to perform colorimetric assays on plasma samples according to the manufacturer's instructions. A standard curve was generated by serial dilution of commercial human F8 (Refacto, Pfizer). Results are expressed in International Units (IU) per deciliter (dL).

[0482] result

[0483] Example 1

[0484] HITI-mediated DsRed integration at the mouse 3'Alb (mAlb) locus in newborn wild-type mice.

[0485] The inventors conducted in vivo experiments to knock in the reporter gene DsRed transgene at the 3'mAlb locus in wild-type newborn mice used as proof of concept (Figure 1A). For this purpose, three different AAV8 vectors were generated: one encoding SpCas9 at expression in a heterozygous liver promoter (HLP), one containing the HITI donor DsRed coding sequence (CDS), and one containing a U6-gRNA or U6-scRNA expression cassette. Specifically, the donor DNA cassette contains the synthetic splice acceptor signal (SAS), the last albumin exon (exon 14), and the coding sequence for DsRed, followed by the T2A sequence. The sequences are provided below.

[0486] Wild-type (WT)C57BL / 6 mice were randomly assigned to two treatment groups (gRNA or scRNA) and received a 1:1 vector mixture via the temporal vein on day 1 (p1). To integrate DsRed CDS at the 3' mAlb locus, the gRNA group was injected with a vector encoding SpCas9 and a vector carrying the HITI donor, along with the U6 promoter and gRNA sequence. As a negative control, the scRNA group was treated according to the same protocol, but the vector carrying the HITI donor contained the U6-scRNA expression cassette. Animals were sacrificed 4 weeks post-injection, and DNA was extracted from liver samples to assess SpCas9 cleavage efficiency. Integration ligation was amplified using specific primers via PCR (Table 2). As expected, SpCas9 cleavage occurred only in the gRNA-treated animals and not in the scRNA group (Fig. 1B). Furthermore, PCR analysis showed 5' and 3' ligation products at the target site in the gRNA-treated animals, but not in the scRNA-treated animals (Fig. 1C). Consistent with these results, microscopic images of frozen liver sections revealed high expression of DsRed in gRNA-treated animals, but its complete absence in scRNA-treated controls (Fig. 1D). In summary, these data suggest that HITI is a suitable platform for the integration and expression of DsRed at the 3'mAlb locus.

[0487] Example 2

[0488] HITI-mediated ARSB delivery in neonatal MPSVI mice.

[0489] Next, the inventors tested whether HITI at the 3'mAlb locus in newborn mice resulted in stable and therapeutically relevant levels of arylsulfatase B (ARSB), a lysosomal hydrolase that is deficient in mucopolysaccharidosis type VI (MPS VI), a lysosomal storage disease. Since ARSB is secreted in the bloodstream and can be measured non-invasively, it can be used as a readout for liver transduction

[35] . ARSB deficiency leads to abnormal storage of glycosaminoglycans (GAGs) and urinary secretion, which are useful biomarkers for MPSVI

[36] . The inventors produced an AAV vector carrying a donor DNA cassette as described above: containing a synthetic splice acceptor signal (SAS), the last albumin exon (exon 14), and the coding sequence for human ARSB (hARSB), followed by a T2A sequence, and a gRNA expression cassette with a scrambled sequence as a control (Figure 2A). The gRNA donor vector or scrRNA vector was co-delivered systemically in neonatal MPS VI mice (p1-2) in combination with the HLP-SpCas9 vector (Fig. 2A). Serum ARSB activity was measured at levels higher than in normal littermates in gRNA-treated MPS VI mice (Fig. 2B) and remained stable over time until one year of age. Serum ARSB activity was undetectable in either gRNA-treated or untreated MPS VI mice. Importantly, although no significant difference in urinary GAGs was observed between the gRNA-treated and gRNA-suppressed groups at p60, AAV-HITI-mediated ARSB expression normalized urinary GAGs (from p90 to p360, Fig. 2C).

[0490] AAV-HITI dose response

[0491] The inventors tested three doses of AAV-HITI to treat arylsulfatase B (Arsb) by integrating donor DNA carrying a promoterless coding sequence for ARSB at the 3' albumin locus. - / - A mouse model of mucopolysaccharidosis type VI (MPSVI) was established. Animals were administered three doses of AAV-HITI at 1-2 days of age: 1.2E+14 total genomic copies (GC) / kg (high dose or HD), 3.9E+13 total GC / kg (medium dose or MD), and 1.2E+13 total GC / kg (low dose or LD). Preliminary results from the inventors' ARSB immunoassay of serum samples showed that HD and MD reached supraphysiological levels of secreted active ARSB at 30 days of age. Figure 7 LD also induces the secretion of active ARSB at multiple levels. Figure 7 ).

[0492] Example 3

[0493] HITI-mediated integration of F8 codopV3 at the mouse 3'Alb (mAlb) locus in newborn hemophilia mice.

[0494] The inventors performed in vivo experiments at the 3'mAlb locus in hemophiliac newborn mice to knock in the F8 CodopV3 transgene. For this purpose, three different AAV8 vectors were generated: two vectors encoding SpCas9 carrying a U6-gRNA or U6-scRNA expression cassette at the expression of a heterozygous liver promoter (HLP), and one vector containing the HITI donor F8CodopV3 coding sequence (CDS). Specifically, the donor DNA cassette contains the synthetic splice acceptor signal (SAS), the last albumin exon (exon 14), followed by the T2A sequence and the F8 CodopV3 coding sequence (…). Figure 3 A). Hemophilia mice were randomly assigned to two treatment groups (gRNA or scRNA) and received a 1:1 vector mixture via the temporal vein on day 1 (p1). To integrate the F8 CDS at the 3' mAlb locus, the vector encoding SpCas9 was injected into the gRNA group along with the U6 promoter and gRNA sequence, as well as a vector carrying the HITI donor. As a negative control, the scRNA group was treated according to the same protocol, with the vector carrying SpCas9 containing the U6-scRNA expression cassette. Plasma samples were collected 4 weeks after vector administration.

[0495] F8 activity was monitored using a functional colorimetric assay, and the F8 activity level was 20% compared to the unaffected control. Figure 3 B).

[0496] gRNA sequence

[0497] sheet

[0498]

[0499] Table 1: gRNA sequence at intron 13 of the mouse albumin locus

[0500]

[0501]

[0502] Table 2: Primers for the 3'mAlbumin locus.

[0503] gRNAs with the best predicted on-target and off-target scores targeting the ninth, eleventh, twelfth, thirteenth, or fourteenth introns of human albumin (hALB) were designed and are reported in Table 3.

[0504]

[0505]

[0506] Table 3: gRNAs targeting human albumin. Position is indicated by referencing the first nucleotide of each intron. On-target and off-target scores are predicted values ​​calculated using Benchling. NA: Not available.

[0507] gRNAs are designed to be placed on either strand of the genomic DNA and oriented with a 5'-3' orientation.

[0508] SEQ ID NO is indicated by the 5'-3' orientation.

[0509] serum albumin level

[0510] Serum albumin levels were collected from blood samples of p360 from treated and control mice using an ELISA kit (Abcam, 108791, Cambridge, UK). Figure 4 The study found that serum albumin levels were similar in the treatment group, independent of the other group, which means that the inventors' AAV-HITI does not affect the expression of endogenous proteins.

[0511] Alpha-fetoprotein levels

[0512] Elevated alpha-fetoprotein (AFP) levels have been reported to be associated with hepatocellular carcinoma (HHC) in mice (Ferla et al., Molecular Therapy: Methods & Clinical Development 2021). Following the manufacturer's instructions, the inventors measured AFP levels in serum samples from p360 of treated and control mice using the Mouse AFP / AFP Quantikine Elisa Kit (R&D Systems, Minneapolis, MN, USA). They found that mouse AFP levels increased in mice treated with AAV-HITI gRNA, but not in scRNA or controls. Figure 5 ).

[0513] Off-target analysis

[0514] To investigate potential chromosomal aberrations mediated by intermediate target sites (OMT) (as translocation events), the inventors performed CAST-seq analysis on their AAV-HITI gRNA liver DNA samples, a technique previously described (Turchiano et al., 2021), using AAV-HITI scRNA and untreated liver DNA samples as controls. CAST-seq analysis data showed that the inventors' AAV-HITI gRNA samples exhibited deletion events at intermediate target sites, while no OMT was detected. Figure 6 ).

[0515] Example 4

[0516] Selection of gRNAs targeting the 3' human albumin (ALB) locus

[0517] The inventors used Benchling and / or CHOPCHOP software to select one gRNA targeting intron 13 of ALB and eight gRNAs targeting introns 9 and 11 through 13 of ALB (Table 4). Computer simulation selection was based on i) low-level predicted off-target effects and ii) high-efficiency targeting of the desired locus. Plasmids encoding one of the selected gRNAs or scRNAs under the CBh promoter and the human U6 promoter were transfected into HEPA1-6 cells or HEK293 cells to target the ALB locus, respectively. HEPA1-6 cells were transfected with 1 μg of plasmid DNA using Lipofectamine LTX (Thermo Fisher Scientific, Waltham, MA, USA), while HEK293 cells were transfected with 1 μg of plasmid DNA using calcium phosphate. DNA was extracted from sorted cells expressing Cas9-EGFP, and the genomic region recognized by the gRNA was amplified by PCR. PCR products were digested with the T7 enzyme (Neb, Ipswich, MA, USA) to detect Cas9-mediated insertions / deletions. The same PCR products were also subjected to Sanger sequencing using ICE software from Synthego for insertion / deletion quantification. gRNA0 (ALB intron 13) and gRNAs 3 and 5 (ALB intron 12) induced high Cas9-mediated insertions / deletions, while lower levels were detected using gRNA2 (ALB intron 13), and no insertions / deletions were detected using either gRNA1 (ALB intron 13) or gRNA4 (ALB intron 14) (Table 4 and). Figure 8 The frequency of allelic variations of sequences targeted at the ALB locus was analyzed using the Human Genome Aggregate Database (gnomAD) version 3.1.2 for selected gRNAs. The highest detected allelic variation frequency was per 10 3There is one SNP in each of the alleles (gRNA3 and 6), and importantly, no variant exists in homozygosity.

[0518] Integration efficiency at the 3'Alb locus and the 3'ALB locus

[0519] The inventors evaluated the integration efficiency of HITI at the 3'Alb and 3'ALB loci by generating HITI donors with flanking gRNA0 inverted sequences for integration at the 3'Alb locus or with flanking gRNA3 or 5 inverted sequences for integration at the 3'ALB locus. The donors encode a synthetic splice acceptor signal, exon 14 of Alb or exons 13-14 of ALB, which is linked to the coding sequence of the fluorescent reporter DsRed via a T2A jumping peptide. The inventors transfected HEPA1-6 cells using Lipofectamine LTX (Thermo Fisher Scientific, Waltham, MA, USA) with 1 μg of plasmid DNA encoding Cas9-EGFP and gRNA0 and 1 μg of plasmid DNA encoding donor DNA flanked by gRNA0. Similarly, human hepatocellular carcinoma cell line 7 (HUH7) was transfected with 1 μg of plasmid encoding Cas9-EGFP and gRNA3 plus 1 μg of plasmid encoding a HITI donor flanked by gRNA3, or 1 μg of plasmid encoding Cas9-EGFP and gRNA5 plus 1 μg of plasmid encoding a HITI donor flanked by gRNA5. Cells transfected with HITI donors and plasmid DNA encoding Cas9-EGFP and scRNA were used solely for DsRed fluorescence normalization and quantification of productive HITI donor integration. Fluorescence-activated cell sorting analysis showed that gRNA0 and gRNA3 induced productive integration of HITI donors at the 3'Alb locus and 3'ALB locus, respectively. Figure 9 ).

[0520]

[0521]

[0522] Table 4: gRNAs targeting the 3' mouse (Alb) or human (ALB) albumin locus. This table shows all gRNAs (PAM sequences underlined) and targeting introns of Alb or ALB, showing the percentage of insertions / deletions (n ​​= 3 independent experiments) as mean ± standard error of mean, and allele frequency. SEM = standard error of mean.

[0523] Example 5

[0524] The accuracy of the AAV-HITI platform at the 3'mAlb locus.

[0525] To assess the precision of the inventors' AAV-HITI strategy, several molecular analyses were performed. First, the inventors investigated the cleavage efficiency (insertion / deletion percentage) of the gRNA chosen by the inventors. Genomic DNA extracted from the livers of MPSVI mice treated with AAV-HITI gRNA or AAV-HITI scRNA was analyzed using Illumina-seq NGS. The inventors found only 29% insertions / deletions in mice treated with AAV-HITI gRNA (Figure 10A). Furthermore, the inventors assessed whether they could detect portions of the AAV vector genome integrated at the target site after Cas9-induced double-strand breaks. Using HITI donor DNA or the full AAV vector genome from Cas9 as a reference, the inventors aligned reads generated from Illumina-seq NGS experiments. The inventors were able to align reads covering different portions of a given AAV vector genome with most reads covering the ITR region (Figure 10B). Next, HITI-mediated integration was evaluated compared to ITR-mediated integration. To this end, we generated donor DNA (ITR donor) with the same structure as our HITI gRNA donor DNA but without inverse gRNA sites flanking its 5' and 3' ends. This construct was then generated as AAV8 and used in vivo. Wild-type mice were injected via the temporal vein in p1-2 with a mixture of AAV-Cas9 and AAV-ITR donors containing the Ds-Red coding sequence (as previously described for HITI donor DNA). In parallel, a second group of mice was injected with a combination of AAV-Cas9 and AAV-HITI gRNA donors. Both groups were sacrificed one month after treatment, and DNA was extracted from the livers of all treated animals for further molecular analysis.

[0526] We used specific primers to perform PCR amplification at both the 5' and 3' connection sites between the inserted donor DNA and the endogenous locus (Table 2).

[0527] As visible in agarose gels (Fig. 10C), we were able to amplify ligation bands (5' and 3') of the expected size based on the received donor (HITI or ITR donor) using PCR. Interestingly, in HITI-treated mice, we also observed a higher but darker band of the same size as observed in samples treated with AAV-ITR donor gRNA. Sanger sequencing analysis of both the higher and expected-size bands revealed that donor DNA integration also occurs via ITR in animals treated with HITI donor DNA.

[0528] Next, the inventors evaluated potential gRNA off-target activities. To this end, the inventors used CRISPOR to select the top 10 predicted off-targets (Table 5). For each selected off-target locus, NGS analysis of PCR bands obtained from liver genomic DNA (in both gRNA and scRNA-treated samples) resulted in very low or undetectable off-target editing events (Figure 10D).

[0529] Table 5

[0530]

[0531]

[0532] sequence

[0533] The sequence of Example 1 above

[0534] 5'-ITR

[0535] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT[SEQ ID NO:110]

[0536] gRNA sequence of mouse albumin intron 13

[0537] CACTGCTGCCTATTAAATAC[SEQ ID NO:1]

[0538] scRNA sequence

[0539] gactcgcgcgagtcgaggag[SEQ ID NO:111]

[0540] PAM-free inverted gRNA sequence of mouse albumin intron 13

[0541]

[0542] The reverse gRNA sequence of the mouse albumin intron 13+ PAM sequence (underlined)

[0543]

[0544] Splice acceptor sequence

[0545]

[0546] Exon 14 mouse albumin

[0547]

[0548] Thosea asigna virus 2A (T2A) jumping peptide

[0549] GGAAGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCT[SEQID NO:23]

[0550] Discosoma Red (DsRed) coding sequence

[0551]

[0552] Post-transcriptional regulatory elements (WPREs) of marmot hepatitis virus

[0553]

[0554] Bovine growth hormone polyadenylate (BGH pA)

[0555]

[0556] Human U6 promoter

[0557]

[0558] Chimeric gRNA scaffold

[0559] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGC [SEQ ID NO:28]

[0560] 3'-ITR

[0561] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG[SEQ ID NO:29]

[0562] Construct p1492_pTIGEM_mAlb3'HITI donor (SAS_albex14_T2A_dsRED_bGHpA)+U6gRNAmAlb3'

[0563]

[0564]

[0565] Construct p1496_pTIGEM_mAlb3'HITI donor (SAS_albex14_T2A_dsRED_bGHpA)+U6 scrambling RNA mAlb3'

[0566]

[0567]

[0568]

[0569] The sequence of Example 2 above

[0570] 5'-ITR

[0571] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT[SEQ ID NO:110]

[0572] The gRNA sequence of mouse albumin intron 13 (orientation 5'-3' on the positive strand).

[0573] CACTGCTGCCTATTAAATAC[SEQ ID NO:1]

[0574] scRNA sequence

[0575] gactcgcgcgagtcgaggag[SEQ ID NO:111]

[0576] PAM-free inverted gRNA sequence of mouse albumin intron 13

[0577] CACTGCTGCCTATTAAATAC[SEQ ID NO:1]

[0578] Reverse gRNA sequence of mouse albumin intron 13+ PAM sequence

[0579] CCACACTGCTGCCTATTAAATAC[SEQ ID NO:20]

[0580] Splice acceptor sequence

[0581]

[0582] Exon 14 mouse albumin

[0583]

[0584] Thosea asigna virus 2A (T2A) jumping peptide

[0585] GGAAGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCT[SEQID NO:23]

[0586] ARSB encoded sequence

[0587]

[0588] Bovine growth hormone polyadenylate (BGH pA)

[0589]

[0590] Human U6 promoter

[0591]

[0592] Chimeric gRNA scaffold

[0593] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGC [SEQ ID NO:28]

[0594] 3'-ITR

[0595] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG[SEQ ID NO:29]

[0596] Construct p1479_pTIGEM_mAlb3'HITI donor (SAS_albex14_T2A_ARSB_bGHpA)+U6gRNAmAlb3'

[0597]

[0598]

[0599] Construct p1480_pTIGEM_mAlb3'HITI donor (SAS_albex14_T2A_ARSB_bGHpA)+U6scrRNA mAlb3'

[0600]

[0601]

[0602] The sequence of Example 3 above

[0603] 5'-ITR

[0604] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT[SEQ ID NO:110]

[0605] PAM-free inverted gRNA sequence of mouse albumin intron 13

[0606] CACTGCTGCCTATTAAATAC[SEQ ID NO:1]

[0607] The reverse gRNA sequence of the mouse albumin intron 13+ PAM sequence (underlined)

[0608] CCA CACTGCTGCCTATTAAATAC[SEQ ID NO:20]

[0609] Splice acceptor sequence

[0610]

[0611] Exon 14 mouse albumin

[0612]

[0613] Thosea asigna virus 2A (T2A) jumping peptide

[0614] GGAAGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCT[SEQID NO:23]

[0615] F8_CodopV3 encoded sequence

[0616]

[0617] Synthetic polyadenylation signal

[0618]

[0619] 3'ITR

[0620] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG[SEQ ID NO:29]

[0621] Construct p1493_pTIGEM_mAlb3'HITI donor (SAS_albex14_T2A_CodopV3_pA)

[0622]

[0623]

[0624]

[0625]

[0626] Construct _p1139_pAAV2.1._HLP_SpCas9(HA)_spA

[0627] promoter underline the sequence

[0628]

[0629]

[0630]

[0631]

[0632] HITI 3'mALb f8 (Hemophilia A)

[0633] p1498_pAAV_HLP_SpCas9+U6 3'malb_gRNA(5,1kb)

[0634] 5'ITR

[0635] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGC

[0636] GACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT(SEQ ID NO:110)

[0637] Additional AAV sequences

[0638] Tgtagttaatgattaacccgccatgctacttatctacgtagagctcttgtcgaggtcgacatttaaatgaagggcgaattcaattt(SEQ ID NO:44)

[0639] U6 expression cassette gRNA

[0640] Gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattgg aattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagttt gcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctt tatatatcttgtggaaaggacgaaacaccgtatttaataggcagcagtggttttagagctagaaatagcaagttaa aataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttgttttagagcta(SEQ ID NO:45)

[0641] HLP promoter

[0642] TGTTTGCTGCTTGCAATGTTTGCCCATTTTAGGGTGGACACAGGACGCTGTGGTTTCTGAGCCAGGGGGCGACTCAGATCCCAGCCAGTGGACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGCTTCAGGCACCACCACTGACCTGGGACAGTGAAT(SEQ ID NO:46)

[0643] spCas9

[0644]

[0645] Synthetic polyadenylates

[0646] Attcaataaaagatctttattttcattagatctgtgtgttggttttttgtgtgcggcc(SEQ ID NO:48)

[0647] 3'ITR

[0648] Aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcga ccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag(SEQ ID NO:29)

[0649] Full sequence p1498_pAAV_HLP_SpCas9+U6 3’malb_gRNA(5,1kb)

[0650] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTtgtagttaatgattaacccgccatgctacttatctacgtagagctcttgtcgaggtcgacatttaaatgaagggcgaattcaattt gagg gcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgac tgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaa ttatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgt ggaaaggacgaaacaccgtatttaattcaataaaagatctttattttcattagatctgtgtgttggttttttgtgtgcggccgcaggaa cccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgccc gacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag(SEQ ID NO:49)

[0651] p1500 / / pAAV_HLP_SpCas9+U6 3’malb_scRNA

[0652] 5’ ITR

[0653] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT(SEQ ID NO:110)

[0654] Additional AAV sequence

[0655] Tgtagttaatgattaacccgccatgctacttatctacgtagagctcttgtcgaggtcgac(SEQ IDNO:50)

[0656] U6 expression cassette scRNA

[0657] Ctgacctcgagtttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataatt ggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagt ttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggc tttatatatcttgtggaaaggacgaaacaccggactcgcgcgagtcgaggaggttttagagctagaaatagcaagt taaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttgttttagagctagaaata gcaag(SEQ ID NO:51)

[0658] HLP promoter

[0659] TGTTTGCTGCTTGCAATGTTTGCCCATTTTAGGGTGGACACAGGACGCTGTGGTTTCTGAGCCAGGGGGCGACTCAGATCCCAGCCAGTGGACTTAGCCCCTGTTTGCTCCTCCGATAACTGGGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCTTAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGCTTCAGGCACCACCACTGACCTGGGACAGTGAAT(SEQ ID NO:46)

[0660] spCas9

[0661]

[0662] Synthetic polyadenylation

[0663] Aattcaataaaagatctttattttcattagatctgtgtgttggttttttgtgtgcggcc(SEQ ID NO:48)

[0664]

[0665] Full sequence p1500

[0666] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT

[0667] tgtagttaatgattaacccgccatgctacttatctacgtagagctcttgtcgaggtcgac ctgacctc gagtttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactg taaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaatt atgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtgg aaaggacgaaacaccggacaattcaataaaagatctttattttcattagatctgtgtgttggttt tttgtgtgcggccgcaggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggc cgggcgaccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag(SEQ ID NO:53)

[0668] P1617_pTIGEM_HITI 3'malb CodopV3 HITI donor

[0669] 5'ITR

[0670] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (SEQ ID NO: 110)

[0671] Reverse gRNA + PAM site

[0672] GTATTTAATAGGCAGCAGTGTGG(SEQ ID NO:54)

[0673] Synthetic scissor acceptors

[0674] GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG(SEQ ID NO:21)

[0675] mAlbumin exon 14

[0676]

[0677] T2A sequence

[0678] Ggaagcggagagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggacct(SEQID NO:23)

[0679] Codopv3

[0680] atgcagattgagctgagcacctgcttcttcctgtgcctgctgaggttctgcttctctgccaccaggag atactacctgggggctgtggagctgagctgggactacatgcagtctgacctgggggagctgcctgtggatgccagg ttcccccccagagtgcccaagagcttccccttcaacacctctgtggtgtacaagaagaccctgtttgtggagttca ctgaccacctgttcaacattgccaagcccaggcccccctggatgggcctgctgggccccaccatccaggctgaggt gtatgacactgtggtgatcaccctgaagaacatggccagccaccctgtgagcctgcatgctgtgggggtgagctac tggaaggcctctgagggggctgagtatgatgaccagaccagccagagggagaaggaggatgacaaggtgttccctg ggggcagccacacctatgtgtggcaggtgctgaaggagaatggccccatggcctctgaccccctgtgcctgaccta cagctacctgagccatgtggacctggtgaaggacctgaactctggcctgattggggccctgctggtgtgcagggag ggcagcctggccaaggagaagacccagaccctgcacaagttcatcctgctgtttgctgtgtttgatgagggcaaga gctggcactctgaaaccaagaacagcctgatgcaggacagggatgctgcctctgccagggcctggcccaagatgca cactgtgaatggctatgtgaacaggagcctgcctggcctgattggctgccacaggaagtctgtgtactggcatgtg attggcatgggcaccacccctgaggtgcacagcatcttcctggagggccacaccttcctggtcaggaaccacaggc aggccagcctggagatcagccccatcaccttcctgactgcccagaccctgctgatggacctgggccagttcctgct gttctgccacatcagcagccaccagcatgatggcatggaggcctatgtgaaggtggacagctgccctgaggagccc cagctgaggatgaagaacaatgaggaggctgaggactatgatgatgacctgactgactctgagatggatgtggtga ggtttgatgatgacaacagccccagcttcatccagatcaggtctgtggccaagaagcaccccaagacctgggtgca ctacattgctgctgaggaggaggactgggactatgcccccctggtgctggcccctgatgacaggagctacaagagc cagtacctgaacaatggcccccagaggattggcaggaagtacaagaaggtcaggttcatggcctacactgatgaaa ccttcaagaccagggaggccatccagcatgagtctggcatcctgggccccctgctgtatggggaggtgggggacac cctgctgatcatcttcaagaaccaggccagcaggccctacaacatctacccccatggcatcactgatgtgaggccc ctgtacagcaggaggctgcccaagggggtgaagcacctgaaggacttccccatcctgcctggggagatcttcaagt acaagtggactgtgactgtggaggatggccccaccaagtctgaccccaggtgcctgaccagatactacagcagctt tgtgaacatggagagggacctggcctctggcctgattggccccctgctgatctgctacaaggagtctgtggaccag aggggcaaccagatcatgtctgacaagaggaatgtgatcctgttctctgtgtttgatgagaacaggagctggtacc tgactgagaacatccagaggttcctgcccaaccctgctggggtgcagctggaggaccctgagttccaggccagcaa catcatgcacagcatcaatggctatgtgtttgacagcctgcagctgtctgtgtgcctgcatgaggtggcctactgg tacatcctgagcattggggcccagactgacttcctgtctgtgttcttctctggctacaccttcaagcacaagatgg tgtatgaggacaccctgaccctgttccccttctctggggagactgtgttcatgagcatggagaaccctggcctgtg gattctgggctgccacaactctgacttcaggaacaggggcatgactgccctgctgaaagtctccagctgtgacaag aacactggggactactatgaggacagctatgaggacatctctgcctacctgctgagcaagaacaatgccattgagc ccaggagcttcagccagaatgccactaatgtgtctaacaacagcaacaccagcaatgacagcaatgtgtctccccc agtgctgaagaggcaccagagggagatcaccaggaccaccctgcagtctgaccaggaggagattgactatgatgac accatctctgtggagatgaagaaggaggactttgacatctacgacgaggacgagaaccagagccccaggagcttcc agaagaagaccaggcactacttcattgctgctgtggagaggctgtgggactatggcatgagcagcagcccccatgt gctgaggaacagggcccagtctggctctgtgccccagttcaagaaggtggtgttccaggagttcactgatggcagc ttcacccagcccctgtacagaggggagctgaatgagcacctgggcctgctgggcccctacatcagggctgaggtgg aggacaacatcatggtgaccttcaggaaccaggccagcaggccctacagcttctacagcagcctgatcagctatga ggaggaccagaggcagggggctgagcccaggaagaactttgtgaagcccaatgaaaccaagacctacttctggaag gtgcagcaccacatggcccccaccaaggatgagtttgactgcaaggcctgggcctacttctctgatgtggacctgg agaaggatgtgcactctggcctgattggccccctgctggtgtgccacaccaacaccctgaaccctgcccatggcag gcaggtgactgtgcaggagtttgccctgttcttcaccatctttgatgaaaccaagagctggtacttcactgagaac atggagaggaactgcagggccccctgcaacatccagatggaggaccccaccttcaaggagaactacaggttccatg ccatcaatggctacatcatggacaccctgcctggcctggtgatggcccaggaccagaggatcaggtggtacctgct gagcatgggcagcaatgagaacatccacagcatccacttctctggccatgtgttcactgtgaggaagaaggaggag tacaagatggccctgtacaacctgtaccctggggtgtttgagactgtggagatgctgcccagcaaggctggcatct ggagggtggagtgcctgattggggagcacctgcatgctggcatgagcaccctgttcctggtgtacagcaacaagtg ccagacccccctgggcatggcctctggccacatcagggacttccagatcactgcctctggccagtatggccagtgg gcccccaagctggccaggctgcactactctggcagcatcaatgcctggagcaccaaggagcccttcagctggatca aggtggacctgctggcccccatgatcatccatggcatcaagacccagggggccaggcagaagttcagcagcctgta catcagccagttcatcatcatgtacagcctggatggcaagaagtggcagacctacaggggcaacagcactggcacc ctgatggtgttctttggcaatgtggacagctctggcatcaagcacaacatcttcaacccccccatcattgccagat acatcaggctgcaccccacccactacagcatcaggagcaccctgaggatggagctgatgggctgtgacctgaacag ctgcagcatgcccctgggcatggagagcaaggccatctctgatgcccagatcactgccagcagctacttcaccaac atgtttgccacctggagccccagcaaggccaggctgcacctgcagggcaggagcaatgcctggaggccccaggtca acaaccccaaggagtggctgcaggtggacttccagaagaccatgaaggtgactggggtgaccacccagggggtgaa gagcctgctgaccagcatgtatgtgaaggagttcctgatcagcagcagccaggatggccaccagtggaccctgttc ttccagaatggcaaggtgaaggtgttccagggcaaccaggacagcttcacccctgtggtgaacagcctggaccccc ccctgctgaccagatacctgaggattcacccccagagctgggtgcaccagattgccctgaggatggaggtgctggg ctgtgaggcccaggacctgtac (SEQ ID NO:55)

[0681] 3×FLAG

[0682] GACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAGTGA(SEQ ID NO:56)

[0683]

[0684] Reverse gRNA and PAM

[0685] gtatttaataggcagcagtgtgg(SEQ ID NO:54)

[0686]

[0687] 3’ itr

[0688] Aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcga ccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag(SEQ ID NO:29)

[0689] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGctagc GTATTTAA TAGGCAGCAGTGTGG GATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAGggtccaaaccttgtcactagatgcaaagacgccttagccggaagcggagagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggacct atgcagattgagctgagcacctgcttcttcctgtgcctgctgaggttctgcttctctgcc accaggagatactacctgggggctgtggagctgagctgggactacatgcagtctgacctgggggagctgcctgtgg atgccaggttcccccccagagtgcccaagagcttccccttcaacacctctgtggtgtacaagaagaccctgtttgt ggagttcactgaccacctgttcaacattgccaagcccaggcccccctggatgggcctgctgggccccaccatccag gctgaggtgtatgacactgtggtgatcaccctgaagaacatggccagccaccctgtgagcctgcatgctgtggggg tgagctactggaaggcctctgagggggctgagtatgatgaccagaccagccagagggagaaggaggatgacaaggt gttccctgggggcagccacacctatgtgtggcaggtgctgaaggagaatggccccatggcctctgaccccctgtgc ctgacctacagctacctgagccatgtggacctggtgaaggacctgaactctggcctgattggggccctgctggtgt gcagggagggcagcctggccaaggagaagacccagaccctgcacaagttcatcctgctgtttgctgtgtttgatga gggcaagagctggcactctgaaaccaagaacagcctgatgcaggacagggatgctgcctctgccagggcctggccc aagatgcacactgtgaatggctatgtgaacaggagcctgcctggcctgattggctgccacaggaagtctgtgtact ggcatgtgattggcatgggcaccacccctgaggtgcacagcatcttcctggagggccacaccttcctggtcaggaa ccacaggcaggccagcctggagatcagccccatcaccttcctgactgcccagaccctgctgatggacctgggccag ttcctgctgttctgccacatcagcagccaccagcatgatggcatggaggcctatgtgaaggtggacagctgccctg aggagccccagctgaggatgaagaacaatgaggaggctgaggactatgatgatgacctgactgactctgagatgga tgtggtgaggtttgatgatgacaacagccccagcttcatccagatcaggtctgtggccaagaagcaccccaagacc tgggtgcactacattgctgctgaggaggaggactgggactatgcccccctggtgctggcccctgatgacaggagct acaagagccagtacctgaacaatggcccccagaggattggcaggaagtacaagaaggtcaggttcatggcctacac tgatgaaaccttcaagaccagggaggccatccagcatgagtctggcatcctgggccccctgctgtatggggaggtg ggggacaccctgctgatcatcttcaagaaccaggccagcaggccctacaacatctacccccatggcatcactgatg tgaggcccctgtacagcaggaggctgcccaagggggtgaagcacctgaaggacttccccatcctgcctggggagat cttcaagtacaagtggactgtgactgtggaggatggccccaccaagtctgaccccaggtgcctgaccagatactac agcagctttgtgaacatggagagggacctggcctctggcctgattggccccctgctgatctgctacaaggagtctg tggaccagaggggcaaccagatcatgtctgacaagaggaatgtgatcctgttctctgtgtttgatgagaacaggag ctggtacctgactgagaacatccagaggttcctgcccaaccctgctggggtgcagctggaggaccctgagttccag gccagcaacatcatgcacagcatcaatggctatgtgtttgacagcctgcagctgtctgtgtgcctgcatgaggtgg cctactggtacatcctgagcattggggcccagactgacttcctgtctgtgttcttctctggctacaccttcaagca caagatggtgtatgaggacaccctgaccctgttccccttctctggggagactgtgttcatgagcatggagaaccct ggcctgtggattctgggctgccacaactctgacttcaggaacaggggcatgactgccctgctgaaagtctccagct gtgacaagaacactggggactactatgaggacagctatgaggacatctctgcctacctgctgagcaagaacaatgc cattgagcccaggagcttcagccagaatgccactaatgtgtctaacaacagcaacaccagcaatgacagcaatgtg tctcccccagtgctgaagaggcaccagagggagatcaccaggaccaccctgcagtctgaccaggaggagattgact atgatgacaccatctctgtggagatgaagaaggaggactttgacatctacgacgaggacgagaaccagagccccag gagcttccagaagaagaccaggcactacttcattgctgctgtggagaggctgtgggactatggcatgagcagcagc ccccatgtgctgaggaacagggcccagtctggctctgtgccccagttcaagaaggtggtgttccaggagttcactg atggcagcttcacccagcccctgtacagagggggagctgaatgagcacctgggcctgctgggcccctacatcagggc tgaggtggaggaacacatcatggtgaccttcaggaaccaggccagcaggccctacagcttctacagcagcctgatc agctatgaggagaccagaggcaggggctgagcccaggaagaactttgtgaagcccaatgaaaccaagacctact tctggaaggtgcagcaccacatggcccccaccaaggatgagtttgactgcaaggcctgggcctacttctctgatgt ggacctggagaaggatgtgcactctggcctgattggccccctgctggtgtgccacaccaacaccctgaaccctgcc catggcaggcaggtgactgtgcaggatttgccctgttcttcaccatctttgatgaaaccaagagctggctacttca ctgagaacatggagaggaactgcagggccccctgcaacatccagatggaggaccccaccttcaaggagaactacag gttccatgccatcaatggctacatcatggacaccctgcctggcctggtgatggcccaggaccagaggatcaggtgg tacctgctgagcatgggcagcaatgagaaacatccacagcatccacttctctggccatgtgttcactgtgaggaaga aggaggagtacaagatggccctgtacaacctgtaccctggggtgtttgagactgtggagatgctgcccagcaaggc tggcatctggagggtggagtgcctgattggggagcacctgcatgctggcatgagcaccctgttcctggtgtacagc aacaagtgccagacccccctgggcatggcctctggccacatcaggacttccagatcactgcctctggccagtatg gccagtgggcccccaagctggccaggctgcactactctggcagcatcaatgcctggagcaccaaggagcccttcag ctggatcaaggtggacctgctggcccccatgatcatccatggcatcaagacccagggggccaggcagaagttcagc agcctgtacatcagccagttcatcatcatgtacagcctggatggcaagaagtggcagacctacaggggcaacagca ctggcaccctgatggtgttctttggcaatgtggacagctctggcatcaagcacaacatcttcaacccccccatcattgccagatacatcaggctgcaccccacccactacagcatcaggagcaccctgaggatggagctgatgggctgtgac ctgaacagctgcagcatgcccctgggcatggagagcaaggccatctctgatgcccagatcactgccagcagctact tcaccaacatgtttgccacctggagccccagcaaggccaggctgcacctgcagggcaggagcaatgcctggaggcc ccaggtcaacaaccccaaggagtggctgcaggtggacttccagaagaccatgaaggtgactggggtg accacccagggggtgaagagcctgctgaccagcatgtatgtgaaggagttcctgatcagcagcagccaggatggccaccagtggaccctgttcttccagaatggcaaggtgaaggtgttccagggcaaccaggacagcttcacccctgtggtgaacagcctggacccccccctgctgaccagatacctgaggattcacccccagagctgggtgcaccagattgccctgaggatggaggtgctgggctgtgaggcccaggacctgtacGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGACTACAAGGATGACGATGACAAGTGAtcgcgaataaaagatctttattttcattagatctgtgtgttggttttttgtgtgatgcagc gtatttaataggcagcagtgtggGAGCTCTTGTCGAGGTCGACATTTAAATGAATTCCAATTGaggaa cccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgccc gacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcag (SEQ ID NO:58)

[0690] The sequence of Example 4 above

[0691] HITI 3'Human ALb

[0692] Construct p939_pCbh-SpCas9(BB)-2A-GFP + scrambled gRNA

[0693] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC(SEQ ID NO:59)

[0694] Human U6 promoter

[0695] Gactcgcgcgagtcgaggag(SEQ ID NO:111)

[0696] Scrambling RNA

[0697] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTTTT(SEQ ID NO:60)

[0698] Chimeric gRNA scaffold

[0699] cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttgg(SEQ ID NO:61)

[0700] CBH promoter

[0701] ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG(SEQ ID NO:62)

[0702] 3×Flag tag

[0703] ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAA AAAGGCCGGCCAGGCAAAAAAGAAAAAG (SEQ ID NO:112)

[0704] 5' nuclear localization signal +SpCas9+ 3' nuclear localization signal

[0705] GGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCA(SEQID NO:63)

[0706] Thosea Asigna virus T2A jumping peptide

[0707] GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGAATTCTAA(SEQ ID NO:64)

[0708] EGFP fusion protein

[0709] Ctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagagaatagcaggcatgctgggga(SEQ ID NO:65)

[0710] BGH polyA

[0711] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGA CCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG(SEQ ID NO:66)

[0712] 3’ITR

[0713] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG gactcgcgcgagtcgaggagGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTTTAGCGCGTGCGCCAATTCTGCAGACAAATGGCTCTAGAGGTACCcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttggACCGGTGCCACCATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGG AGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCG CTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCG G GCGGCCTCAGTGAGCGAGCGAGCGC GCAGCTGCCTGCAGG (SEQ ID NO:67)

[0714] Construct p1526_pCbh-SpCas9(BB)-2A-GFP+3' human albumin gRNA1

[0715] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC(SEQ ID NO:59)

[0716] Human U6 promoter

[0717] Aatctctggacggaagctca(SEQ ID NO:10)

[0718] gRNA1 human albumin

[0719] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTTTT(SEQ ID NO:60)

[0720] Chimeric gRNA scaffold

[0721] Cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttgg(SEQ ID NO:61) CBH promoter

[0722] ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG(SEQ ID NO:62)

[0723] 3×Flag tag

[0724] ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAA AAAGGCCGGCCAGGCAAAAAAGAAAAAG (SEQ ID NO:68)

[0725] 5’ Nuclear localization signal +SpCas9+ 3’ Nuclear localization signal

[0726] GGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCA(SEQID NO:63)

[0727] Thosea Asigna virus T2A skipping peptide

[0728] GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGAATTCTAA

[0729] EGFP fusion protein

[0730] Ctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagagaatagcaggcatgctgggga(SEQ ID NO:65)

[0731] BGH polyA

[0732] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGA CCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG(SEQ ID NO:66)

[0733] 3’ ITR

[0734] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG aatctctggacggaagctcaGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTTTAGCGCGTGCGCCAATTCTGCAGACAAATGGCTCTAGAGGTACCcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttggACCGGTGCCACCATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGG AGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCG CTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGC GCAGCTGCCTGCAGG (SEQ ID NO:69)

[0735] Construct p1530_pCbh-SpCas9(BB)-2A-GFP+3' human albumin gRNA2

[0736] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC(SEQ ID NO:59)

[0737] Human U6 promoter

[0738] Acagtatggcacaatagagc(SEQ ID NO:12)

[0739] gRNA2 human albumin

[0740] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTTTT(SEQ ID NO:60)

[0741] Chimeric gRNA scaffold

[0742] cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttgg

[0743] CBH promoter

[0744] ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG(SEQ ID NO:62)

[0745] 3×Flag tag

[0746] ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAA AAAGGCCGGCCAGGCAAAAAAGAAAAAG (SEQ ID NO:70)

[0747] 5’ nuclear localization signal +SpCas9+ 3’ nuclear localization signal

[0748] GGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCA(SEQID NO:63)

[0749] Thosea Asigna virus T2A skipping peptide

[0750] GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGAATTCTAA

[0751] EGFP fusion protein

[0752] Ctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagagaatagcaggcatgctgggga(SEQ ID NO:65)

[0753] BGH polyA

[0754] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGA CCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG(SEQ ID NO:66)

[0755] 3’ ITR

[0756] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG acagtatggcacaatagagcGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTTTAGCGCGTGCGCCAATTCTGCAGACAAATGGCTCTAGAGGTACCcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttggACCGGTGCCACCATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGG AGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCG CTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGC GCAGCTGCCTGCAGG (SEQ ID NO:71)

[0757] Construct p1531_pCbh-SpCas9(BB)-2A-GFP+3' human albumin gRNA3

[0758] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC(SEQ ID NO:59)

[0759] Human U6 promoter

[0760] Acactacataacgtgatgag(SEQ ID NO:13)

[0761] gRNA3 human albumin

[0762] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTTTT(SEQ ID NO:60)

[0763] Chimeric gRNA scaffold

[0764] cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttgg

[0765] CBH promoter

[0766] ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG(SEQ ID NO:62)

[0767] 3×Flag tag

[0768] ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAA AAAGGCCGGCCAGGCAAAAAAGAAAAAG (SEQ ID NO:72)

[0769] 5’ nuclear localization signal +SpCas9+ 3’ nuclear localization signal

[0770] GGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCA(SEQID NO:63)

[0771] Thosea Asigna virus T2A skipping peptide

[0772] GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGAATTCTAA

[0773] EGFP fusion protein

[0774] Ctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagagaatagcaggcatgctgggga(SEQ ID NO:65)

[0775] BGH polyA

[0776] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGA CCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG(SEQ ID NO:66)

[0777] 3’ ITR

[0778] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG acactacataacgtgatgagGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTTTAGCGCGTGCGCCAATTCTGCAGACAAATGGCTCTAGAGGTACCcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttggACCGGTGCCACCATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGG AGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCG CTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGC GCAGCTGCCTGCAGG (SEQ ID NO:73)

[0779] Construct p1532_pCbh-SpCas9(BB)-2A-GFP+3' human albumin gRNA4

[0780] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC(SEQ ID NO:59)

[0781] Human U6 promoter

[0782] Aaatagtttagaatagtggt(SEQ ID NO:14)

[0783] gRNA4 human albumin

[0784] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTTTT(SEQ ID NO:60)

[0785] Chimeric gRNA scaffold

[0786] cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttgg

[0787] CBH promoter

[0788] ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG(SEQ ID NO:62)

[0789] 3×Flag tag

[0790] ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAA AAAGGCCGGCCAGGCAAAAAAGAAAAAG (SEQ ID NO:109)

[0791] 5’ Nuclear localization signal +SpCas9+ 3’ Nuclear localization signal

[0792] GGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCA(SEQID NO:63)

[0793] Thosea Asigna virus T2A skip peptide

[0794] GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGAATTCTAA

[0795] EGFP fusion protein

[0796] Ctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagagaatagcaggcatgctgggga(SEQ ID NO:65)

[0797] BGH polyA

[0798] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGA CCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG(SEQ ID NO:66)

[0799] 3’ ITR

[0800] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG aaatagtttagaatagtggtGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTTTAGCGCGTGCGCCAATTCTGCAGACAAATGGCTCTAGAGGTACCcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttggACCGGTGCCACCATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGG AGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCG CTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGC GCAGCTGCCTGCAGG (SEQ ID NO:74)

[0801] Construct p1556_pCbh-SpCas9(BB)-2A-GFP+3' human albumin gRNA5GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACA AAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC(SEQ ID NO:59)

[0802] Human U6 promoter

[0803] Gtgggctgtaatcatcgtct(SEQ ID NO:16)

[0804] gRNA5 human albumin

[0805] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTTTT(SEQ ID NO:60)

[0806] Chimeric gRNA scaffold

[0807] cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttgg

[0808] CBH promoter

[0809] ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG(SEQ ID NO:62)

[0810] 3×Flag tag

[0811] ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAA AAAGGCCGGCCAGGCAAAAAAGAAAAAG (SEQ ID NO:75)

[0812] 5’ Nuclear localization signal +SpCas9+ 3’ Nuclear localization signal

[0813] GGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCA(SEQID NO:63)

[0814] Thosea Asigna virus T2A skipping peptide

[0815] GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGAATTCTAA

[0816] EGFP fusion protein

[0817] Ctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagagaatagcaggcatgctgggga(SEQ ID NO:65)

[0818] BGH polyA

[0819] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGA CCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG(SEQ ID NO:66)

[0820] 3’ ITR

[0821] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG gtgggctgtaatcatcgtctGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTTTAGCGCGTGCGCCAATTCTGCAGACAAATGGCTCTAGAGGTACCcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttggACCGGTGCCACCATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGG AGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCG CTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGC GCAGCTGCCTGCAGG (SEQ ID NO:76)

[0822] Construct p1545_pTIGEM_hALB3'HITI donor (SAS_albex13_ex14_T2A_dsRED_WPRE_bGHpA)

[0823] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (SEQ ID NO: 110)

[0824] 5'-ITR

[0825] CCA CTCATCACGTTATTGTAGTGT(SEQ ID NO:77)

[0826] Human albumin intron 12+ PAM sequence reverse gRNA sequence

[0827] Gataggcacctattggtcttactgacatccactttgcctttctctccacag(SEQ ID NO:21)

[0828] Splice acceptor sequence

[0829] TGCACTTGTTGAGCTCGTGAAACACAAGCCCAAGGCAACAAAAGAGCAACTGAAAGCTGTTATGGATG ATTTCGCAGCTTTTGTAGAGAAGTGCTGCAAGGCTGACGATAAGGAGACCTGCTTTGCCGAGGAG(SEQ ID NO: 78)

[0830] Exon 13 human albumin

[0831] Ggtaaaaaacttgttgctgcaagtcaagctgccttaggctta(SEQ ID NO:79)

[0832] Exon 14 human albumin

[0833] GGAAGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCT(SEQID NO:23)

[0834] Thosea asigna virus 2A (T2A) jumping peptide

[0835] ATGGATAGCACTGAGAACGTCATCAAGCCCTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCAAGCCCTACGAGGGCACCCAGACCGCCAAGCTGCAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCACCTTCATCTACCACGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACTCTGGGCTGGGAGCCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCGCTGAAGCTGAAGGGCGGCGGCCACTACCTGGTGGAGTTCAAGTCAATCTACATGGCCAAGAAGCCCGTGAAGCTGCCCGGCTACTACTACGTGGACTCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCGTGGTGGAGCAGTACGAGCGCGCCGAGGCCCGCCACCACCTGTTCCAGTAGDiscosoma Red (DsRed) coding sequence

[0836] aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttac gctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttg tataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgt ttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccct ccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgac aattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcg ggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcg gcctcttccgcgtcttcg

[0837] Post-transcriptional regulatory element of woodchuck hepatitis virus (WPRE)

[0838] gcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccct ggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattct attctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctgggga(SEQ ID NO:26)

[0839] Bovine growth hormone polyadenylation (BGH pA)

[0840] CCA CTCATCACGTTATGTAGTGT(SEQ ID NO:77)

[0841] Human albumin intron 12+ PAM sequence Reverse gRNA sequence

[0842] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG(SEQ ID NO:29)

[0843] 3’-ITR

[0844] ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcctgctagtgctagcggcgcgcctcta CCA CTCATCACGTTATGTAGTGTgataggcacctattggtcttactgacatccactttgcctttctctccacag TGCACTTGTTGAGCTCGTGAAACACAAGCCCAAGGCAACAAAAGAGCAACTGAAAGCTGTTATGGATG ATTTCGCAGCTTTTGTAGAGAAGTGCTGCAAGGCTGACGATAAGGAGACCTGCTTTGCCGAGGAGggtaaaaaact tgttgctgcaagtcaagctgccttaggcttaGGAAGCGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCTATGGATAGCACTGAGAACGTCATCAAGCCCTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCAAGCCCTACGAGGGCACCCAGACCGCCAAGCTGCAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCCAGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTACAAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCACCTTCATCTACCACGTGAAGTTCATCGGCGTGAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACTCTGGGCTGGGAGCCCTCCACCGAGCGCCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCGCTGAAGCTGAAGGGCGGCGGCCACTACCTGGTGGAGTTCAAGTCAATCTACATGGCCAAGAAGCCCGTGAAGCTGCCCGGCTACTACTACGTGGACTCCAAGCTGGACATCACCTCCCACAACGAGGACTACACCGTGGTGGAGCAGTACGAGCGCGCCGAGGCCCGCCACCACCTGTTCCAGTAGgatcc aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgc tccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttc tcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgt gcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgc tttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttg ggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctgga ttctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgcc ggctctgcggcctcttccgcgtcttcgagatctgcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctgggga CCA CTCATCACGTTATGTAGTGTagctcttgtcgaggaattgAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAG(SEQ ID NO:80)

[0845] Construct p1615_pCbh-SpCas9(BB)-2A-GFP + 3'Human Albumin gRNA6

[0846] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC(SEQ ID NO:59)

[0847] Human U6 promoter

[0848] Tattggcagtcaaggccccg(SEQ ID NO:17)

[0849] gRNA6 Human Albumin

[0850] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTTTT(SEQ ID NO:60)

[0851] Chimeric gRNA scaffold

[0852] cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttgg

[0853] CBH promoter

[0854] ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG(SEQ ID NO:62)

[0855] 3×Flag tag

[0856] ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAA AAAGGCCGGCCAGGCAAAAAAGAAAAAG (SEQ ID NO:81)

[0857] 5' nuclear localization signal +SpCas9+ 3' nuclear localization signal

[0858] GGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCA(SEQID NO:63)

[0859] Thosea Asigna virus T2A skipping peptide

[0860] GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGAATTCTAA

[0861] EGFP fusion protein

[0862] Ctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagagaatagcaggcatgctgggga(SEQ ID NO:65)

[0863] BGH polyA

[0864] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGA CCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG(SEQ ID NO:66)

[0865] 3’ ITR

[0866] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG tattggcagtcaaggccccgGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTTTAGCGCGTGCGCCAATTCTGCAGACAAATGGCTCTAGAGGTACCcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttggACCGGTGCCACCATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGG AGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCG CTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGC GCAGCTGCCTGCAGG (SEQ ID NO:82)

[0867] Construct p1616_pCbh-SpCas9(BB)-2A-GFP+3' human albumin gRNA7GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACA AAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC(SEQ ID NO:59)

[0868] Human U6 promoter

[0869] Tcgaatgtattgtgacagag (SEQ ID NO:18)

[0870] gRNA7 human albumin

[0871] GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTTTT(SEQ ID NO:60)

[0872] Chimeric gRNA scaffold

[0873] cgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttgg

[0874] CBH promoter

[0875] ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG(SEQ ID NO:62)

[0876] 3×Flag tag

[0877] ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAA AAAGGCCGGCCAGGCAAAAAAGAAAAAG (SEQ ID NO:19)

[0878] 5’ nuclear localization signal +SpCas9+ 3’ nuclear localization signal

[0879] GGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCA(SEQID NO:63)

[0880] Thosea Asigna virus T2A jumping peptide

[0881] GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGAATTCTAA

[0882] EGFP fusion protein

[0883] Ctagagctcgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagagaatagcaggcatgctgggga(SEQ ID NO:65)

[0884] BGH polyA

[0885] AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGA CCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG(SEQ ID NO:66)

[0886] 3’ ITR

[0887] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG tcgaatgtattgtgacagagGTTTTAGAGCTAGAAATAGCAAGTTA AAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTTTAGCGCGTGCGCCAATTCTGCAGACAAATGGCTCTAGAGGTACCcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgacgctgccttcgccccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggtgagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatggttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttggACCGGTGCCACCATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAG ATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGG AGTCCCAGCAGCCAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAGGCAAAAAAGAAAAAGAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCG CTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGC GCAGCTGCCTGCAGG (SEQ ID NO:83)

[0888] The sequence of Example 5 above

[0889] The sequence of the ITR donor DNA construct (the donor DNA is not flanked by 5' and 3' inverted gRNA sites_p1547)

[0890] 5'ITR

[0891] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT (SEQ ID NO: 110)

[0892] Other AAV sequences

[0893] Gctagtgctagc(SEQ ID NO:84)

[0894]

[0895] mouse albumin exon 14

[0896] ggtccaaaccttgtcactagatgcaaagacgccttagcc(SEQ ID NO:22)

[0897] T2A sequence

[0898] Ggaagcggagagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggacct(SEQID NO:23)

[0899]

[0900] Additional AAV sequence

[0901] Tttagagctagaaatagcaagttaaaataaggctagtccgtttttagcgcgtgcgccaattctgcaga caaatggctctagaggtaccaattg(SEQ ID NO:87)

[0902] 3’ ITR sequence

[0903] Aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcga ccaaaggtcgcccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagt(SEQ ID NO:29)

[0904] Full sequence_p1547

[0905] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT

[0906]

[0907] References

[0908] 1. Cong, L. et al., Multiplex genome engineering using CRISPR / Cas systems. Science, 2013. 339(6121): pp. 819 - 23.

[0909] 2. Jiang, W. et al., RNA - guided editing of bacterial genomes using CRISPR - Cas systems. Nat Biotechnol, 2013. 31(3): pp. 233 - 9.

[0910] 3. Tu, Z. et al., CRISPR / Cas9: a powerful genetic engineering tool for establishing large animal models of neurodegenerative diseases. Mol Neurodegener, 2015. 10: p. 35.

[0911] 4. Nishiyama, J., T. Mikuni and R. Yasuda, Virus - Mediated Genome Editing via Homology - Directed Repair in Mitotic and Postmitotic Cells in Mammalian Brain. Neuron, 2017. 96(4): pp. 755 - 768e5.

[0912] 5. Anguela, X.M. et al., Robust ZFN - mediated genome editing in adult hemophilic mice. Blood, 2013. 122(19): pp. 3283 - 7.

[0913] 6. Barzel, A. et al., promoter-less gene targeting without nucleasesameliorates haemophilia B in mice. Nature, 2015, 517(7534): 360-4.

[0914] 7. Li, H. et al., In vivo genome editing restores haemostasis in a mouse model of haemophilia. Nature, 2011, 475(7355): 217-21.

[0915] 8.Sharma, R. et al., In vivo genome editing of the albumin locus as a platform for protein replacement therapy. Blood, 2015.126(15): pp. 1777-84.

[0916] 9. Bakondi, B., In vivo versus ex vivo CRISPR therapies for retinaldystrophy. Expert Rev Ophthalmol, 2016.11(6): Pages 397-400.

[0917] 10. Lackner, DH et al., A generic strategy for CRISPR-Cas9-mediated genetagging. Nat Commun, 2015.6: 10237.

[0918] 11.Suzuki, K. et al., In vivo genome editing via CRISPR / Cas9 mediatedhomology-independent targeted integration. Nature, 2016.540(7631): pp. 144-149.

[0919] 12. Brunetti - Pierri N, A. A., Gene Therapy of Human Inherited Diseases, in The Metabolic and Molecular Bases of Inherited Diseases, S. R, Editor. 2010, McGraw Hill: New York.

[0920] 13. Ehrhardt, A., H. Xu and M. A. Kay, Episomal persistence of recombinant adenoviral vector genomes during the cell cycle in vivo. J Virol, 2003. 77(13): pp. 7689 - 95.

[0921] 14. E Neufeld, J. M., The mucopolysaccharidoses, in The mucopolysaccharidoses, A. B. C. R. Scriver, W. S. Sly, D. M. Valle, Editor. 2001, McGraw - Hill: New York(2001). pp. 3421 - 3452.

[0922] 15. Cotugno, G. et al., Impact of age at administration, lysosomal storage, and transgene regulatory elements on AAV2 / 8 - mediated rat liver transduction. PLoS One, 2012. 7(3): pp. e33286.

[0923] 16. Ferla, R. et al., Similar therapeutic efficacy between a single administration of gene therapy and multiple administrations of recombinant enzyme in a mouse model of lysosomal storage disease. Hum Gene Ther, 2014. 25(7): pp. 609 - 18.

[0924] 17. Ferla, R. et al., Gene therapy for mucopolysaccharidosis type VI is effective in cats without pre-existing immunity to AAV8. Hum Gene Ther, 2013. 24(2): pp. 163-9.

[0925] 18. Tessitore, A. et al., Biochemical, pathological, and skeletal improvement of mucopolysaccharidosis VI after gene transfer to liver but not to muscle. Mol Ther, 2008. 16(1): pp. 30-7.

[0926] 19. Alliegro, M. et al., Low-dose Gene Therapy Reduces the Frequency of Enzyme Replacement Therapy in a Mouse Model of Lysosomal Storage Disease. Mol Ther, 2016. 24(12): pp. 2054-2063.

[0927] 20. Ferla, R. et al., Non-clinical Safety and Efficacy of an AAV2 / 8 Vector Administered Intravenously for Treatment of Mucopolysaccharidosis Type VI. Mol Ther Methods Clin Dev, 2017. 6: pp. 143-158.

[0928] 21. Cotugno, G. et al., Long-term amelioration of feline Mucopolysaccharidosis VI after AAV-mediated liver gene transfer. Mol Ther, 2011. 19(3): pp. 461-9.

[0929] 22. Giugliani, R. et al., Natural history and galsulfase treatment in mucopolysaccharidosis VI (MPS VI, Maroteaux-Lamy syndrome)--10-year follow-up of patients who previously participated in an MPS VI Survey Study. Am J Med Genet A, 2014. 164A(8): pp. 1953-64.

[0930] 23. Desnick, R. J and E. H. Schuchman, Enzyme replacement therapy for lysosomal diseases: lessons from 20 years of experience and remaining challenges. Annu Rev Genomics Hum Genet, 2012. 13: pp. 307-35.

[0931] 24. Neufeld, E. F., Lysosomal storage diseases. Annu Rev Biochem, 1991. 60: pp. 257-80.

[0932] 25. Bowen, D. J., Haemophilia A and haemophilia B: molecular insights. Mol Pathol, 2002. 55(2): pp. 127-44.

[0933] 26. Bunting, S. et al., Gene Therapy with BMN 270 Results in Therapeutic Levels of FVIII in Mice and Primates and Normalization of Bleeding in Hemophilic Mice. Mol Ther, 2018. 26(2): pp. 496-509.

[0934] 27. Rangarajan, S. et al., AAV5 - Factor VIII Gene Transfer in Severe Hemophilia A. N Engl J Med, 2017. 377(26): pp. 2519 - 2530.

[0935] 28. Makris, M. Gene therapy 1·0 in haemophilia: effective and safe, but with many uncertainties. The Lancet Haematology (2020) doi:10.1016 / S2352 - 3026(20)30035 - 1

[0936] 29. Grieger, J.C. et al., Packaging Capacity of Adeno - Associated Virus Serotypes: Impact of Larger Genomes on Infectivity and Postentry Steps. J.Virol. (2005)

[0937] 30. Dong, B. et al., Characterization of genome integrity for oversized recombinant AAV vector. Mol.Ther. (2010)

[0938] 31. Hirsch, M. et al., Little vector, big gene transduction: Fragmented genome reassembly of adeno - associated virus. Molecular Therapy (2010)

[0939] 32. Wu, Z. et al., Effect of genome size on AAV vector packaging. Mol.Ther. (2010)

[0940] 33. McIntosh J, Lenting PJ, Rosales C, Lee D, Rabbanian S, Raj D, Patel N, Tuddenham EG, Christophe OD, McVey JH, Waddington S, Nienhuis AW, Gray JT, Fagone P, Mingozzi F, Zhou SZ, High KA, Cancio M, Ng CY, Zhou J, Morton CL, Davidoff AM, Nathwani AC. Therapeutic levels of FVIII following a single peripheral vein administration of rAAV vector encoding a novel human factor VIII variant. Blood. 2013 Apr 25;121(17):3335-44. doi:10.1182 / blood-2012-10-462200. Epub 2013 Feb 20. PMID:23426947; PMCID:PMC3637010.

[0941] 34. Doria, M., A. Ferrara, and A. Auricchio, AAV2 / 8 vectors purified from culture medium with a simple and rapid protocol transduce murine liver, muscle, and retina efficiently. Hum Gene Ther Methods, 2013. 24(6): pp. 392-8.

[0942] 35.Ferla R,Claudiani P,Cotugno G,Saccone P,De Leonibus E,AuricchioA.Similar therapeutic efficacy between a single administration of genetherapy and multiple administrations of recombinant enzyme in a mouse modelof lysosomal storage disease.Hum Gene Ther.2014;25(7):609-618.doi:10.1089 / hum.2013.213

[0943] 36.Harmatz PR,Shediac R.Mucopolysaccharidosis VI:Pathophysiology,diagnosis and treatment.Front Biosci-Landmark.2017;22(3):385-406.doi:10.2741 / 4490

[0944] 37.Paddison PJ,Caudy AA,Bernstein E,Hannon GJ,Conklin DS.Shorthairpin RNAs(shRNAs)induce sequence-specific silencing in mammaliancells.Genes Dev.2002Apr 15;16(8):948-58.doi:10.1101 / gad.981002.PMID:11959843;PMCID:PMC152352.

[0945] 38.Paul CP,Good PD,Winer I,Engelke DR.Effective expression of smallinterfering RNA in human cells.Nat Biotechnol.2002May;20(5):505-8.doi:10.1038 / nbt0502-505.PMID:11981566.

[0946] 39.Drittanti,L.Special,High throughput production,screening and analysisof adeno-associated viral vectors.Gene Ther,2000.7(11):Vol.

[0947] 40.Antonarakis,SE Activity,Molecular etiology of factor VIII deficiencyin hemophilia A.Adv Exp Med Biol,1995.386:Page 19-34.

Claims

1. A method for integrating an exogenous DNA sequence into the genome of a cell, comprising contacting the cell with: a) a donor nucleic acid, comprising: - said exogenous DNA sequence, - optionally one or more albumin exons, wherein the donor nucleic acid is flanked by reverse targeting sequences at 5' and 3'; b) a complementary strand oligonucleotide homologous to the target sequence, and c) a nuclease that recognizes the targeting sequence, The targeting sequence is located at the 3' end of the albumin gene in a region selected from the group consisting of intron 9, intron 11, intron 12, intron 13 and intron 14 of the albumin gene.

2. The method of claim 1, wherein the donor nucleic acid comprises one or more albumin exons, and the exons are exon 13 and / or exon 14 or fragments thereof.

3. The method according to claim 1, wherein the donor nucleic acid comprises one or more albumin exons, and the exons are exon 10 and / or exon 11 and / or exon 12 and / or exon 13 and / or exon 14 or fragments thereof.

4. The method according to any one of the preceding claims, wherein the complementary strand oligonucleotide homologous to the targeting sequence is a guide RNA hybridizing to a targeting sequence located within intron 9, intron 11, intron 12, intron 13 or intron 14 of the albumin gene or its complementary strand, preferably the guide RNA is adjacent to a protospacer adjacent motif (PAM) sequence.

5. The method according to any one of claims 1 to 4, wherein the albumin gene is a human gene or a mouse gene.

6. The method according to any one of claims 1 to 5, wherein the complementary strand oligonucleotide homologous to the targeting sequence is under the control of a promoter, preferably a U6 promoter.

7. The method according to any one of claims 1 to 6, wherein the exogenous DNA sequence is the coding sequence of the arylsulfatase B (ARSB) gene, preferably the coding sequence of the ARSB comprises SEQ ID NO: 33 or substantially has a sequence having at least 95% identity with SEQ ID NO:

33.

8. The method according to any one of claims 1 to 6, wherein the exogenous DNA sequence is the coding sequence of the factor 8 (F8) gene, preferably the coding sequence of F8 comprises SEQ ID NO: 36 or 55 or substantially has a sequence having at least 95% identity with SEQ ID NO: 36 or 55.

9. The method according to any one of claims 1 to 8, wherein the reverse targeting sequence is a reverse sequence relative to a target sequence located in a region selected from intron 9, intron 11, intron 12, intron 13 and intron 14 at the 3' end of the albumin gene, preferably the reverse targeting sequence is linked to a protospacer adjacent motif (PAM) sequence at its 3' end.

10. The method of any one of claims 1-9, wherein the donor nucleic acid further comprises one or more of the following: - a post-transcriptional regulatory element, preferably located at the 3' end of the exogenous DNA sequence; - a transcription termination sequence, preferably located at the 3' end of the post-transcriptional regulatory element or at the 3' end of the exogenous DNA sequence; - a splice acceptor sequence, preferably located at the 3' end of the donor nucleic acid, for example linked to the albumin exon, if present; - a ribosomal skipping sequence, preferably located between said exogenous DNA sequence and said albumin exon.

11. The method according to claim 10, wherein the ribosomal skipping sequence is T2A, P2A, E2A, F2A, preferably a T2A sequence and / or the post-transcriptional regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) and / or the transcription termination sequence is a polyadenylation signal sequence, preferably bovine growth hormone polyadenylate (BGH polyA).

12. The method according to any one of claims 1 to 10, wherein the targeting sequence comprises any one of SEQ ID NOs: 1-2, SEQ ID NOs: 9-18, or a functional fragment thereof, or substantially has a sequence having at least 95% identity with any one of SEQ ID NOs: 1-2, SEQ ID NOs: 9-18, or a functional fragment thereof, and / or the complementary strand oligonucleotide homologous to the targeting sequence comprises any one of SEQ ID NOs: 1-2, SEQ ID NOs: 9-18, or a functional fragment thereof, or substantially has a sequence having at least 95% identity with any one of SEQ ID NOs: 1-2, SEQ ID NOs: 9-18, or a functional fragment thereof.

13. The method of any one of claims 1-12, wherein the donor nucleic acid comprises: - a first reverse targeting sequence and its protospacer adjacent motif (PAM) sequence; - splice acceptor sequence; - one or more albumin exons, preferably one or more exons selected from exon 13 and exon 14; - a ribosomal skipping sequence, preferably T2A; - an exogenous DNA sequence, preferably the coding sequence of the human ARSB gene; - a transcription termination sequence; and - A second reverse targeting sequence and its protospacer adjacent motif (PAM) sequence.

14. The method according to any one of claims 1-13, wherein the nuclease is preferably selected from: CRISPR nuclease, TALEN, DNA-guided nuclease, mega nuclease and zinc finger nuclease, preferably the nuclease is a CRISPR nuclease selected from the group consisting of: Cas9, Cpf1, Cas12b (C2c1), Cas13a (C2c2), Cas3, Csf1, Cas13b (C2c6) and C2c3 or variants thereof, such as SaCas9 or VQR-Cas9-HF1.

15. The method according to any one of claims 1 to 14, wherein the cell is contacted with a nucleic acid encoding the nuclease, preferably the nucleic acid encoding the nuclease is under the control of a tissue-specific promoter, such as the liver-specific hybrid liver promoter (HLP).

16. The method according to any one of claims 1 to 15, wherein the complementary strand oligonucleotide, the donor nucleic acid and the nucleic acid encoding the nuclease are contained in a viral vector or a non-viral vector, preferably the viral vector is selected from: adeno-associated virus, lentivirus, retrovirus and adenovirus.

17. The method according to any one of claims 1-16, wherein the cell is selected from the group consisting of: liver cells, lymphocytes, monocytes, neutrophils, eosinophils, basophils, endothelial cells, epithelial cells, hepatocytes, bone cells, platelets, adipocytes, cardiomyocytes, neurons, retinal cells, smooth muscle cells, skeletal muscle cells, spermatocytes, oocytes and pancreatic cells, induced pluripotent stem cells (iPS cells), stem cells, hematopoietic stem cells, hematopoietic progenitor stem cells, one or more, preferably the cell is a liver cell of a subject.

18. Cells obtainable by the method of claims 1-17 for use in the treatment of a disease wherein both mutant alleles and wild-type alleles are replaced by a correct copy of the gene provided by the donor DNA, or for the treatment of recessive inherited and common diseases due to loss of function, preferably the disease is selected from: hemophilia; diabetes; lysosomal storage diseases, including mucopolysaccharidoses such as MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVI and MPSVII, sphingolipid storage diseases such as Fabry disease, Gaucher disease, Niemann-Pick disease and GM1 gangliosidosis, lipofuscin storage diseases such as Batten disease, and mucolipidosis; choroidal and retinal gyrus atrophy, adenylo-succinate deficiency, hemophilia A and B, ALA dehydratase deficiency, adrenoleukodystrophy.

19. A system comprising: a) a donor nucleic acid, comprising: - foreign DNA sequences, - optionally one or more albumin exons, wherein the donor nucleic acid is flanked on the 5' and 3' sides by reverse targeting sequences; b) a complementary strand oligonucleotide homologous to the target sequence, and c) a nuclease that recognizes the targeting sequence, The targeting sequence is located in a region selected from the group consisting of intron 9, intron 11, intron 12, intron 13 and intron 14 at the 3' end of the albumin gene.

20. The system according to claim 19, wherein the nuclease is encoded by a nucleic acid, and the donor nucleic acid, the complementary strand oligonucleotide and the nucleic acid encoding the nuclease are located on a DNA construct, preferably the donor nucleic acid and the complementary strand oligonucleotide are located on the same DNA construct, while the nucleic acid encoding the nuclease is located on a separate DNA construct.

21. The system according to any one of claims 19-20, wherein the donor nucleic acid and / or the exogenous DNA sequence and / or the targeting sequence and / or the complementary strand oligonucleotide and / or the nuclease are defined according to any one of claims 1-16.

22. The system according to any one of claims 19-21, wherein the complementary chain oligonucleotide and / or the donor nucleic acid and / or the nucleic acid encoding the nuclease are contained in one or more viral vectors or non-viral vectors, preferably the viral vector is selected from: adeno-associated virus, retrovirus, adenovirus and lentivirus.

23. The system of claim 22, wherein the system comprises a first vector and a second vector, the first vector comprising a nucleic acid expressing a nuclease, and the second vector comprising the donor nucleic acid and the complementary strand oligonucleotide homologous to the targeting sequence, wherein such elements are defined according to any one of claims 1-16.

24. The system of claim 22, wherein the system comprises a first vector and a second vector, the first vector comprising the donor nucleic acid, and the second vector comprising the complementary strand oligonucleotide homologous to a targeting sequence and the nucleic acid encoding the nuclease, wherein such elements are defined according to any one of claims 1-16.

25. The system according to any one of claims 19-24 for use as a medicament.

26. A vector comprising a donor nucleic acid as defined in any one of claims 1 to 16 and / or the complementary strand oligonucleotide homologous to the targeting sequence and / or a nucleic acid encoding a nuclease recognizing the targeting sequence.

27. The vector according to claim 26, wherein the vector is a viral vector, preferably a lentiviral vector or an adeno-associated viral vector, or a non-viral vector, preferably selected from polymer-based, particle-based, lipid-based, peptide-based delivery vehicles or combinations thereof, such as cationic polymers, micelles, liposomes, exosomes, microparticles and nanoparticles including lipid nanoparticles (LNPs).

28. The vector according to claim 26 or 27, further comprising a 5'-terminal repeat (5'-TR) nucleotide sequence and a 3'-terminal repeat (3'-TR) nucleotide sequence, preferably, the 5'-TR is a 5'-inverted terminal repeat (5'-ITR) nucleotide sequence, and the 3'-TR is a 3'-inverted terminal repeat (3'-ITR) nucleotide sequence, preferably the ITR is derived from the same viral serotype or different viral serotypes, preferably the virus is AAV, preferably having serotype 2.

29. A host cell comprising the system according to any one of claims 19-25 or the vector according to any one of claims 26-28.

30. A viral particle comprising the system according to any one of claims 19-25 or the vector according to any one of claims 26-28.

31. The viral particle of claim 30, wherein the viral particle comprises a capsid protein of AAV.

32. The viral particle according to claim 31, wherein the viral particle comprises a capsid protein of AAV, and the serotype of AAV is selected from one or more of the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9 and AAV 10, preferably selected from AAV2 or AAV8 serotype.

33. A pharmaceutical composition comprising one of the following: a system according to any one of claims 19-25, or one or more vectors according to any one of claims 26-28, a host cell according to claim 29, a viral particle according to any one of claims 30-32, and a pharmaceutically acceptable carrier.

34. A kit comprising: a system according to any one of claims 19-25, or one or more vectors according to any one of claims 26-28, a host cell according to claim 29, a viral particle according to any one of claims 30-32, or a pharmaceutical composition according to claim 33 in one or more containers, optionally further comprising instructions or packaging materials describing how to administer the nucleic acid construct, vector, host cell, viral particle or pharmaceutical composition to a patient.

35. The system according to any one of claims 19-25, or the vector according to any one of claims 26-28, the host cell according to claim 29, the viral particle according to any one of claims 30-32 or the pharmaceutical composition according to claim 33, for use as a medicament.

36. The system according to any one of claims 29-25, or the vector according to any one of claims 26-28, the host cell according to claim 29, the viral particle according to any one of claims 30-32, or the pharmaceutical composition according to any one of claims 33, for use in the treatment of the following diseases: liver disease; lysosomal storage diseases, including mucopolysaccharidoses, such as MPSI, MPSII, MPSIIIA, MPSIIIB, MPSIIIC, MPSIVA, MPSIVB, MPSVI and MPSVII, sphingolipid storage diseases, such as Fabry disease, Gaucher disease, Niemann-Pick disease and GM1 gangliosidosis, lipofuscin storage diseases, such as Batten disease and mucolipidosis; other diseases in which the liver can be used as a factory for the production and / or secretion of therapeutic proteins, such as diabetes, gyrus atrophy of the choroid and retina, adenylo-succinate deficiency, hemophilia A and B, ALA dehydratase deficiency, adrenoleukodystrophy.

37. Use of the system according to any one of claims 19 to 25 or the vector according to any one of claims 26 to 28 for producing viral particles.

38. A DNA construct comprising a donor nucleic acid as defined in any one of claims 1 to 16, and / or a complementary strand oligonucleotide homologous to a targeting sequence and / or a nucleic acid encoding a nuclease recognizing the targeting sequence.

Images