A highly bioactive recombinant human type XVII collagen and its preparation method and application
By designing recombinant human XVII collagen ectodomain fragments in Pichia yeast expression system and introducing orthologous promoters, the problem of expressing and secreting highly biologically active collagen in the prior art is solved, and collagen expression with high biological activity and stability is achieved, which is suitable for industrial applications.
Patent Information
- Application Number
- CN202411243992.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-05
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2044-09-05
AI Technical Summary
The prior art is difficult to efficiently express and secrete human XVII collagen with high biological activity, and there is a problem of endotoxin contamination and low biological activity, especially the E. coli expression system is difficult to form trihelix collagen with natural high-level structures.
Using the Pichia cerevisia expression system, the recombinant plasmid pPIC9K-(Col17a)n was constructed by designing the ectodomain fragment of recombinant human XVII collagen and introducing the orthologous promoter of methyl trophic yeast. Gene cloning and electrotransformation were performed using Gibson Assembly seamless connection technology to achieve high-density fermentation and secretion expression of recombinant human XVII collagen.
The stability and solubility of highly biologically active recombinant human XVII collagen was achieved, which significantly improved cell adhesion activity, cell migration activity, tissue regeneration and hair follicle repair ability, and overcome the defects of the E. coli expression system.
Smart Images

Figure CN119143864B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to a recombinant human type XVII collagen with high biological activity, and a preparation method and application thereof. Background Art
[0002] Human type XVII collagen is a transmembrane, non-fibrogenic collagen protein. It is a homogeneous trimer composed of three identical α1(XVII) chains with a single-chain molecular weight of 180 kDa. It contains a 70 kDa globular intracellular domain, a transmembrane domain, and a 120 kDa extracellular collagen domain, and is highly thermally stable. Human type XVII collagen, with its N-terminus located in the cytoplasm and its C-terminus in the extracellular matrix, is divided into three major domains: intracellular, transmembrane, and extracellular. These domains can be further divided into 16 non-triple-helical regions and 15 triple-helical regions based on whether they contain the typical (Gly-XY)n amino acid repeat sequence and whether they can form triple-helical regions. These collagen and non-collagenous domains jointly participate in the interaction with the extracellular matrix. It is primarily expressed in epidermal basal keratinocytes.
[0003] Human type XVII collagen, as an important component of hemidesmosomes in cells, plays an important role in maintaining tight junctions between the basement membrane and the extracellular matrix. It regulates the adhesion, separation, and developmental differentiation of epithelial cells and plays an important role in the differentiation and regeneration of keratinocytes. Type XVII collagen is an important regulator in the wound repair process. During wound healing, the expression and cleavage of type XVII collagen in basal keratinocytes are strongly induced. The 120kDa extracellular domain of type XVII collagen is cleaved by A disintegrin and metalloproteinases (ADAMs) 9 and 10. In addition, in quiescent hair follicle stem cells, the expression of type XVII collagen is reduced. Knocking out the gene for type XVII collagen leads to hair loss. Therefore, type XVII collagen plays a key role in hair growth.
[0004] However, type XVII collagen is present in very low concentrations in humans and animals, making its extraction extremely difficult. Traditional methods such as acid, alkali, and enzymatic hydrolysis of animal tissues are not feasible. Extraction of small quantities can only meet scientific research needs, but cannot be mass-produced or widely used. Furthermore, there are unavoidable biosafety risks, such as infection with animal-derived diseases, immune rejection or allergic reactions, and potential viruses. Therefore, with the development of genetic engineering technology, the primary approach to addressing these issues is to obtain recombinant type XVII collagen through biotechniques such as genetic engineering.
[0005] For example, the Chinese patent application number CN110845603A, filed on October 31, 2019, discloses a human collagen type 17 polypeptide expressed in Escherichia coli, its production method and use, wherein the polypeptide comprises 63 to 1496 consecutive amino acid residues of SEQ ID No. 9, wherein the polypeptide comprises the sequence shown in (A) m or consists of the sequence shown in (A) m, and its amino acid sequence is 1-10 tandem repeats of any one of the three polypeptides. The recombinant human collagen produced has very good hydrophilicity and stability, and its amino acid composition is 100% identical to the corresponding part of the natural collagen amino acid sequence. It will not cause immune rejection and allergic reactions when applied to the human body, and can be widely used in the biomedicine and cosmetics industries; the publication number is CN116640231A, filed on October 31, 2019, A Chinese patent on June 9, 2023 discloses a recombinant humanized type 17 collagen polypeptide and a method for preparing the same. The amino acid sequence of the collagen polypeptide rhC17ICD consists of the amino acid sequence of the intracellular region (ICD) of human type 17 collagen or contains the amino acid sequence of the ICD region. The efficient and stable expression of the ICD region of human type 17 collagen is achieved through the E. coli system, and the purification method provided can obtain the target protein with a purity of more than 90%, overcoming the limitations of the recombinant and efficient expression of the ICD region of human type 17 collagen and the problems of poor product stability and easy degradation. However, the above-mentioned invention applications all use the E. coli expression system. E. coli is a prokaryotic organism that cannot perform post-translational modification on proteins. Therefore, it is difficult for the E. coli system to express triple-helical collagen with a natural higher-order structure. In addition, the protein obtained by expression in E. coli may also have problems such as endotoxin contamination and low biological activity.
[0006] In addition, generally speaking, transmembrane proteins are not secreted extracellularly when expressed in eukaryotic cells, but are fixed to the cell membrane. The amino acid sequence of type XVII collagen is very long (1497 amino acids) and the protein molecular weight is large (180kDa). In theory, it is difficult to effectively secrete it extracellularly and it is easily degraded. For successful expression, it is necessary to select relevant sequences. The extracellular domain of type XVII collagen (489-1497aa) contains 15 collagen domains and 16 non-collagenous domains. These domains jointly participate in the interaction with the extracellular matrix and are an important part of maintaining the stability of the basement membrane. The Pichia pastoris protein expression pathway overcomes the defects of collagen expressed by animal sources and Escherichia coli. The yeast expression system has molecular chaperones and enzymes for post-translational modification of proteins (such as glycosylation, hydroxylation, acetylase, etc.), which is very suitable for the formation of triple-helical collagen with a higher-order structure.
[0007] Therefore, on the premise of selecting an amino acid sequence so that it can maintain the advantages of the Pichia pastoris expression system (especially secretory expression), genetic engineering is used to develop recombinant human type XVII collagen with excellent cell adhesion activity, cell migration promoting activity, and biological activity of promoting tissue regeneration and hair follicle repair and regeneration. A preparation method is designed with simple operation, considerable yield, and easy expansion of production, which is of great significance to the current research and application of recombinant human type XVII collagen. Summary of the Invention
[0008] In order to solve the problems existing in the prior art, the present invention provides a highly bioactive recombinant human type XVII collagen protein and its preparation method and application. The collagen protein not only has good solubility and the protein state can maintain stability in the later stage of fermentation, but also has excellent cell adhesion activity, cell migration promoting activity and biological activity of promoting tissue regeneration and hair follicle repair and regeneration.
[0009] The technical solutions of the present invention are as follows:
[0010] One of the purposes of the present invention is to provide a method for preparing recombinant human type XVII collagen with high biological activity, comprising the following steps:
[0011] S1. Analyze the amino acid sequence of the human type XVII collagen α1 chain and select amino acid fragments (489-1497aa) from the non-transmembrane region of the protein that are not easily degraded by endogenous or exogenous proteases. Repeatedly splice the selected fragments to generate a recombinant collagen gene fragment (Col17a)n. Introduce orthologous promoters from different methylotrophic yeasts before the recombinant collagen to optimize the synthesis of the selected (Col17a)n and promoter fragments.
[0012] S2. PCR cloning was used to obtain the connecting fragment, and then the collagen fragment (Col17a)n, the promoter fragment and the pPIC9K vector backbone fragment were connected by Gibson Assembly seamless connection technology to construct the recombinant plasmid pPIC9K-(Col17a)n;
[0013] S3. Preparation of competent Pichia pastoris cells P. pastoris GS115 and expression of human type XVII collagen protein using pPIC9K-(Col17a)n.
[0014] Furthermore, in the recombinant collagen gene fragment (Col17a)n in S1, Col17a is the amino acid sequence shown in SEQ ID NO.1, or an amino acid sequence modified to a certain extent by amino acid substitution, insertion, replacement, addition or deletion on the basis of SEQ ID NO.1, or an amino acid sequence having greater than 80% homology with the amino acid sequence of SEQ ID NO.1.
[0015] Furthermore, n is an integer greater than or equal to 1.
[0016] Furthermore, the orthologous promoter in S1 is the AOX1 promoter from Pichia pastoris or the FMD promoter from Hansenula polymorpha.
[0017] Furthermore, the FMD promoter of Hansenula polymorpha (NCBI sequence number: AY550077.1) was modified and synthesized, and the nucleotide sequence (1-639aa) is shown in SEQ ID NO.2.
[0018] Furthermore, the PCR cloning in S2 includes the following steps:
[0019] S2-1. PCR cloning was performed on the expression vector pPIC9K, collagen fragment, and promoter fragment to obtain a junction fragment. The cloned collagen, promoter, and expression vector pPIC9K fragment were mixed at a concentration ratio of 3:4:1.
[0020] S2-2, using Gibson Assembly seamless ligation technology, the collagen fragment, promoter, and pPIC9K vector backbone fragment obtained in S21 were connected to construct the recombinant plasmid pPIC9K-(Col17a)n;
[0021] S2-3. Incubate the ligation mixture in a metal bath, then transform the ligation mixture into Escherichia coli DH5α competent cells by heat shock method. After overnight culture at 37°C, pick the positive single clones growing on plates containing sodium ampicillin and kanamycin for preliminary verification by colony PCR. The successfully verified single colony is inoculated into a 5 mL LB test tube for culture, and the plasmid is extracted and sequenced to confirm that the recombinant gene is consistent with the design.
[0022] Furthermore, the verification primer in S2-3 is Col17a-F / R.
[0023] Furthermore, the ligation mixture in S2-3 was incubated in a 50° C. metal bath for 1 hour.
[0024] Furthermore, the single colony successfully verified in S2-3 was cultured in a 5 mL LB test tube at 37 degrees for 16 hours.
[0025] Furthermore, the preparation of GS115 competent cells in S3 and the expression of pPIC9K-(Col17a)n include the following steps:
[0026] S3-1. Preparation of electrocompetent cells: Activate GS115 bacterial culture by streaking on a YPD plate and incubate in an incubator until a single colony grows. Pick a single colony and inoculate it into 5 mL of YPD liquid medium. Then, inoculate the seed liquid into 50 mL of YPD at a 1‰ inoculum. Collect the bacterial culture and centrifuge it. Discard the supernatant. Repeat the process. Resuspend the cells in D-sorbitol solution and aliquot into 100 μL / tube.
[0027] S3-2. Mix the linearized recombinant plasmid pPIC9K-(Col17a)n fragment with competent Pichia pastoris cells P. pastoris GS115. After mixing, quickly transfer the mixture to an electroporation cuvette for electroporation to allow the recombinant plasmid fragment to enter the competent P. pastoris GS115 cells.
[0028] S3-3. Spread the transformed competent cells P. pastoris GS115 on a MD plate and invert it in a constant temperature incubator for culture until a single colony appears on the plate. Pick a single colony, culture it, extract the genome, perform PCR verification, and then sequence to verify whether the transformation is successful.
[0029] S3-4. The recombinant bacteria verified to be correct by sequencing were transfected onto YPD plates containing 500 μg / ml to 4 mg / ml of G418 to screen for high-copy recombinant strains. The recombinant bacteria that could grow on the high-concentration G418 plates were selected for activation and then maintained.
[0030] S3-5, transfer the activated recombinant bacteria in S3-4 to new YPD liquid medium and culture overnight;
[0031] S3-6. Transfer the overnight activated bacterial solution to 5 mL of BMGY liquid medium at a 1% inoculum volume, culture, and collect the cells by centrifugation. Then, suspend the collected cells in 50 mL of BMMY liquid medium and ferment them. Add methanol to a final concentration of 0.5-1% to the culture medium every 24 hours to induce expression.
[0032] S3-7. After 96 hours of induction, the culture medium was centrifuged and the supernatants at 24 hours, 48 hours, 72 hours and 96 hours of induction were collected for SDS-PAGE protein electrophoresis to verify the expression of highly bioactive recombinant human type XVII collagen.
[0033] Furthermore, in S3-1, the GS115 bacterial liquid was activated by streaking on a YPD plate and cultured in a 30°C incubator until a single colony grew. A single colony was picked and inoculated into 5 mL of YPD liquid culture medium and cultured at 30°C and 220 rpm for 18 h.
[0034] Furthermore, in the S3-1, the seed liquid was inoculated into 50 mL of YPD at an inoculum size of 1‰, cultured to an OD600 of 1.3-1.5, the bacterial liquid was collected and centrifuged at 4°C and 5000 rpm for 5 min, the supernatant was discarded, and the process was repeated twice. The bacteria were resuspended in 1 M / L D-sorbitol solution and aliquoted into small portions at 100 μL / tube.
[0035] Furthermore, 1 μg of the linearized plasmid pPIC9K-(Col17a)n fragment in S3-2 was mixed with 100 μL of yeast competent GS115 in S3-1, and the mixture was quickly transferred to a 0.2 cm pre-cooled electroporation cuvette and placed on ice for 5 minutes.
[0036] Furthermore, the electric shock conversion parameters in S3-2 are as follows: electric shock voltage 2kV, capacitance 25μF, resistance 200Ω, and electric shock time 5msec.
[0037] Furthermore, after the electric shock in S3-2 is completed, pre-cooled sorbitol solution is immediately added to the electroporation cup, gently blown to mix, and then quickly transferred to a centrifuge tube, and placed in a 30°C constant temperature incubator for static culture.
[0038] Furthermore, immediately after the electric shock in S3-2 is completed, 600-700 μL of pre-cooled 1 M sorbitol solution is added to the electroporation cup, gently pipetted to mix, and then quickly transferred to a 1.5 mL centrifuge tube and placed in a 30° C. constant temperature incubator for 1-2 hours.
[0039] Furthermore, in S3-3, the transformed competent cells P. pastoris GS115 were spread on MD plates and then inverted in a 30° C. constant temperature incubator for 3-4 days.
[0040] Furthermore, the activated recombinant bacteria in S3-5 were cultured in YPD liquid culture medium at 30° C. and 220 rpm overnight for activation.
[0041] Furthermore, the activated bacterial solution in S3-6 was cultured in 5 mL of BMGY liquid culture medium at 30° C. and 220 rpm for 24 h, and the bacterial cells were collected by centrifugation at 4° C. and 5000 rpm for 10 min.
[0042] Furthermore, in the S3-6, 50 mL of BMMY liquid culture medium was used to suspend the bacteria collected by centrifugation and fermented at 30° C. and 220 rpm.
[0043] Furthermore, the culture medium after induced expression in S3-7 was centrifuged at 4° C. and 12,000 rpm for 10 minutes.
[0044] The second object of the present invention is to provide a recombinant human type XVII collagen with high biological activity.
[0045] The third object of the present invention is to provide a use of highly bioactive recombinant human type XVII collagen in promoting tissue regeneration and hair follicle repair and regeneration.
[0046] Compared with the prior art, the present invention has the following beneficial effects:
[0047] 1. The extracellular domain of type XVII collagen (489-1497aa) contains 15 collagen domains and 16 non-collagenous domains. These domains participate in the interaction with the extracellular matrix and are an important part in maintaining the stability of the basement membrane. The present invention designs and splices the sequence of human type XVII collagen, selects different functional domain fragments from the extracellular domain (489-1497aa) of the α1 chain of human full-length type XVII collagen, and splices them to obtain a recombinant collagen gene fragment (Col17a)n. Orthologous promoters from different methylotrophic yeasts, such as the AOX1 promoter of Pichia pastoris or the FMD promoter of Hansenula polymorpha, are introduced before the recombinant collagen. The selected (Col17a)n and promoter fragments are optimized and synthesized to construct a novel recombinant plasmid. The secreted human type XVII collagen expressed by the plasmid has better solubility, higher biological activity, and better stability, and significantly reduces the probability of protein degradation in the late fermentation period. The plasmid is suitable for promotion and application in actual industry, and solves the problem of limited source of type XVII collagen.
[0048] 2. Unlike the Escherichia coli expression system commonly used in the prior art, the present invention innovatively combines the Pichia pastoris expression system with the recombinant plasmid pPIC9K-(Col17a)n to secrete and express recombinant human type XVII collagen with high biological activity. The Pichia pastoris expression system has molecular chaperones and enzymes for post-translational modification of proteins (such as glycosylation, hydroxylation, acetylase, etc.), which is very suitable for the formation of human type XVII collagen with triple-helical collagen. It also overcomes the defects of the Escherichia coli expression system that cannot perform post-translational modification of proteins and may have endotoxin contamination and low biological activity. At the same time, when the Pichia pastoris expression system expresses recombinant proteins with natural sequences at high density fermentation, they are often degraded by the protease system in Pichia pastoris. The recombinant human type XVII collagen secreted by the recombinant plasmid pPIC9K-(Col17a)n constructed by the present invention can maintain the physical and chemical properties of the recombinant human type XVII collagen while reducing the degradation phenomenon, maintain the stability of biological functions and improve its biological activity.
[0049] 3. The present invention discloses for the first time a highly biologically active recombinant human type XVII collagen, which has an advanced triple helix structure and good solubility, and a stable molecular structure. Compared with natural human type XVII collagen, it exhibits superior cell adhesion activity, cell migration promoting activity, and biological activity in promoting tissue regeneration and hair follicle repair and regeneration. BRIEF DESCRIPTION OF THE DRAWINGS
[0050] Figure 1 Schematic diagram of the structure of the recombinant plasmid pPIC9K-(Col17a)2 constructed in the present invention;
[0051] Figure 2 This is the collagen electrophoresis result of the highly bioactive recombinant human type XVII collagen described in Example 2 of the present invention;
[0052] Figure 3 This is a graph showing the effects of recombinant human collagen XVII (Col17a) 2 and fetal bovine serum (BSA) on the relative adhesion of human hair follicle stem cells in the performance test of the present invention;
[0053] Figure 4 This is a graph showing the effects of recombinant human collagen XVII (Col17a) 2 and fetal bovine serum (BSA) on the relative adhesion of human fibroblasts in the performance test of the present invention;
[0054] Figure 5 This is a graph showing the effects of recombinant human collagen XVII (Col17a) 2 and fetal bovine serum (BSA) on the migration rate of human hair follicle stem cells in the performance test of the present invention;
[0055] Figure 6 This is a graph showing the effects of recombinant human collagen XVII (Col17a) 2 and fetal bovine serum (BSA) on the migration rate of human fibroblasts in the performance test of the present invention;
[0056] Figure 7 This is a graph showing the effects of recombinant human collagen XVII (Col17a) 2 and fetal bovine serum (BSA) on the proliferation rate of human hair follicle stem cells in the performance test of the present invention;
[0057] Figure 8 This is a graph showing the effects of recombinant human XVII collagen (Col17a) 2 and fetal bovine serum (BSA) on the proliferation rate of human fibroblasts in the performance test of the present invention. DETAILED DESCRIPTION
[0058] The present invention is further described below in conjunction with preferred embodiments. The endpoints of the ranges and any values disclosed in the present invention are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of each range, the endpoint values of each range and individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.
[0059] Unless otherwise specified, the experimental methods in the following examples are conventional methods and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions.
[0060] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0061] In the following examples, the gene fragment (Col17a) 2 and the FMD promoter fragment were fully synthesized by GenScript Biopharmaceuticals Co., Ltd.
[0062] Example 1
[0063] This example provides a method for constructing a recombinant plasmid pPIC9K-(Col17a)n that expresses highly bioactive recombinant human collagen XVII. The preparation method is as follows:
[0064] (1) The cloned collagen (Col17a) 2, FMD promoter fragment, and expression vector pPIC9K fragment were mixed at a concentration ratio of 3:4:1 by PCR technology;
[0065] (2) The cloned collagen fragment, promoter, and pPIC9K vector backbone fragment were connected using Gibson Assembly seamless ligation technology to construct the recombinant plasmid pPIC9K-(Col17a)2;
[0066] (3) The ligation mixture was incubated in a 50°C metal bath for 1 h, and then transformed into Escherichia coli DH5α competent cells by heat shock method. After overnight incubation at 37°C, positive single clones growing on plates containing sodium ampicillin and kanamycin were picked and preliminarily verified by colony PCR using verification primers Col17a-F / R;
[0067] The nucleotide sequences of the primers are as follows:
[0068] Col17a-F: atgagatttccttcaatttttactgcagt;
[0069] Col17a-R:gaattaattcgcggccgcttaaccaggtggacctggg;
[0070] pPIC9K-F: gcggccgcgaattaattcgcctta;
[0071] pPIC9K-R:gtttgcgtttagatacatttcgaataataactgttatt;
[0072] FMD-F: aatgtatctaaacgcaaactccgag;
[0073] FMD-R: aaattgaaggaaatctcatgatttgattgatgaaggc;
[0074] (4) The successfully verified single colony was inoculated into a 5 mL LB tube and cultured at 37°C for 16 h. The plasmid was extracted and sequenced to confirm that the recombinant gene was consistent with the design.
[0075] Example 2
[0076] This embodiment provides a method for preparing a recombinant genetically engineered strain of Pichia pastoris that secretes and expresses a highly bioactive recombinant human collagen XVII, comprising the following steps:
[0077] (1) Pichia pastoris GS115 bacterial suspension was streaked onto a YPD plate for activation and cultured in a 30°C incubator until a single colony grew. A single colony was picked and inoculated into 5 mL of YPD liquid medium and cultured at 30°C and 220 rpm for 18 h to prepare Pichia pastoris GS115 electroporated competent cells.
[0078] (2) Inoculate 1‰ of the GS115 competent bacterial suspension into 50 mL of YPD medium and grow to an OD600 of 1.4. Collect the bacterial suspension and centrifuge it at 4°C, 5000 rpm for 5 min. Discard the supernatant and repeat twice. Resuspend the bacteria in 1 M / L D-sorbitol solution and aliquot into 100 μL / tube.
[0079] (3) Take 1 μg of the linearized plasmid pPIC9K-(Col17a)2 fragment and mix it with 100 μL of GS115 yeast competent culture medium. After mixing, quickly transfer it to a 0.2 cm pre-cooled electroporation cuvette and place it on ice for 5 minutes;
[0080] (4) Set the electroporation parameters: electroporation voltage 2 kV, capacitance 25 μF, resistance 200 Ω, and electroporation time 5 msec. Perform electroporation in a cuvette to allow the recombinant plasmid fragment to enter the competent cells P. pastoris GS115.
[0081] (5) Immediately after the electroporation, add 650 μL of pre-cooled 1 M sorbitol solution to the electroporation cup. Gently pipette to mix the bacterial solution and quickly transfer it to a 1.5 mL centrifuge tube. Place it in a 30°C constant temperature incubator and incubate for 1.5 h.
[0082] (6) Take 100 μL of bacterial solution and spread it on the MD plate, invert it and culture it in a 30°C constant temperature incubator for 3 days until a single colony appears on the plate. Pick a single colony to culture and extract the genome for PCR verification and sequencing to verify whether the transformation is successful;
[0083] (4) The recombinant bacteria verified to be correct by sequencing were transfected onto YPD plates with a G418 concentration of 2 mg / ml for screening of high-copy recombinant strains. The recombinant bacteria that could grow on the high-concentration G418 plates were selected for activation and then maintained to obtain a recombinant genetically engineered strain of Pichia pastoris that could secrete and express highly bioactive recombinant human XVII collagen.
[0084] Example 3
[0085] This embodiment provides a method for secreting and expressing recombinant human collagen XVII with high biological activity, comprising the following steps:
[0086] (1) A single colony of a recombinant genetically engineered Pichia pastoris strain capable of expressing highly bioactive recombinant human collagen XVII was inoculated into 5 mL of YPD liquid medium and cultured overnight at 30°C and 220 rpm for activation;
[0087] (2) Transfer the overnight activated bacterial solution to 5 mL of BMGY liquid medium at a 1% inoculum volume, incubate at 30°C, 220 rpm for 24 h, and collect the bacteria by centrifugation at 4°C, 5000 rpm for 10 min;
[0088] (3) The collected bacteria were suspended in 50 mL of BMMY liquid medium and fermented at 30°C and 220 rpm. Methanol was added to the culture medium at a final concentration of 0.7% every 24 h to induce expression.
[0089] (4) After 96 h of induction, the bacterial culture was centrifuged at 4°C, 12,000 rpm for 10 min, and the supernatant was collected for SDS-PAGE protein electrophoresis to verify protein expression.
[0090] The experimental results are shown in Figure 2:M:Marker lane 1 is the supernatant of recombinant collagen (Col17a) 2 fermented for 24 hours, lane 2 is the supernatant of recombinant collagen (Col17a) 2 fermented for 48 hours, lane 3 is the supernatant of recombinant collagen (Col17a) 2 fermented for 72 hours, lane 4 is the supernatant of recombinant collagen (Col17a) 2 fermented for 96 hours. The molecular weight of recombinant collagen (Col17a) 2 protein is between 30kDa and 40kDa, which is consistent with the theoretical molecular weight of (Col17a) 2 protein of 38kDa.
[0091] Performance Testing
[0092] 1. Cell Adhesion Assay
[0093] Human hair follicle stem cells and human fibroblasts were used as experimental cells, and the ability of recombinant human collagen XVII (Col17a) 2 and BSA to promote cell adhesion was detected by centrifugation method.
[0094] The results are as follows Figure 3 and 4 As shown in the figure, it can be seen that recombinant human type XVII collagen (Col17a) 2 exhibits better cell adhesion promoting ability than BSA. In the cell adhesion ability test of human hair follicle stem cells and human fibroblasts, compared with BSA, recombinant human type XVII collagen (Col17a) 2 increased by 3.6 times and 2.5 times.
[0095] 2. Cell migration assay
[0096] Human hair follicle stem cells and human fibroblasts were used as experimental cells. The cell migration movement was determined by cell scratch assay to detect the ability of recombinant human type XVII collagen (Col17a) 2 and BSA to promote cell migration.
[0097] The results are as follows Figure 5 and 6 As shown in the figure, it can be seen that recombinant type XVII collagen (Col17a) 2 exhibits a better ability to promote cell migration than BSA. In the cell migration experiments of human hair follicle stem cells and human fibroblasts, compared with BSA, recombinant human type XVII collagen (Col17a) 2 increased by 2.9 times and 3.1 times.
[0098] 3. Cell proliferation assay
[0099] Human hair follicle stem cells and human fibroblasts were used as experimental cells, and the MTT assay was used to detect the ability of recombinant human type XVII collagen and BSA to promote cell proliferation.
[0100] The results are as follows Figure 7 and 8As shown in the figure, it can be seen that recombinant type XVII collagen exhibits a better ability to promote cell proliferation than BSA. In the cell proliferation tests of human hair follicle stem cells and human fibroblasts, compared with BSA, recombinant human type XVII collagen (Col17a)2 increased by 3.1 times and 1.8 times.
[0101] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. The terms "comprise", "include" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, an element defined by the sentence "comprises a..." does not exclude the presence of other identical elements in the process, method, article or device that includes the element.
[0102] The above are merely preferred embodiments of the present application and do not constitute any form of limitation to the present application. Any technician familiar with the present profession can make slight changes or modifications to equivalent embodiments of the technical contents disclosed above without departing from the scope of the technical solution of the present application. However, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present application without departing from the content of the technical solution of the present application are still within the scope of the technical solution of the present application.
Claims
1. A method for preparing recombinant human type XVII collagen with high biological activity, characterized in that: The following steps are involved: S1. Analyze the amino acid sequence of the human type XVII collagen α1 chain and select amino acid fragments from the non-transmembrane regions of different functional domains of the protein that are not easily degraded by endogenous or exogenous proteases. Repeatedly splice the selected fragments to generate a recombinant collagen gene fragment (Col17a)2. Introduce orthologous promoters from different methylotrophic yeasts before the recombinant collagen to optimize the synthesis of the selected (Col17a)2 promoter fragment. S2. PCR cloning was used to obtain the connecting fragments, and then the collagen fragment (Col17a) 2, the promoter fragment and the pPIC9K vector backbone fragment were connected by Gibson Assembly seamless connection technology to construct the recombinant plasmid pPIC9K-(Col17a) 2; S3. Preparation of competent Pichia pastoris GS115 cells and expression of recombinant human type XVII collagen protein using pPIC9K-(Col17a)2; In the recombinant collagen gene fragment (Col17a) 2 in S1, the amino acid sequence of Col17a is shown in SEQ ID NO.
1.
2. The method for preparing a highly bioactive recombinant human type XVII collagen according to claim 1, characterized in that: The orthologous promoter in S1 is the AOX1 promoter from Pichia pastoris or the FMD promoter from Hansenula polymorpha; the nucleotide sequence of the FMD promoter is shown in SEQ ID NO.
2.
3. The method for preparing a highly bioactive recombinant human type XVII collagen according to claim 1, characterized in that: The PCR cloning in S2 includes the following steps: S2-1. PCR cloning was performed on the expression vector pPIC9K, collagen fragment, and promoter fragment to obtain a junction fragment. The cloned collagen, promoter, and expression vector pPIC9K fragment were mixed at a concentration ratio of 3:4:
1. S2-2, using Gibson Assembly seamless ligation technology, the collagen fragment, promoter and pPIC9K vector backbone fragment obtained in S21 were connected to construct the recombinant plasmid pPIC9K-(Col17a)2; S2-3. Incubate the ligation mixture in a metal bath, then transform the ligation mixture into Escherichia coli DH5α competent cells by heat shock method. After overnight culture at 37°C, pick the positive single clones growing on plates containing sodium ampicillin and kanamycin for preliminary verification by colony PCR. The successfully verified single colony is inoculated into a 5 mL LB test tube for culture, and the plasmid is extracted and sequenced to confirm that the recombinant gene is consistent with the design.
4. The method for preparing a highly bioactive recombinant human type XVII collagen according to claim 3, characterized in that: The verification primer in S2-3 is Col17a-F / R.
5. The method for preparing a highly bioactive recombinant human type XVII collagen according to claim 1, characterized in that: The preparation of GS115 competent cells and the expression of pPIC9K-(Col17a)2 in S3 include the following steps: S3-1. Preparation of electrocompetent cells: Activate GS115 bacterial culture by streaking on a YPD plate and incubate in an incubator until a single colony grows. Pick a single colony and inoculate it into 5 mL of YPD liquid medium. Then, inoculate the seed liquid into 50 mL of YPD at a 1‰ inoculum. Collect the bacterial culture and centrifuge it. Discard the supernatant. Repeat the process. Resuspend the cells in D-sorbitol solution and aliquot into 100 μL / tube. S3-2, take the linearized recombinant plasmid pPIC9K-(Col17a)2 fragment and mix it with Pichia pastoris competent cells P. pastoris GS115, and then quickly transfer it to an electroporation cuvette for electroporation to transform the recombinant plasmid fragment into the competent cells P. pastoris GS115; S3-3. Spread the transformed competent cells P. pastoris GS115 on a MD plate and invert it in a constant temperature incubator for culture until a single colony appears on the plate. Pick a single colony, culture it, extract the genome, perform PCR verification, and then sequence to verify whether the transformation is successful. S3-4. The recombinant bacteria verified to be correct by sequencing were transfected onto YPD plates containing 500 μg / ml to 4 mg / ml of G418 to screen for high-copy recombinant strains. The recombinant bacteria that could grow on the high-concentration G418 plates were selected for activation and then maintained. S3-5, transfer the activated recombinant bacteria in S3-4 to new YPD liquid medium and culture overnight; S3-6. Transfer the overnight activated bacterial solution to 5 mL of BMGY liquid medium at a 1% inoculum volume, culture, and collect the cells by centrifugation. Then, suspend the collected cells in 50 mL of BMMY liquid medium and ferment them. Add methanol to a final concentration of 0.5-1% to the culture medium every 24 hours to induce expression. S3-7. After 96 hours of induction, the culture medium was centrifuged and the supernatants at 24 hours, 48 hours, 72 hours and 96 hours of induction were collected for SDS-PAGE protein electrophoresis to verify the expression of highly bioactive recombinant human type XVII collagen.
6. The method for preparing a highly bioactive recombinant human type XVII collagen according to claim 5, characterized in that: The electric shock conversion parameters in S3-2 are as follows: electric shock voltage 2 kV, capacitance 25 μF, resistance 200 Ω, and electric shock time 5 msec.
7. The method for preparing a highly bioactive recombinant human type XVII collagen according to claim 5, characterized in that: After the electric shock in S3-2 is completed, pre-cooled sorbitol solution is immediately added to the electroporation cup, gently pipetted to mix, and then quickly transferred to a centrifuge tube, and placed in a 30°C constant temperature incubator for static culture.
8. A recombinant human type XVII collagen with high biological activity produced by the method according to any one of claims 1 to 7.
Citation Information
Patent Citations
Human collagen 17-type polypeptide and production method and application thereof
CN110845603A
Recombinant humanized 17-type collagen polypeptide and preparation method thereof
CN116640231A
Recombinant XVII type collagen and expression strain thereof
CN116640205A
Method for rapidly screening large-molecular-weight human collagen pichia pastoris engineering bacteria and application of large-molecular-weight human collagen pichia pastoris engineering bacteria
CN116904494A