A nucleic acid composition, kit and application for detecting canine coronavirus and canine parvovirus

Abstract

The present invention relates to the field of canine parvovirus detection, and specifically relates to a nucleic acid composition, a kit and an application for detecting canine coronavirus and canine parvovirus. The kit can construct a colorimetric sensing detection kit by preparing a biotinylated aptamer and an alkylamino aptamer, using the biotinylated aptamer as a carrier for capturing the virus, and using an aptamer coupled to an iron-based metal organic framework as a detection carrier. The colorimetric sensing kit can detect CCV or CPV alone or simultaneously, with high detection sensitivity and strong specificity. In addition, the detection kit can effectively avoid interference from other similar viruses and has no cross-reactivity.

Description

Technical Field

[0001] The present invention relates to the field of canine coronavirus and canine parvovirus detection, and specifically relates to a nucleic acid composition, a kit and an application thereof for detecting canine coronavirus and canine parvovirus. Background Art

[0002] Canine coronavirus ( Caninecoronavirus Canine coronavirus (CCV) is a single-stranded positive-sense RNA virus with 6 to 7 polypeptides, 4 of which are glycopeptides. It does not contain RNA polymerase and neuraminidase. Canine coronavirus is a viral infectious disease that seriously endangers the dog breeding industry, economic animal breeding industry and wildlife protection. It can cause dogs to have varying degrees of gastroenteritis symptoms, characterized by frequent vomiting, diarrhea, depression, anorexia and other symptoms. The disease can occur all year round, but is more common in winter. Sick dogs are the main source of infection, and dogs can be transmitted through the respiratory tract, digestive tract, feces and pollutants. Once the disease occurs, it is difficult to control the infection in dogs in the same litter and room. The disease is often co-infected with canine parvovirus, rotavirus and other gastrointestinal diseases, and the mortality rate of puppies is relatively high. Canine parvovirus ( CanineParvovirus CPV (CPV) belongs to the Parvoviridae family, Parvovirus genus. CPV mainly infects dogs, especially puppies, and is highly contagious and has a high mortality rate.

[0003] Common CCV and CPV detection methods mainly include clinical symptom observation, serological testing, immunoserological testing, virus isolation, colloidal gold test paper detection, immunofluorescence test paper detection, ordinary PCR amplification, real-time fluorescence quantitative PCR detection, real-time fluorescence loop-mediated isothermal amplification detection, etc. Virus isolation and culture is the gold standard for identifying CCV and CPV. It has strong specificity, but the operation is complicated and time-consuming. It requires technicians skilled in experimental operation to culture and proliferate in professional cell culture equipment. In addition, virus isolation and hemagglutination tests are prone to false negative results in the early stage of viral infection, and the sensitivity is not high. Electron microscopes can be used to observe the morphology of ultra-micro pathogens such as viruses. This is a standard method for directly determining pathogens, but it is subject to expensive equipment and complex maintenance. It also requires observers to have experience in skilled identification. It cannot be detected in real time and is difficult to apply to on-site diagnosis, so it has certain limitations. Colloidal gold test paper detection is through colloidal gold immunochromatography. The sample antigen combines with the colloidal gold-labeled antibody to form a gold-labeled antigen-antibody complex and detect the result. This method is simple and rapid to operate, but when the virus content is low, false negatives are prone to occur, leading to doctors' missed diagnosis. Immunofluorescence experiment is a method of pathogen detection by using a fluorescence microscope to observe specific fluorescence after antibodies or antigens with labeled fluorescent molecules are specifically bound to corresponding antigens or antibodies. Although this method has high sensitivity, it also has non-specific binding, and the slices are not easy to preserve for a long time. The cost is also high, and it cannot be widely used in grassroots units. Real-time fluorescence PCR detection is to mix and amplify the Taq-man probe labeled with fluorescein with the sample antigen DNA and primers. During the amplification process, the free fluorescein is irradiated with specific light to produce fluorescence, and then the CT value is obtained. This method has accurate detection results and can detect multiple samples at the same time, but it is costly and time-consuming. Summary of the invention

[0004] In view of this, the present invention provides a nucleic acid composition, a kit and an application for detecting canine coronavirus and canine parvovirus, so as to solve one of the above-mentioned technical problems to at least a certain extent.

[0005] One of the purposes of the present invention is to provide a nucleic acid composition for detecting canine coronavirus and canine parvovirus. The nucleic acid composition comprises: a DNA molecule as described in SEQ ID NO: 1-4.

[0006] One of the purposes of the present invention is to provide a colorimetric sensor kit for detecting canine coronavirus and canine parvovirus. The kit comprises: a biotinylated DNA molecule such as SEQ ID NO: 1, a biotinylated DNA molecule such as SEQ ID NO: 3, an alkylamylated DNA molecule such as SEQ ID NO: 2, and an alkylamylated DNA molecule such as SEQ ID NO: 4.

[0007] Specifically, the alkylation is butylation.

[0008] Specifically, the kit also includes a conjugate.

[0009] Specifically, the preparation method of the conjugate comprises:

[0010] (1) 5 mg of Fe-MOF was resuspended in 4.4 mL of PBS buffer (10 mmol / L, pH 7.4) and sonicated for 5 min.

[0011] (2) Then add 250 μL of LEDC (1.0 mol / L) and 250 μL of NHS (0.4 mol / L) solution and incubate at room temperature for 1 h;

[0012] (3) Then, 100 μL of butylamino aptamer 2 (10 μmol / L) and butylamino aptamer 4 (10 μmol / L) were added and incubated at 37°C for 12 h;

[0013] (4) After the reaction, the mixture was centrifuged at 10,000 r / min for 10 min, the supernatant was removed, and the precipitate was washed three times with PBS (10 mmol / L, pH 7.4). The prepared conjugates of the iron-based metal organic framework and butylamino aptamer 2 and butylamino aptamer 4 were dispersed in 5 mL of pH 7.4 binding buffer and stored at 4°C for later use.

[0014] One of the purposes of the present invention is to provide a method for detecting canine coronavirus and canine parvovirus. The method comprises:

[0015] (1) Dilute the biotinylated DNA molecule such as SEQ ID NO: 1 or the biotinylated DNA molecule such as SEQ ID NO: 3 to 100 nmol / L with binding buffer, add 200 μL to the reaction well of the ELISA plate, and incubate for 20 min;

[0016] (2) Each well was washed three times with PBST buffer (10 mmol / PBS, 0.05% Tween-20), the solution in the well was discarded, 200 μL BSA (10 g / L) blocking solution was added, and the wells were blocked at 4°C for 2 h. The blocking solution was discarded and the wells were washed three times with PBST.

[0017] (3) Add 200 μL of the sample solution to be tested, and make blank control and positive control wells at the same time, incubate at room temperature for 20 min, discard the test solution, and wash with PBST;

[0018] (4) Add 200 μL of conjugate (0.8 mg / mL) solution, incubate at room temperature for 20 min, discard the reaction solution in the well, wash with PBST. Add 100 μL of TMB-H2O2 colorimetric solution, react at room temperature for 20 min, then add 50 μL of sulfuric acid (2 mol / L);

[0019] (5) Use an ELISA reader to measure the absorbance at 652 nm and calculate the content of the virus to be tested using the standard curve.

[0020] Specifically, the binding buffer is a pH 7.4 solution containing 1.6 g / mL NaCl, 0.04 g / mL KCl, 0.04 g / mL KH2PO4, 0.02 g / mL CaCl2, 0.23 g / mL Na2HPO4 and 0.02 g / mL MgCl2.

[0021] One of the purposes of the present invention is to provide a nucleic acid composition for use in detecting canine coronavirus and canine parvovirus. The nucleic acid composition comprises: a DNA molecule as described in SEQ ID NO: 1-4.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The aptamer for detecting canine coronavirus provided by the present invention has a high affinity with the E protein of CCV and can effectively capture and detect virions.

[0024] The aptamer for detecting canine parvovirus provided by the present invention has a high affinity with the VP2 protein of CPV and can effectively capture and detect virions.

[0025] The kit for detecting canine parvovirus provided by the present invention can construct a colorimetric sensing detection kit by preparing a biotinylated aptamer and an alkylaminated aptamer, using the biotinylated aptamer as a carrier for capturing the virus, and using an aptamer coupled to an iron-based metal organic framework as a detection carrier. The kit can detect CCV or CPV alone or simultaneously, with high detection sensitivity and strong specificity. In addition, the detection kit can effectively avoid interference from other similar viruses and has no cross-reactivity.

[0026] In addition, the kit provided by the present invention has higher detection sensitivity, specificity and accuracy than commercial ELISA kits, and the detection process is non-invasive, simple and economical, and has good application prospects in the field of canine virus detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the SDS-PAGE image of the recombinantly expressed E protein and VP2 protein.

[0028] Figure 2 This is the immunofluorescence identification image of aptamers 1~4.

[0029] Figure 3 (A) SEM image and (B) Fourier transform infrared spectrum of the conjugate.

[0030] Figure 4The sensitivity test results and linear regression equation of CCV (A) and the sensitivity test results and linear regression equation of CPV (B).

[0031] Figure 5 This is the detection specificity evaluation result of the kit provided by the present invention.

[0032] Figure 6 This is the detection cross-specificity evaluation result of the kit provided by the present invention.

[0033] Figure 7 This is the test repeatability and stability evaluation result of the kit provided by the present invention. DETAILED DESCRIPTION

[0034] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. The reagents not described separately in detail in the present invention are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0035] 1. Expression and purification of target protein

[0036] The recombinant plasmid pET28a-E containing the CDS nucleotide sequence of CCV virus E protein (GenBank: PP526172.1, 24791..25027 nt) and the recombinant plasmid pET28a-VP2 containing the CDS nucleotide sequence of CPV virus VP2 protein (GenBank: KY073269.1, 270..529 nt and 2002..2239 nt) were constructed respectively.

[0037] Using primer pair EF:GG CTCGAG atgacgttccctagggcattgac, SEQ ID NO: 5, underlined XOt I restriction site; ER: CC GGATCC tcaaacaaggagtgcttcga, SEQ ID NO: 6, underlined Bam HI restriction site. Amplify the CDS fragment of E protein with restriction site; use XOt I and BamThe E CDS fragment with restriction sites and plasmid pET-28a(+) (ZY1207, Shanghai Zeye Biotechnology Co., Ltd.) were double-digested by HI, and connected by T4 ligase. The ligation product (i.e., recombinant plasmid pET28a-E) was transferred into Escherichia coli DH5α (Cat. No. BTN12-11Y, Biolabs) competent cells and cultured in LB liquid medium with kanamycin resistance to OD600nm of 0.6. IPTG was added to induce expression for 6 hours, the culture fluid was harvested, and the E protein was purified using a Ni affinity chromatography column. After purification, the protein concentration was detected using a BCA kit.

[0038] The same method was used to construct the recombinant plasmid pET28a-VP2, and the plasmid was transformed into E. coli DH5α for induction expression to obtain the VP2 protein. The primer pair was VP2-F: GG CTCGAG atgagtgatggagcagttcaaccag, SEQ ID NO: 7, underlined XOt I restriction site; VP2-R: CC GGAT ttaatataattttctaggtgc, SEQ ID NO: 8, underlined Bam HI restriction site. Figure 1 As shown, after SDS-PAGE detection, the sizes of the obtained E protein and VP2 protein were consistent with the theoretical values.

[0039] 2. Screening of aptamers

[0040] 150 μg of E protein and 150 μg of VP2 protein were coated in a microplate at 100 μL / well and incubated at 4°C overnight. The next day, each well was washed three times with 300 μL of HEPES containing 0.05% Tween-20 (referred to as HEPEST solution). Then, 200 μL of HEPES solution containing 1% BSA was added to each well and blocked at 37°C for 2 h. After washing with HEPEST solution, 100 μL of the initial oligonucleotide library (5'-TAGGGAATTCGTCGACGGATCC-(N) 40-CTGCAGGTCGACGCATGCGCCG-3', SEQ ID NO: 11; N represents A or G or C or T, synthesized by Shanghai Shenggong Biotechnology Technology Service Co., Ltd.) for 1 hour; then washed with HEPEST solution and added with nucleic acid eluent, and acted at 80℃ for 10 minutes; phenol extraction was used to extract the nucleic acid aptamer in the eluent; finally, the extracted nucleic acid aptamer was subjected to one round of symmetric and asymmetric PCR amplification (the symmetric PCR system was: 25μL 2×MiX, 1μL upstream primer F1 (tagggaattcgtcgacggatcc, SEQ ID NO: 9), 1μL downstream primer R1 (cggcgcatgcgtcgacctgcag, SEQ ID NO:10), 3μL aptamer and 20μL deionized water. The reaction procedure was 95℃10min, 95℃20s, 65℃20s, 72℃30s, 72℃5min, for a total of 15 cycles. The asymmetric PCR system was 25μL2×MiX, 1μLF1, 0.02μLR1, 5μL aptamer and 19μL deionized water. The reaction procedure was the same as that of the symmetric PCR, but the cycle was set to 28 times). The purified aptamer was collected using the Bioteke short fragment DNA gel recovery kit. In order to avoid screening nucleic acid aptamers that non-specifically bind to the microplate and BSA, counter-screening was started from the 5th round. When coating the E protein or VP2 protein, uncoated counter-screening holes were set, and the other steps remained unchanged.

[0041] 3. Detection of binding rate between aptamer and protein

[0042] In the process of multiple rounds of screening, the primer pair F2 (BIO-tagggaattcgtcgacggatcc, SEQ ID NO: 12) and R1 were used to asymmetric PCR amplification of the nucleic acid aptamer library obtained after each round of screening, and the asymmetric PCR products were recovered by gel to obtain biotin-labeled nucleic acid aptamers. The concentration of nucleic acid aptamers in each round was adjusted to 200nmol / L with HEPEST solution. The indirect enzyme-linked aptamer method (i-ELAA) was used to determine its binding rate with G protein. The specific operation is as follows: 150 μg of E protein or VP2 protein was coated in a microplate at 100 μL / well at 4°C overnight; the next day, HEPES solution containing 1% BSA was added and incubated at 37°C for 2 hours; the plate was washed with HEPEST solution for 3 times, and each round of nucleic acid aptamers was added and incubated at 37°C for 1 hour; HRP-SA (1:6000, Beijing Borsi Technology Co., Ltd.) was added after washing with HEPEST solution for 3 times, and incubated at 37°C for 1 hour; the plate was washed with color development solution for 4 times, and color development was performed at 37°C for 10 minutes; the stop solution 2 mol / L H2SO4 was added to stop color development; and the OD450nm value of each well was read with an ELISA reader. Aptamers with an OD450nm value of more than 0.8 were selected.

[0043] 4. Determination of nucleic acid aptamer sequence and dissociation constant (Kd value)

[0044] The aptamers with OD450nm values ​​above 0.8 were subjected to one round of symmetrical PCR to obtain dsDNA (expected to be 84 bp), which was then connected to the pTOPO-TA vector (expected to be 160 bp) and transformed using the pTOPO-TASimple cloning kit (Beijing Adlai Biotechnology Co., Ltd.). The transformation product was evenly spread on LB solid medium containing ampicillin and cultured overnight at 37°C. White colonies were picked in 1 mL of LB liquid medium containing ampicillin and cultured at 37°C for 18 hours. The bacterial solution was PCR identified using universal primers for the pTOPO-TA vector and the plasmid was extracted and sequenced by Boshang Biotechnology (Shanghai) Co., Ltd. The Kd value of each aptamer was calculated according to the formula Kd=BmaXX / YX. Among them, Y represents the average OD450nm, BmaX represents the maximum OD450nm value, and X represents the aptamer concentration.

[0045] As shown in Table 1, the Kd value of Adptor1 is much smaller than that of Adptor2, which indicates that the affinity of Adptor1 to E is much higher than that of Adptor2. The Kd value of Adptor3 is much smaller than that of Adptor4, which indicates that the affinity of Adptor3 to VP2 is much higher than that of Adptor4.

[0046] Table 1 Aptamer sequences and Kd

[0047]

[0048] 5. Immunofluorescence identification of aptamers

[0049] Vero cells were subcultured in advance into cell culture dishes and cultured to keep the cells in good condition at 1.6×10 4 / 200μL Vero-81 cells were plated into a 96-well cell culture plate and cultured at 37°C, 5% CO2 for 48h; the cell nutrient solution in the 96-well plate was discarded, 100μL 37°C preheated PBS was added to wash the cells once, and the washing solution was discarded. 100 μL of CCV virus solution or CPV virus solution was added to each well, with a virus amount of 0.5 MOI, and incubated at 37°C, 5% CO2 for 1 h; the virus solution was discarded, 100 μL of PBS was added to each well to gently wash once, and then 200 μL of maintenance solution was added to each well, and incubated at 37°C, 5% CO2 for 36 h; the maintenance solution was discarded, 280 μL of PBS was added to each well to wash twice, and then ice-cold anhydrous methanol was added to fix the cells, 50 μL / well, frozen at -20°C for 10 min, the methanol was removed, and each well was gently washed once with 280 μL PBS; 100 μL of FAM-labeled aptamers Adptor1~4 were added to the test wells, 100 μL per well, and incubated at 37°C in the dark for 1 h; CCV monoclonal antibody (Cat. No. A040, Antibio) and CPV monoclonal antibody (Cat. No. NB100-62434, Novus) were set up as positive controls. Discard the liquid, add 280μL PBS to each well and wash twice; add 1:200 dilution of goat anti-mouse fluorescent antibody (AleXaFluor594) to the positive control well, incubate at 37℃ in the dark for 45min; discard the liquid, add 280μL PBS to each well and wash twice, 3min each time. At the same time, set up negative control wells: the infected cells, the aptamer without fluorescent label, the monoclonal antibody without fluorescent label and the goat anti-mouse fluorescent antibody without fluorescent label were diluted with PBS solution containing 1% BSA, and finally add 50μL of BisbenZimde 10μg / mL to each well and incubate at room temperature for 20-30min. Wash gently with 280μL / well PBS twice, 3min each time, and observe under a fluorescence microscope.

[0050] like Figure 2 The cell nuclei of the control group were intact, round or oval, while the cell nuclei of the experimental group were partially deformed and fragmented. In the fluorescence images of Adpto1~4, obvious green fluorescence appeared, indicating that Adpto1~4 can effectively detect viruses in cells.

[0051] 6. Preparation of Iron-based Metal-Organic Frameworks

[0052] The functionalized iron-based metal organic framework was synthesized by the hydrothermal method reported by Skobelev et al. First, a DMF solution containing 1.24 mM terephthalic acid and 2.45 mM FeCl3 was prepared, stirred thoroughly to completely dissolve, and the solution was transferred to a reactor lined with polytetrafluoroethylene and reacted at 110°C for 20 h. After the reaction, the reactor was naturally cooled at room temperature, the reaction solution was centrifuged, the supernatant was removed, the precipitate was washed 3 times with anhydrous ethanol, then dissolved in DMF, stirred overnight to dissolve the unreacted ligand, and washed with hot ethanol (60°C) for 3 h. After repeated washing 3 times, it was vacuum dried at 60°C overnight to obtain a light yellow-brown product, which is the iron-based metal organic framework.

[0053] 7. Aptamer coupling

[0054] (1) Preparation of biotinylated aptamers

[0055] 1) Prepare a PBS solution containing 1 μM aptamer (Adptor1 or Adptor3) and 5 μM ascorbate peroxidase (APEX2), incubate at room temperature until fully dissolved;

[0056] 2) Add 0.1mM H2O2 and 1mM biotin aniline (B&K) to the incubated solution in sequence, react at 37°C for 5 minutes, add 10mM sodium ascorbate and 5mM water-soluble vitamins (TroloX) to terminate the reaction. The obtained reaction product is ethanol precipitated and purified to obtain the biotinylated aptamer.

[0057] The obtained biotinylated aptamer was reacted with fluorescently labeled streptavidin and detected by 12% non-denaturing PAGE. The detection reaction system was 1 μL 10× PBS, 1 μL biotinylated aptamer, 5 μM FITC-Avidin and 7 μL water.

[0058] (2) Preparation of alkylamino aptamers

[0059] In a 10 mL Shrek tube, the aptamer (Adptor2 or Adptor4) (0.1 mmol), butylaminoboronic acid (0.4 mmol, PubChem CID: 88291639), MesAcr (0.005 mmol, 9-m-dimethyl-10-methylacridinium tetrafluoroborate, CAS No: 1442433-71-7, Merck), (NH4)2S2O8 (0.2 mmol, 45.6 mg), catechol (0.1 mmol), 7.5 μL trifluoroacetic acid (0.1 mmol), 0.5 mL acetonitrile and 0.5 mL H2O were added to the reaction mixture, and the mixture was reacted at room temperature under 85 W LED under nitrogen protection for 24 hours. The reaction was tracked by LCMS. After the reaction was terminated, the reaction solution was evaporated to dryness by a rotary evaporator, and the residue was purified by column chromatography to obtain the target compounds, namely, butylamino aptamer 2 (5'-NH2-(CH2)2-CGACCTGCAGTGGAAAAGGGCAGCAAAACGATCGGAAAGAGTGCAATCCGGGGATCCGATCGACGAATTCCCTA, SEQ ID NO: 13) and butylamino aptamer 4 (5'-NH2-(CH2)2-TGTGCTGGTCAGTGTGTCTAGGTGCACTAGACATCGTTTAGCCGCCATTTGGACTCTTAGGGATTTGGGCGGTT, SEQ ID NO: 14).

[0060] (3) Preparation of conjugates

[0061] 5 mg of the iron-based metal organic framework was resuspended in 4.4 mL of PBS buffer (10 mmol / L, pH 7.4), and ultrasonicated for 5 min. Then, 250 μL of EDC (1.0 mol / L) and 250 μL of NHS (0.4 mol / L) solution were added. After incubation at room temperature for 1 h, 100 μL of butylamino aptamer 2 (10 μmol / L) and butylamino aptamer 4 (10 μmol / L) were added. The mixture was incubated at 37 °C for 12 h. After the reaction was completed, the mixture was heated at 10,000 °C. The mixture was centrifuged at 400 rpm for 10 min, the supernatant was removed, and the precipitate was washed three times with PBS (10 mmol / L, pH 7.4). The prepared conjugate of the iron-based metal organic framework and butylamino aptamer 2 or butylamino aptamer 4 was dispersed in 5 mL of pH 7.4 binding buffer (8 g NaCl, 0.2 g KCl, 0.2 g KH2PO4, 0.1 g CaCl2, 1.15 g Na2HPO4 and 0.1 g MgCl2·6H2O) and stored at 4°C for later use.

[0062] The size and morphology of the conjugate were characterized by SEM. The conjugate was analyzed by FTIR using the KBr pellet method, and the scanning range of the infrared spectrum was 400~2000cm -1 .like Figure 3 As shown in Figure A, the conjugate has a microscopic octahedral shape of 500-600 nm. Figure 3 As shown in B, in the Fourier infrared spectrum, 1590, 1540, 1380, 1020, 745, 560 cm -1 It is the characteristic absorption peak of the iron-based metal framework, 1590cm -1 and 1380cm -1 is the carboxyl vibration peak, 1540 cm -1 The absorption peak at 1020 cm is attributed to the stretching vibration of C=C; -1 and 743cm -1 The absorption peak at 560 cm is attributed to the bending vibration of CH; -1 The absorption peak at is related to the vibration of Fe-O, indicating that the aptamer has been coupled to the iron-based metal framework.

[0063] 8. Detection

[0064] The biotinylated aptamer 1 or the biotinylated aptamer 3 is fixed in the ELISA plate through the biotin-streptavidin reaction. When CCV or CPV is present in the sample to be tested, the target protein in CCV or CPV specifically binds to the biotinylated aptamer 1 or the biotinylated aptamer 3, respectively. Then, the conjugate prepared in the above steps is added to promote its specific binding to the biotinylated aptamer 1 or the biotinylated aptamer 3 to form a double aptamer sandwich structure. After TMB+H2O2 is added, the conjugate catalyzes the color development of the TMB substrate, and the reaction solution is blue. When there is no CCV or CPV in the sample to be tested, the double aptamer sandwich structure cannot be formed, the conjugate is washed and removed, and the reaction solution does not develop color.

[0065] (1) Testing process

[0066] Dilute biotinylated aptamer 1 or biotinylated aptamer 3 to 100 nmol / L with binding buffer, take 200 μL and add it to the reaction well of the ELISA plate, and incubate for 20 min. Wash each well with PBST buffer (10 mmol / PBS, 0.05% Tween-20) 3 times, discard the solution in the well, add 200 μL BSA (10 g / L) blocking solution, block for 2 h at 4 °C, discard the blocking solution, and wash 3 times with PBST. Add 200 μL of the sample solution to be tested, and make blank control and positive control wells at the same time, incubate at room temperature for 20 min, discard the solution to be tested, and wash with PBST. Add 200 μL of conjugate (0.8 mg / mL) solution, incubate at room temperature for 20 min, discard the reaction solution in the well, and wash with PBST. Add 100 μL TMB-H2O2 colorimetric solution, react at room temperature for 20 min, and then add 50 μL sulfuric acid (2 mol / L). The sample solutions to be tested are 100 ng / L, 10 ng / L and 1 ng / L inactivated CCV virus solution or CPV virus solution. The color change of the solution is observed by naked eyes to qualitatively detect CCV or CPV. For quantitative detection, the absorbance at 652 nm is measured by an enzyme marker, and the content of the virus to be tested is calculated by the standard curve.

[0067] (2) Optimization of detection conditions

[0068] Single factor experiments were used to determine the concentration of biotinylated aptamer 1 (20, 50, 100, 200, 300, 400, 500 nmol / L), the mass concentration of the conjugate (0.2, 0.4, 0.8, 1.0 mg / mL), the binding time of CCV or CPV with the aptamer (10, 20, 30, 40, 60 min), and the TMB color development time (10, 20, 30, 40, 50, 60 min). The reaction system used binding buffer, and each experiment was repeated 3 times.

[0069] The optimal detection conditions were as follows: the concentration of biotinylated aptamer 1 or biotinylated aptamer 3 was 100 nmol / L, the mass concentration of the conjugate was 0.8 mg / mL, the reaction time after adding the conjugate was 20 min, and the color development reaction time was 20 min.

[0070] (3) Evaluation of detection sensitivity

[0071] The inactivated virus solution of CCV or CPV was diluted with binding buffer into standard working solutions of different mass concentrations (0, 0.01ng / mL, 0.1ng / mL, 0.5ng / mL, 1ng / mL, 2ng / mL, 5ng / mL, 25ng / mL, 50ng / mL, 100ng / mL, 500ng / mL), and the method was used for determination. The detection steps were the same as above, and the absorbance of the reaction solution at 652nm was determined by a multifunctional microplate reader. The mass concentration of inactivated CCV or CPV was used as the X-axis, and the corresponding absorbance value was used as the Y-axis. The working curve of the detection system was drawn to obtain the linear equation and correlation coefficient. The detection limit of the method was calculated based on 3σ / S, where σ was the average standard deviation of 10 blank sample detections and S was the slope. Each experiment was repeated 3 times.

[0072] As the concentration of CCV or CPV increases, the color of the reaction solution gradually turns blue and deepens, and the absorbance value gradually increases. The naked eye visual detection limit is 0.5 ng / mL. Figure 4 As shown in Figure A, the standard curve shows that CCV has a good linear relationship with absorbance (Y) in the range of 0.01-500 ng / mL mass concentration (X), and the linear regression equation is Y=0.5783+0.3925lgX, with a detection limit of 0.09 ng / mL. Figure 4 As shown in B, CPV has good linearity with absorbance (Y) in the range of 0.01~500ng / mL mass concentration (X), the linear regression equation is Y=0.405+0.3075lgX, and the detection limit is 0.11ng / mL. The results show that this method has a low detection limit and a wide linear range.

[0073] Evaluation of test specificity

[0074] Canine coronavirus ( Canine coronavirus , CCV, StrainCCV-TN449, VR-3389™, ATCC). Canine parvovirus ( Canine parvovirus , CPV, Strain C-780916, VR-953™, ATCC). Adenovirus type 2 (abbreviated as ‌CAV-2, catalog number V0011, Biowit). Canine herpes virus ( Felidher pesvirus 1 , Abbreviated as FPV-1, VR-636™, ATCC). Canine Calicivirus ( Feline calicivirus , referred to as FCV, strain F-9, VR-782™, ATCC). Canine parvovirus ( Feline parvovirusTo evaluate the specificity of this method, inactivated virus solutions of CCV, CPV, CAV-2, FPV-1, FCV and FV were prepared at a mass concentration of 50 ng / mL, respectively, and the method was used for determination. An equal volume of binding buffer was used as a blank control, and each experiment was repeated 3 times.

[0075] like Figure 5 As shown, the absorbance values ​​of the inactivated virus solutions of CAV-2, FPV-1, FCV and FV were all lower than 0.1, while the absorbance values ​​of the inactivated virus solutions of CCV and CPV were all higher than 0.85. This shows that the specificity of the detection reagent and the detection method provided by the present invention is very high and can effectively distinguish these viruses.

[0076] (4) Cross-specificity detection

[0077] Samples: CCV solution containing 30 ng / mL (CCV), CPV solution containing 30 ng / mL (CPV), a mixture of CCV containing 30 ng / mL and 30 ng / mL CPV (CCV+CPV), a mixture of CCV containing 10 ng / mL and 10 ng / mL CPV (CCV(10 ng / mL)+CPV(10 ng / mL)), a mixture of CCV containing 30 ng / mL and 30 ng / mL CAV-2 (CCV+CAV-2), a mixture of CCV containing 30 ng / mL and 30 ng / mL FPV-1 (CCV+FPV-1), a mixture of CCV containing 30 ng / mL and 30 ng / mL FCV (CCV+FCV), a mixture of CCV containing 30 ng / mL and 30 ng / mL FV (CCV+FV), a mixture of CPV containing 30 ng / mL and 30 ng / mL A mixture of FCV (CPV+FCV), a mixture containing 30 ng / mL CPV and 30 ng / mL FV (CPV+FV), a mixture containing 10 ng / mL CCV, 10 ng / mL CPV, 10 ng / mL CAV-2, 10 ng / mL FPV-1, 10 ng / mL FCV and 10 ng / mL FV (CCV / CPV / CAV-2 / FPV-1 / FCV / FV).

[0078] Detection: Dilute biotinylated aptamer 1 or biotinylated aptamer 3 to 100 nmol / L with binding buffer, take 200 μL and add it to the reaction well of the ELISA plate, and incubate for 20 min. Wash each well with PBST buffer (10 mmol / PBS, 0.05% Tween-20) 3 times, discard the solution in the well, add 200 μL BSA (10 g / L) blocking solution, block for 2 h at 4 °C, discard the blocking solution, and wash 3 times with PBST. Add 200 μL of the sample to be tested, and make blank control and positive control wells at the same time, incubate at room temperature for 20 min, discard the solution to be tested, and wash with PBST. Add 200 μL of conjugate (0.8 mg / mL) solution, incubate at room temperature for 20 min, discard the reaction solution in the well, and wash with PBST. Add 100 μL TMB-H2O2 colorimetric solution, react at room temperature for 20 min, and then add 50 μL sulfuric acid (2 mol / L). The absorbance at 652 nm was measured by an ELISA instrument, and the content of the virus to be tested was calculated by the standard curve. For the sample solution containing both CCV and CPV viruses, biotinylated aptamer 1 and biotinylated aptamer 3 were used at the same time and diluted to 100 nmol / L with binding buffer, and the subsequent steps were the same.

[0079] like Figure 6 As shown, the absorbance values ​​detected in the CCV+CPV group were significantly increased relative to those in the CCV group and the CPV group, indicating that the kit provided by the present invention can simultaneously detect samples containing CCV and CPV without interference from the two.

[0080] like Figure 6 As shown, there was no significant difference ("ns") between the CCV+CAV-2 group, the CCVFPV-1 group, the CCV+FCV group, and the CCV+FV group relative to the CCV group, indicating that CAV-2, FPV-1, FCV, and FV had no cross-reactivity to CCV. The kit provided by the present invention has a very strong specificity and can avoid the interference of CAV-2, FPV-1, FCV, and FV in the detection of CCV.

[0081] like Figure 6 As shown, there was no significant difference ("ns") between the CPV+FCV group and the CPV+FV group relative to the CPV group, indicating that FCV and FV had no cross-reactivity to CPV. The kit provided by the present invention has a very strong specificity and can avoid the interference of FCV and FV in the detection of CPV.

[0082] like Figure 6As shown, the absorbance detected by the mixture of the six inactivated viruses is not significantly different from the absorbance detected by the mixture containing 10 ng / mL CCV and 10 ng / mL CPV ("ns"), which indicates that there is no cross-reactivity between the six viruses, and the kit provided by the present invention is highly specific and can avoid the interference of CAV-2, FPV-1, FCV and FV in the detection.

[0083] (5) Repeatability and stability evaluation

[0084] In addition, the kit (biochemical aptamer and conjugate) obtained above was freeze-dried to prepare a freeze-dried product, which is convenient for transportation and can be transported at room temperature and stored at low temperature. The freeze-dried product was taken out at different 0 days, 30 days, 60 days and 90 days, and balanced at room temperature for 40 minutes. The inactivated virus solution containing 10 ng / mL CCV or CPV prepared in the binding buffer was tested according to the above steps, and the method was repeated 5 times under the same conditions. The measured absorbance was substituted into the standard curve to calculate the CCV or CPV content and relative standard deviation (RSD).

[0085] like Figure 7 As shown, the RSDs of the test kits on day 0, 30, 60 and 90 for testing CCV or CPV were all less than 2.25%. In addition, only the RSD of the test kit on day 90 for testing CCV was significantly different from that on day 0 ("*"), and the RSDs of the test kits stored at different times did not show significant differences, which indicates that the test kit provided by the present invention has excellent detection stability.

[0086] 9. Testing of actual samples

[0087] Samples: A total of 300 nasal, throat swabs and fecal samples and 200 CPV samples were collected from canine cases suspected of being infected with CCV virus in a pet hospital and stored at -40℃.

[0088] Detection: After diluting twice with binding buffer, perform the test according to the optimal detection conditions obtained above in “(1) Detection process”. Set up a positive group (containing 2 ng / mL CCV inactivated virus solution or CPV inactivated virus solution) and a blank group (binding buffer) at the same time, and perform the test using the same steps.

[0089] Method comparison: The CCV content in the samples was detected using a commercially available canine coronavirus detection ELISA kit (Cat. No.: FT-PS2673G, detection range: 0.25-8 ng / mL, Shanghai Fantai Biotechnology Co., Ltd.). The CPV content in the samples was detected using a commercially available canine parvovirus ELISA kit (Cat. No.: RQ-sw13883, Shenzhen Ruiqing).

[0090] Test result judgment: mainly judged by visual observation of the color change of the reaction solution. There are three kinds of judgment results:

[0091] Positive: The sample reaction well is blue, which is darker or similar in color to the positive control well;

[0092] Negative: The sample reaction well solution is colorless or the color is similar to the blank control;

[0093] Invalid test: Positive reaction wells without color are considered invalid tests. If the test results of this method are inconsistent with those of commercial kits, the infected cells of the sample are further isolated and identified as true positive or true negative.

[0094] The positive, false positive, negative and false negative results were counted to evaluate the detection sensitivity, specificity and accuracy of the kit provided by the present invention.

[0095] Sensitivity (%) = true positive / (true positive + false negative) × 100%

[0096] Specificity (%) = true negative / (true negative + false positive) × 100%

[0097] Accuracy (%) = (true positive + true negative) / total number of samples × 100%

[0098] The results are shown in Table 2. The kit provided by the present invention was used to detect these samples, and its detection sensitivity, specificity and accuracy were significantly higher than those of commercially available products. In addition, the detection process found that the commercially available canine coronavirus detection ELISA kit was also reactive to CPV samples, and the commercially available canine parvovirus ELISA assay kit was also reactive to CCV samples. It has cross-reactivity to CCV and CPV, and its specificity needs to be improved.

[0099] Table 2

[0100]

[0101] The above is only a preferred specific implementation of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily thought of by a person skilled in the art within the technical scope disclosed in the present invention should be included in the protection scope of the present invention.

Claims

1. Use of a nucleic acid composition in the preparation of a kit for detecting canine coronavirus and canine parvovirus, the nucleic acid composition comprising: A DNA molecule as shown in SEQ ID NO: 1-4.

2. Use of a nucleic acid composition in the preparation of a colorimetric sensing kit for detecting canine coronavirus and canine parvovirus, the nucleic acid composition comprising: Biotinylation of the DNA molecule shown in SEQ ID NO: 1, biotinylation of the DNA molecule shown in SEQ ID NO: 3, alkylation of the DNA molecule shown in SEQ ID NO: 2, and alkylation of the DNA molecule shown in SEQ ID NO:

4.

3. The use according to claim 2, wherein the alkylation is butylation.

4. The use according to claim 2, further comprising a conjugate.

5. The use according to claim 4, wherein the method for preparing the conjugate comprises: (1) Take 5 mg of the iron-based metal-organic framework and resuspend it in 4.4 mL of PBS buffer with a pH of 7.4 and a concentration of 10 mmol / L, and sonicate for 5 min. (2) Then add 250 μL of 1.0 mol / L EDC and 250 μL of 0.4 mol / L NHS solution and incubate at room temperature for 1 h; (3) Then, 100 μL of a solution containing 10 μmol / L butylamino aptamer 2 and 10 μmol / L butylamino aptamer 4 was added, and the mixture was incubated at 37° C. for 12 h; the butylamino aptamer 2 is shown in SEQ ID NO: 13, and the butylamino aptamer 4 is shown in SEQ ID NO: 14; (4) After the reaction, the mixture was centrifuged at 10,000 r / min for 10 min, the supernatant was removed, and the precipitate was washed three times with 10 mmol / L PBS, pH 7.

4. The prepared conjugates of the iron-based metal organic framework and butylamino aptamer 2 and butylamino aptamer 4 were dispersed in 5 mL of pH 7.4 binding buffer and stored at 4°C for later use.

Images