Method for creating disease-resistant grass carp based on smyd3 gene editing and application

By targeting and knocking out the smyd3 gene in grass carp using CRISPR/Cas9 technology, a new germplasm with enhanced resistance to grass carp reovirus type II (GCRV-II) infection was created, solving the problem of GCRV-II prevention and control in grass carp farming and achieving significant improvement in grass carp survival rate and reduction in virus replication.

CN119144661BActive Publication Date: 2025-12-12INST OF AQUATIC LIFE ACAD SINICA
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411391613.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-30
Publication Date
2025-12-12
Estimated Expiration
2044-09-30

AI Technical Summary

Technical Problem

The lack of effective methods for controlling grass carp reovirus type II (GCRV-II) in current technologies has resulted in huge economic losses for the grass carp farming industry.

Method used

The smyd3 gene in grass carp was knocked out using CRISPR/Cas9 technology, rendering it unable to encode or lose its original function. Cas9 protein and gRNA were then introduced into grass carp fertilized eggs via microinjection, and F0 generation chimeras with the smyd3 gene knocked out were screened out.

Benefits of technology

The smyd3 gene knockout chimera significantly enhanced the grass carp's resistance to GCRV-II, manifested by reduced hemorrhagic symptoms, increased survival rate, and significant inhibition of viral replication and enhanced expression of antiviral genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005072586900000051
    Figure BDA0005072586900000051
  • Figure HDA0005072586970000011
    Figure HDA0005072586970000011
  • Figure HDA0005072586970000012
    Figure HDA0005072586970000012
Patent Text Reader

Abstract

This invention belongs to the field of aquatic organism breeding technology, and discloses a method based on... smyd3 Methods and applications of gene editing technology for creating new grass carp germplasm resistant to grass carp hemorrhagic septicemia virus (grass carp reovirus type II GCRV-II) infection. smyd3 Gene editing was performed on wild-type grass carp, targeting specific genes, and selecting... smyd3 Gene knockout F0 generation chimeras were challenged with GCRV-II. Based on the experimental results, grass carp... smyd3 The knockout chimera has a strong ability to resist GCRV-II virus infection, providing a method for genetic improvement of antiviral infection in economic fish such as grass carp, and has important industrial application value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of aquatic organism breeding, and particularly relates to a method for creating grass carp resistant to diseases based on smyd3 gene editing technology and application. BACKGROUND

[0002] Grass carp is the highest yield of freshwater aquaculture fish in China, known as the fish that "feeds half of China", and has important contributions in improving people's dietary structure and providing protein sources. According to the China Fishery Statistical Yearbook 2024, the total yield of grass carp in China in 2023 was about 594.13 million tons, accounting for about 17.4% of the total yield of freshwater fish. However, with the expansion of the grass carp aquaculture industry and the increase in yield, viral diseases have become one of the main bottlenecks of healthy grass carp farming.

[0003] Grass carp hemorrhagic disease is a highly infectious and lethal viral disease, which has been listed as a class II animal epidemic disease by the Ministry of Agriculture and Rural Affairs of China. Its pathogen is grass carp reovirus (GCRV). GCRV is the first fish virus isolated and identified in China. It is a icosahedral spherical particle containing 11 fragments of double-stranded RNA, and is divided into GCRV-I, GCRV-II and GCRV-III types according to genomic information and biological characteristics. Among them, GCRV-II is the most widely prevalent and most harmful GCRV type in recent years, and is the most prevalent strain in China. Grass carp hemorrhagic disease frequently occurs in 1-year-old grass carp, with characteristics of acute onset, rapid transmission and high mortality, causing huge economic losses to the grass carp aquaculture industry in China every year. However, due to the unclear mechanism of GCRV-II infection, there is currently no efficient prevention and control method for GCRV-II. Therefore, using modern technology to create new germplasm of grass carp resistant to diseases will enhance the disease resistance of fish from the root, reduce economic losses, and has important application value. SUMMARY

[0004] The purpose of the present application is to provide a method for creating new germplasm of grass carp resistant to GCRV-II infection based on smyd3 gene editing technology.

[0005] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0006] The application discloses a method for creating grass carp with disease resistance, which comprises knocking out a smyd3 gene of the grass carp so that the smyd3 gene cannot encode a protein or the encoded protein no longer performs the original function. Preferably, the smyd3 gene of the grass carp is knocked out by using a CRISPR / Cas9 editing technology, a target site sequence is 5'-GCAGAATGCATACGGGTCGC-3', a Cas9 protein and a gRNA targeting the smyd3 gene are mixed and then microinjected into a fertilized egg in the I cell stage of the grass carp, and an F0 generation chimera with the smyd3 gene knocked out is screened through genotype detection.

[0007] The F0 generation chimera with the smyd3 gene knocked out constructed by the method has an effect of resisting infection of grass carp reovirus type II (GCRV-II). The F0 generation chimera with the smyd3 gene knocked out is subjected to a GCRV-II virus challenge experiment, phenotype observation and death time recording are performed, it is found that the smyd3 knockout chimera has less hemorrhagic signs and a higher survival rate compared with a wild type; expression of an anti-virus gene (ifn1, isg15, mx2) and a virus gene (VP35, VP56) in the grass carp tissue is detected, it is found that the expression level of the anti-virus gene in the smyd3 knockout chimera in vivo is significantly enhanced, and the replication level of the GCRV-II virus is significantly inhibited. Therefore, the grass carp smyd3 knockout chimera has a significantly enhanced ability of resisting GCRV-II, and is an ideal new grass carp germplasm with resistance to virus infection.

[0008] The application firstly performs gene editing operation on the smyd3 gene of the grass carp and obtains the F0 generation chimera with the knockout effect, the smyd3 knockout chimera grass carp has a stronger ability of resisting infection of grass carp reovirus type II (GCRV-II), and provides a method for genetic improvement of the grass carp with resistance to virus infection, and has important industrial application value. BRIEF DESCRIPTION OF DRAWINGS

[0009] Figure 1 A smyd3 gene knockout information map of the grass carp.

[0010] Figure 2 Hemorrhage of the smyd3 knockout chimera grass carp after GCRV-II virus infection. Wild type represents a wild type grass carp, and smyd3 KO chimera represents a smyd3 knockout chimera grass carp (the same below).

[0011] Figure 3 Survival rate of the smyd3 knockout chimera grass carp after GCRV-II virus infection.

[0012] Figure 4The expression of virus-related genes (ifn1, isg15, mx2) in the liver and intestinal tissues of the smyd3 knockout chimera grass carp after GCRV-II virus infection. UI represents uninfected GCRV-II, and GCRV-II represents the GCRV-II infection group.

[0013] Figure 5 The expression of virus genes (GCRV-II-VP35, GCRV-II-VP56) in multiple tissues of the smyd3 knockout chimera grass carp after GCRV-II virus infection. DETAILED DESCRIPTION

[0014] The present application will be further described in detail below in conjunction with specific examples, so that those skilled in the art can understand. The technical solutions described in the present application are conventional solutions in the art if not specifically stated; the reagents or materials are from commercial channels if not specifically stated.

[0015] Example 1: Creation of smyd3 gene edited grass carp germplasm

[0016] 1.1 Design of gRNA target site

[0017] According to the sequence information of grass carp smyd3, the optimal knockout site is designed and screened. The smyd3 gene sequence in this embodiment is downloaded from the NCBI database, and the sequence number is XP_051723627.1. The target site is located on the 1st exon of smyd3 gene (as shown in Figure 1 The target site sequence is: 5'-GCAGAATGCATACGGGTCGC-3'.

[0018] 1.2 In vitro synthesis and purification of gRNA

[0019] pUC19-gRNA vector (https: / / www.addgene.org / 137776 / ) was used to amplify sgRNA, primers were F: 5'-GTAATACGACTCACTATAGGCAGAATGCATACGGGTCGCGTTTTAGAGCT AGAAATAGC-3', R: 5'-AAAAGCACCGACTCGGTGCC-3', respectively. PCR system was: I5 DNA polymerase (purchased from MCLAB, item number I5HM-OEM) 20 μl, F primer (concentration was 10 μΜ) 1.6 μl, R primer (concentration was 10 μΜ) 1.6 μl, ddH2O 15.8 μl, gRNA plasmid template (concentration was 300 ng / μl) 1 μl. PCR reaction conditions were: 98 °C pre-denaturation for 5 minutes; 98 °C denaturation for 10 seconds, 60 °C annealing for 12 seconds, 72 °C extension for 15 seconds, 35 cycles; 75 °C re-extension for 5 minutes. The PCR product was subjected to 1% agarose gel electrophoresis, and after verifying the correct band size, the PCR product was purified and recovered, and the concentration of the recovered product was detected. According to the instructions of TranscriptAid T7 High Yield Transcription Kit (Thermo Scientific, USA), gRNA was transcribed in vitro, and the total system was 20 μl, and lithium chloride precipitation method was used for purification and recovery. The specific steps of gRNA purification were as follows: 1 μl of DNase I was added to the gRNA in vitro transcription system, and the residual DNA was removed by incubating in a 37 °C water bath for 15 minutes, 1 μl of 0.5 M EDTA was added, and after the reaction was terminated by incubating in a 65 °C water bath for 10 minutes, 2.5 M lithium chloride was added to make the final concentration of lithium chloride in the solution, mixed well, and the solution was precipitated at -20 °C or -80 °C for 2 hours or overnight. The precipitate was collected by centrifugation at 16000 x g for 20 minutes at 4 °C, 50 μl of 70% pre-cooled ethanol was added to wash the precipitate to remove residual salt, and the ethanol was removed by centrifugation at 13000 x g for 5 minutes at 4 °C. Natural drying, 20 μl of DEPC water was added to dissolve the precipitate. 1 μL was taken to detect the RNA concentration, and the quality of gRNA was detected by 1% agarose gel electrophoresis, and then stored at -80 °C refrigerator for later use.

[0020] 1.3 Microinjection

[0021] The embryos used for grass carp microinjection were obtained by artificial spawning and fertilization of sexually mature grass carp female and male parents. The injection system was prepared by mixing gRNA and Cas9 protein, with a final concentration of 500 ng / μl for gRNA and 400 ng / μl for Cas9. The above mixture was injected into grass carp fertilized eggs plated in a culture dish using a Picoliter Microinjector injection instrument (Warner, PL-100A, USA). The injection was preferably completed within 2 hours after the egg was fertilized. After the injection was completed, the fertilized eggs were placed in a hatching barrel with a water temperature of 23-28°C for incubation.

[0022] 1.4 Screening and identification of F0 generation of grass carp smyd3 knockout chimera

[0023] When the F0 generation of gene edited grass carp grew up to the size that tail fin identification could be performed, PCR detection was performed using the identification primers F: 5'-CTTTCATGGCATCACGCACC-3' and R: 5'-ACTACGTACGTCATGTCGCC-3'. The correct target sequence was gel recovered and purified, then T-loaded (TaKaRa, #6011) and subjected to single colony sequencing. According to the sequencing results, a grass carp smyd3 gene knockout information chart was drawn Figure 1 ), and grass carp smyd3 chimera with knockout effect was obtained.

[0024] Example 2: The smyd3 knockout chimera grass carp has significantly enhanced ability to resist GCRV-II viral infection

[0025] Wild-type grass carp and smyd3 knockout chimera grass carp with a body length of 3-4 cm were injected with 20 μl of GCRV-II virus (2.60 x 10 6 copies / mL) into the abdominal cavity, respectively, and the experimental fish were placed in a constant temperature environment of 28°C. The state of the grass carp was observed and the number of deaths was counted every day, and photographs were taken after 5 days of viral infection, as shown in Figure 2 , with red arrows pointing to the bleeding points of the grass carp. The survival of the grass carp was counted using GraphPad prism software, and the results are shown in Figure 3 .

[0026] According to the photographing results, after 5 days of GCRV-II infection of the grass carp, the bleeding signs of the wild-type grass carp were significantly more than those of the smyd3 knockout chimera grass carp Figure 2 ), and according to the death curve Figure 3 , we found that the wild-type grass carp died completely after 6 days of GCRV-II infection, while the survival rate of the smyd3 knockout chimera grass carp was still more than 75% at that time, which indicated that the smyd3 knockout chimera grass carp had significantly enhanced ability to resist GCRV-II viral infection.

[0027] Example 3 The expression of anti-virus related genes in smyd3 knockout chimeric grass carp is significantly enhanced

[0028] Wild-type grass carp and smyd3 knockout chimeric grass carp with a body length of 3-4 cm were injected with GCRV-II virus (2.60 x 10 6 copies / mL) 20 μl, respectively, and the experimental fish were placed in a constant temperature environment of 28°C. After 48 hours of viral infection, the fish were dissected, and liver and intestinal tissues were taken in 1.5 ml centrifuge tubes. RNA was extracted using the Trizol method, and then cDNA was obtained using a reverse transcription kit. Real-time fluorescent quantitative PCR was performed according to the SYBR Green qPCR mix instructions to detect the expression of grass carp anti-virus related genes (ifn1, isg15, mx2). The reference gene was β-actin. The primer sequences for fluorescent quantitative PCR are shown in Table 1. The experimental results are shown in Figure 4

[0029] The experimental results show that GCRV-II virus can significantly activate the expression of grass carp anti-virus related genes ifn1, isg15, and mx2. At the same time, the expression levels of anti-virus genes in the liver and intestinal tissues of smyd3 knockout chimeric grass carp are significantly higher than those of wild-type grass carp.

[0030] Table 1

[0031]

[0032] Example 4 The replication ability of GCRV-II virus in smyd3 knockout chimeric grass carp is significantly inhibited

[0033] Wild-type grass carp and smyd3 knockout chimeric grass carp with a body length of 3-4 cm were injected with GCRV-II virus (2.60 x 10 6 copies / mL) 20 μl, respectively, and the experimental fish were placed in a constant temperature environment of 28°C. After 48 hours of viral infection, the fish were dissected, and liver, intestine, gill, and heart tissues were taken in 1.5 ml centrifuge tubes. RNA was extracted using the Trizol method, and then cDNA was obtained using a reverse transcription kit. Real-time fluorescent quantitative PCR was performed according to the SYBR Green qPCR mix instructions to detect the expression of GCRV-II virus genes (GCRV-II-VP35, GCRV-II-VP56). The primer sequences for fluorescent quantitative PCR are shown in Table 1. The experimental results are shown in Figure 5

[0034] The experimental results show that the replication ability of GCRV-II in smyd3 knockout grass carp chimeric fish is significantly inhibited.​​

Claims

1. A reagent for constructing resistance against grass carp reovirus type II infection, characterized in that, Including Cas9 protein and targeted smyd3 The gene-specific gRNA, the target sequence of which is 5'-GCAGAATGCATACGGGTCGC-3'.

Citation Information

Patent Citations

  • Gene editing method for constructing hypoxia-resistant megalobrama amblycephala by targeting mylipb gene and application

    CN118956867A

  • Method for knocking out grass carp SMYD3 gene and application

    CN119432853A

  • Kit for breeding a TGEV infection resistant pig and use thereof

    US20240389561A1