A kit for detecting Phytophthora palmitoides root rot of durian and its application

Abstract

The present invention belongs to the field of modern agricultural technology, and specifically relates to a kit for detecting Phytophthora palmitoides, a durian root rot disease, and its application. The present invention designs primers and crRNA for the specific sequence of Phytophthora palmitoides, and develops a rapid visualization detection reagent and kit for Phytophthora palmitoides, a durian root rot disease. The reagent or kit can complete the detection of Phytophthora palmitoides, a durian root rot disease, within 30 minutes, has good specificity and no cross-reaction, and the sensitivity reaches 10 fg / μL. And there is no need to open the cover after the RPA amplification is completed to add the CRISPR / Cas12a reaction system, avoiding aerosol contamination caused by opening the cover. The present invention does not require the use of large-scale instruments and equipment, has the characteristics of short time consumption, simple operation, high sensitivity and specificity, and is suitable for rapid visualization detection of clinical samples and on-site.

Description

Technical Field

[0001] The invention belongs to the technical field of modern agriculture, and particularly relates to a kit for detecting Phytophthora palmitoides, a durian root rot disease, and an application thereof. Background Art

[0002] By Phytophthora palmi Phytophthora palmivora ) is the most serious disease in durian producing areas such as my country, Thailand, Myanmar, Vietnam and Malaysia, which restricts the vigorous development of the durian industry. The pathogen has a wide host range and can cause diseases in different parts of the durian plant. Rapid field detection of pathogens is a key means to effectively prevent the occurrence of diseases. At present, the diagnosis of palm phytophthora that causes durian root rot is mainly through symptom observation, pathogen isolation and identification, and conventional PCR-based methods. These methods are time-consuming and prone to delayed diagnosis; slow-growing pathogens may be missed; there are problems of cross-reaction and false positives. In addition, traditional technologies usually require professional operation and have high requirements for equipment and facilities, which increases cost and complexity. Therefore, it is urgent to explore and develop faster, more accurate and simpler methods for detecting palm phytophthora.

[0003] At present, the traditional method of plant disease identification includes the isolation, cultivation and morphological identification of pathogens, and the verification of pathogenicity of pathogens, and finally the classification and status of pathogens are determined in combination with classification data. Although this method is the basis of pathogen identification, it is easily affected by the operator's skills and experience, human factors and the environment, is time-consuming and cannot meet the needs of rapid detection.

[0004] The polymerase chain reaction (PCR) was proposed by Mullis in 1983. This method has rapidly promoted major advances in many scientific and diagnostic fields. The method is to repeatedly heat and cool the sample under controlled conditions and amplify DNA through heat-resistant DNA polymerase. On this basis, a series of new methods such as real-time fluorescence quantitative PCR have been formed, which play an important role in the identification and detection of pathogens due to their good specificity and operability. However, the requirement of PCR-based technology for high-precision thermal cyclers makes this powerful method unable to be widely used in field detection.

[0005] Loop-mediated Isthermal Amplification (LAMP) was developed by Notomi and his colleagues in 2000. This method relies on a DNA polymerase with high strand displacement activity and a set of two specially designed internal and two external primers for automatic cyclic strand displacement DNA synthesis, allowing rapid and accurate diagnosis of pathogens within 1 hour. It is widely used in the detection of pathogens such as bacteria, fungi, and viruses because it only requires conventional water baths and other equipment, and is simple, rapid, and sensitive to operate.

[0006] In summary, with the development of biotechnology, more and more molecular detection-related technologies have been explored, optimized and applied to the detection of pathogens, but they also have their own limitations. Traditional methods for pathogen isolation and identification are usually time-consuming and cumbersome, requiring complex culture conditions and equipment. In addition, traditional methods may be misjudged in some cases, resulting in inaccurate and unreliable results. Although PCR technology has a wide range of applications, it is highly dependent on temperature control equipment, time-consuming and professional, and difficult to apply to on-site testing. Loop-mediated isothermal amplification technology (LAMP) has high sensitivity and strong specificity, but its primer design and reagent addition are cumbersome, the operation is complex, the required temperature is high, and it is easy to cause non-specific amplification and other characteristics that affect the test results. Summary of the invention

[0007] The purpose of the first aspect of the present invention is to provide a reagent for detecting durian root rot caused by Phytophthora palmi.

[0008] The object of the second aspect of the present invention is to provide a kit for detecting Phytophthora palmitoides, a durian root rot disease.

[0009] The third aspect of the present invention aims to provide an application.

[0010] The purpose of the fourth aspect of the present invention is to provide a detection method for durian root rot palm phytophthora based on RPA combined with CRISPR / Cas12a.

[0011] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0012] The first aspect of the present invention provides a reagent for detecting Phytophthora palmitoides, which is a durian root rot disease. The reagent includes a primer pair for detecting the genome of Phytophthora palmitoides, which is a durian root rot disease, and / or a crRNA for detecting Phytophthora palmitoides, which is a durian root rot disease.

[0013] The primer pair is RPA-F / RPA-R, and the nucleotide sequence is as follows:

[0014] RPA-F: 5'-CCAGAGGGTACAAACGAAATCGGCGCTACG-3';

[0015] RPA-R: 5'-CCTACCGGTATGCCTCGTGATCATTGG-3';

[0016] The crRNA includes crRNA1 and crRNA2, and the nucleotide sequences are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.

[0017] In the first aspect of the present invention, the primer pair is designed based on the palmitophytic phthora specific sequence >NCKW01006925.

[0018] The second aspect of the present invention provides a kit for detecting Phytophthora palmitoides causing durian root rot, comprising the reagent described in the first aspect of the present invention.

[0019] In some embodiments of the present invention, the kit further comprises a ssDNA fluorescent probe and a Cas protein.

[0020] In some embodiments of the present invention, the Cas protein is selected from at least one of Mb4Cas12a, FnCas12a, LbCas12a or dLbCas12a.

[0021] In some embodiments of the present invention, both ends of the ssDNA fluorescent probe are modified with a fluorescent group and a quenching group, respectively.

[0022] In some embodiments of the present invention, the fluorescent group is selected from any one of FAM, CY5, HTX, ROX, VIC, TAMRA and HEX.

[0023] In some embodiments of the present invention, the quencher group is selected from any one of BHQ1, BHQ2 and BHQ3.

[0024] In some embodiments of the present invention, the kit also includes an RPA reaction solution and a CRISPR / Cas12a buffer.

[0025] In some embodiments of the present invention, the CRISPR / Cas12a buffer is 10 × NEBuffer TM r2.1.

[0026] In some embodiments of the present invention, the kit further comprises a positive control and a negative control.

[0027] The third aspect of the present invention provides the use of the reagent described in the first aspect of the present invention and / or the kit described in the second aspect of the present invention in any one of 1) to 2):

[0028] 1) Detection of Phytophthora palmatum, a durian root rot disease;

[0029] 2) Preparation of products for detecting Phytophthora palmitoides root rot in durian.

[0030] The fourth aspect of the present invention provides a method for detecting Phytophthora palmitoides, a durian root rot disease, based on RPA combined with CRISPR / Cas12a, comprising the steps of using the reagent of the first aspect of the present invention and / or the kit of the second aspect of the present invention.

[0031] In some embodiments of the present invention, the detection method specifically comprises the following steps:

[0032] (1) Extracting nucleic acid from the sample to be tested;

[0033] (2) mixing the primer pair with the nucleic acid in step (1) and performing RPA amplification to obtain an RPA amplification product;

[0034] (3) Mixing the RPA amplification product described in step (2) with crRNA, Cas protein, and ssDNA fluorescent probe, performing a CRISPR reaction, and reading the detection signal;

[0035] (4) Determine whether the sample to be tested contains Phytophthora palmitoides, a durian root rot pathogen, based on the detection signal.

[0036] In some embodiments of the present invention, the RPA amplification conditions are 37-42° C. and the reaction time is 5-30 minutes.

[0037] In some embodiments of the present invention, the concentrations of crRNA and Cas12a are both 200 to 1000 nM.

[0038] In some embodiments of the present invention, the concentration of the ssDNA fluorescent probe is 1 to 100 μM.

[0039] In some embodiments of the present invention, the molar ratio of crRNA1 to crRNA2 is (1-3): (1-3).

[0040] In the implementation of this invention, the detection method steps are as follows:

[0041] (1) The RPA reaction system and the genomic DNA of the sample to be tested are mixed and placed at the bottom of the reaction tube, the CRISPR / Cas12a reaction system is mixed and placed in the reaction tube cover, and then the tube bottom is placed in a constant temperature amplification device for RPA amplification of the target fragment; the target fragment includes the nucleotide sequence shown in SEQ ID NO: 1.

[0042] (2) After the RPA amplification is completed, the CRISPR / Cas12a system in the reaction tube cover is added to the reaction tube and mixed.

[0043] (3) Visually detect the fluorescence intensity of the reaction solution in step (2).

[0044] If the reaction tube emits fluorescence, it indicates that Phytophthora palmitoides, a durian root rot disease, is present in the sample to be tested; if no fluorescence is emitted in the reaction tube, it indicates that Phytophthora palmitoides, a durian root rot disease, is not present in the sample to be tested.

[0045] In the implementation process of the present invention, the fluorescence intensity of the reaction tube in the visual detection (2) includes:

[0046] Place the reaction tube in a 38°C thermostat for RPA reaction for 15 minutes, then centrifuge the CRISPR / Cas12a reaction solution on the tube cap to the bottom of the tube and continue the reaction for 20 minutes, collecting FAM fluorescence every 30 seconds during the reaction; or after reacting in a 38°C thermostat for 20 minutes, observe the reaction tube with the naked eye to see if there is fluorescence under blue light.

[0047] The present invention develops a rapid visual detection reagent and kit for Phytophthora palmitoides, which has the following beneficial effects:

[0048] (1) This invention systematically compares and screens the whole genome sequences of pathogenic oomycetes such as Phytophthora palmi, Phytophthora sojae, Phytophthora infestans, and pathogenic fungi such as Rice blast fungus and Fusarium graminearum to obtain the specific sequence of Phytophthora palmi, which is the cause of durian root rot> NCKW01006925. This sequence is still in the region of unknown function and has not been used in detection technology and related literature so far. The discovery of this sequence realizes the specific detection of Phytophthora palmi for durian root rot.

[0049] (2) This invention uses the palm spore-specific sequence >NCKW01006925 to design and screen the crRNA of the CRISPR / Cas12a system, and designs and screens specific RPA primers based on the binding site of the crRNA to achieve RPA-specific target gene amplification and specific detection of palm spore-specific fungus.

[0050] (3) This invention innovatively uses two crRNA sequences for detection, and its detection sensitivity is one order of magnitude higher than that of a single crRNA, greatly improving the sensitivity and accuracy of detection.

[0051] (4) The reagent of the present invention is used to detect Phytophthora palmitoides, which causes durian root rot, and comprises a primer pair and crRNA. The primer pair can be used for RPA isothermal amplification technology to accurately, quickly and specifically detect Phytophthora palmitoides, which causes durian root rot; crRNA can form a complementary double strand with the specific fragment of Phytophthora palmitoides, which causes durian root rot, and will not cross-react with other oomycetes, Phytophthora and fungal sequences, thereby improving the detection specificity of Phytophthora palmitoides, which causes durian root rot.

[0052] This invention combines the RPA system with the CRISPR / Cas12a system to create a method for rapid and visual detection of palm phytophthora. Specifically, the method obtains a specific fragment of palm phytophthora for durian root rot through genome sequence alignment, and designs and screens the crRNA probe and RPA primer of the CRISPR / Cas12a system based on this fragment, thereby achieving RPA-specific amplification of the target gene. In addition, the present invention uses the CRISPR / Cas12a system to cut the reporter gene to establish a rapid detection method suitable for palm phytophthora for durian root rot. The method was optimized by RPA and CRISPR / Cas12a systems, and the sensitivity and specificity of the detection method were evaluated. The results showed that the detection of palm phytophthora for durian root rot by this method can be completed within 30 minutes, with good specificity and no cross-reaction, and the sensitivity reaches 10 fg / μL. This method is based on the trans-cutting activity of CRISPR / Cas12a and can quickly, sensitively and specifically detect specific fragments of Phytophthora palmitoides, the cause of durian root rot. It does not require expensive or large instruments and equipment and uses a simple, portable visual closed-tube detection method, which is suitable for rapid detection of on-site and field samples.

[0053] (5) This method combines the specific recognition of crRNA and target sequences with the specific amplification of RPA, which enhances the sensitivity and specificity of CRISPR / Cas12a technology detection. The detection is carried out at 38°C, which is suitable for situations where there is no PCR instrument equipment in the laboratory or on-site. At the same time, blue light can be used for irradiation and the test results can be observed by naked eyes.

[0054] In summary, the RPA-CRISPR / Cas12a fluorescence-based method for detecting Phytophthora palmitoides, the root rot of durian, has higher sensitivity than the traditional culture method, and the detection time is greatly shortened, and the detection can be completed within 30 minutes. This method is simple, fast, sensitive and highly specific. The whole process is carried out at 38°C, and the requirements for instruments and equipment are not high. It is suitable for wide application in on-site detection at customs ports and has good prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0056] Figure 1 Results for RPA reaction temperature optimization.

[0057] Figure 2 Optimize results for RPA response time.

[0058] Figure 3 Optimization results for crRNA and Cas12a concentrations.

[0059] Figure 4 Optimize the ratio of crRNA and Cas12a.

[0060] Figure 5 Results for ssDNA fluorescent probe concentration optimization.

[0061] Figure 6 Specific detection of RPA combined with CRISPR / Cas12a; A is the visualization detection result of RPA combined with CRISPR / Cas12a under two kinds of light (blue light and ultraviolet light). In the figure, 1 to 21 represent: 1 palm phytophthora, 2 bell phytophthora, 3 cowpea phytophthora, 4 tobacco phytophthora, 5 watermelon phytophthora, 6 pepper phytophthora, 7 camphor phytophthora, 8 soybean phytophthora, 9 taro phytophthora, 10 pathogenic phytophthora, 1 1 parasitic Phytophthora, 12 cryptophytophthora, 13 digging Phytophthora, 14 Phytophthora caerulea, 15 litchi peronophytophthora, 16 aphanidermatum, 17 cabbage anthracnose, 18 tofu mold, 19 Fusarium 9393, 20 citrus brown rot, 21 loquat anthracnose, N is the negative control; B is the fluorescence curve of RPA combined with CRISPR / Cas12a amplification, and the curve in the figure is the fluorescence signal detection result of palm Phytophthora of sample No. 1 in Figure A.

[0062] Figure 7It is the sensitivity detection of RPA combined with CRISPR / Cas12a (single crRNA, crRNA1); A is the visualization detection result of RPA combined with CRISPR / Cas12a under two kinds of irradiation light; B is the fluorescence curve result of RPA combined with CRISPR / Cas12a amplification of crRNA1; the concentrations of DNA in each reaction tube are: 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, 1 fg / μL, N: Negative.

[0063] Figure 8 It is the sensitivity detection of RPA combined with CRISPR / Cas12a (single crRNA, crRNA2); A is the visualization detection result of RPA combined with CRISPR / Cas12a under two kinds of irradiation light; B is the fluorescence curve result of RPA combined with CRISPR / Cas12a amplification of crRNA2; the concentrations of DNA in each reaction tube are: 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, 1 fg / μL, N: Negative.

[0064] Fig. 9 Optimization results for the ratio of two crRNAs.

[0065] Fig.10 The sensitivity test of RPA combined with CRISPR / Cas12a (two crRNAs, the ratio of crRNA1 to crRNA2 is 1:3); A is the visual detection result of RPA combined with CRISPR / Cas12a under two irradiation lights; B is the fluorescence curve result of RPA combined with CRISPR / Cas12a amplification. The concentrations of DNA in each reaction tube are: 100 fg / μL, 50 fg / μL, 25 fg / μL, 10 fg / μL, N: Negative.

[0066] Fig.11 These are the test results of durian root rot samples caused by inoculation with Phytophthora palmitoides, where A is the disease result of durian roots after inoculation with Phytophthora palmitoides; B is the fluorescence curve result of RPA combined with CRISPR / Cas12a amplification; C is the visualization detection result of RPA combined with CRISPR / Cas12a under two irradiation lights; 1 to 4 represent the test results of four healthy durian root disease samples inoculated with Phytophthora palmitoides, P represents the positive control using the genomic DNA of Phytophthora palmitoides for durian root rot as a template, and N is the negative control. DETAILED DESCRIPTION

[0067] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0068] Example 1 Design of RPA-specific amplification primer pairs and crRNA guide sequences

[0069] The specific fragments in the genome of Phytophthora palmatum were obtained by whole genome comparison, and the crRNA guide sequence and RPA specific amplification primer pair were designed based on this fragment. The specific sequences used for the design of primers for Phytophthora palmatum are as follows: > NCKW01006925 (1-736bp):

[0070] GTACGAAACTGGTTACGCTATACCTAAGAGTTGCGTGGGGCTACTAGACCGTCAATCAGATCGGCCGACACTGGATTGCAGTTGAAGCCGGGATGCCATCGGGATTGCTCGCCGTGGCGAGGATAATGTACGATGAATGGATCGAGGAGCACGTCGAGGTCGCACTCACCAGCTACCATGCACCTCAGCACCCACTGCAGAAACCGCTTCCAAGCAGCTCCAAGTCGGGAACGACGTTGTTTCCGGGCGTGACAAAGTTCGCGGAGGTAGGGACTCCTGGATTGCAGAACAGAGGATATGGGGAGGAAGTGGGAAGCCTCCCATAACGCTTGCTGGTGATGATCCCGAAGAGCAGAGAAACGCCGGAAGACAGGTTCCAGAGCGCCAGAGGGTACAAACGAAATCGGCGCTACGGCGGTGGTGAGTACACGCCAGGGAGTCGCAGCATACAGTGCCCTGACGTGGGTTTCGTCAATGAGCTCCGGGGTTCCACTGTCTCGCTGACGGAGTGGAGTAACTCCGCGGAAATATCCAAAGCTTGGGTTTCGAAAAGTGGTGGAAGAGCAGATCCAGGTTCAACTCTTGGACGCAAACCCGGCGTATACTTTTGACATGCCAAGGGGAAACGTGAGTTACGGAGATCTGCGTACGAACGCTATAGCCGGGGACCCAATGATCACGAGGCATACCGGTAGGGGGGAGTCGGTCGAAAATCTGGGAAGTGAGTAGCAGATTG (SEQ ID NO:1 ， Phytophthora palmivoravar. palmivora strain sbr112.9 ).

[0071] The specific amplification primer pairs for RPA are as follows:

[0072] RPA-F: 5'-CCAGAGGGTACAAACGAAATCGGCGCTACG-3' (SEQ ID NO:2);

[0073] RPA-R: 5'-CCTACCGGTATGCCTCGTGATCATTGG-3' (SEQ ID NO:3).

[0074] The crRNA1 sequence is as follows:

[0075] 5'-UAAUUUCUACUAAGUGUAGAUGAUAUUUCCGCGGAGUUACU-3' (SEQ ID NO: 4).

[0076] The crRNA2 sequence is as follows:

[0077] 5-UAAUUUCUACUAAGUGUAGAUACAUGCCAAGGGGAAACGUG-3' (SEQ ID NO: 5).

[0078] Example 2 Establishment of a visual detection method for durian root rot Phytophthora palmatum based on RPA combined with CRISPR / Cas12a

[0079] Here are the steps:

[0080] 1) Mix the RPA reaction solution in a sterile reaction tube: add 2μL (10μM) of RPA-F, 2μL (10μM) of RPA-R, 29.4 μL Buffer A and 2.5μL Buffer B (Anpu Future Biotech, catalog number #WLBB201KIT) to a reaction tube, then add 2μL 100ng / μL genomic DNA of the sample to be tested, add sterile water to a total volume of 50μL, vortex to mix, and centrifuge the reaction solution to the bottom of the tube. Then place it in a water bath for RPA reaction. The RPA reaction procedure is: constant temperature amplification at 38℃ for 15 minutes.

[0081] 2) Prepare CRISPR / Cas12a reaction solution: take 2μL 1000nM LbCas12a enzyme (NEB, catalog number #M0653T), 1.5μL 10 × NEBufferTM r2.1, 1μL 1000nM crRNA1 (SEQ ID NO:4), 3μL 1000nMcrRNA2 (SEQ ID NO:5), 1μL 100μM ssDNA fluorescent probe, and make up the rest to 10μL with sterile water and vortex to mix.

[0082] The nucleotide sequence of the ssDNA fluorescent probe is CCACCC.

[0083] 3) Take 10 μL of the RPA reaction solution in (1) at the bottom of a reaction tube, place the CRISPR / Cas12a reaction solution in (2) on the reaction tube cover, and then place the reaction tube at 38°C for 15 minutes. After the RPA amplification is completed, transfer the CRISPR / Cas12a reaction solution in the tube cover into the reaction tube for enzyme digestion reaction. The specific CRISPR procedure is: place the reaction tube in a fluorescent quantitative PCR instrument, react at 38°C for 20 minutes, collect FAM fluorescence every 30 seconds, or react at 38°C for 20 minutes, and observe the fluorescence results of the reaction solution in the tube under blue light excitation with the naked eye.

[0084] Based on the above RPA and CRISPR / Cas12a amplification systems, the relevant reaction conditions were optimized as follows:

[0085] The palm phytophthora isolated and identified from the diseased tissue of durian was used as the object, and its genomic DNA was extracted using the CTAB method, and the DNA was used as a template for optimization.

[0086] The optimization scheme for RPA temperature is as follows: control the amplification time to 30min, the concentration of Cas12a enzyme and crRNA to 1000nM, and the probe concentration to 100μM. When these parameters remain unchanged, adjust the amplification temperature to 36, 37, 38, 39, 40, 41, and 42°C for a total of 7 gradients, and a negative control. The test results are as follows Figure 1 As shown, the most suitable amplification temperature is 38°C.

[0087] The optimization scheme for RPA time is as follows: control the amplification temperature to 38°C, the concentration of Cas12a enzyme and crRNA to 1000nM, and the probe concentration to 100μM. Under the condition that these parameters remain unchanged, adjust the amplification time to 7 gradients of 5, 10, 15, 20, 25, 30, and 35min, and a negative control. The test results are as follows Figure 2 As shown, the most suitable amplification time is 15 min.

[0088] The optimization scheme for the concentration of Cas12a enzyme and crRNA is as follows: control the amplification temperature to 38°C, the amplification time to 15min, and the probe concentration to 100μM. When these parameters remain unchanged, adjust the concentration of Cas12a enzyme and crRNA to 1000nM, 800nM, 600nM, 400nM, 200nM for a total of 5 gradients, and a negative control. The test results are as follows Figure 3 As shown, the most suitable concentration for Cas12a enzyme and crRNA amplification is 1000nM.

[0089] The optimization scheme for the ratio of Cas12a enzyme and crRNA is as follows: control the amplification temperature to 38°C, the amplification time to 15min, and the probe concentration to 100μM. Under the condition that these parameters remain unchanged, adjust the ratio of Cas12a enzyme: crRNA to 3:3, 3:2, 3:1, 1:3, 2:3 for a total of 5 gradients, and a negative control. The test results are as follows Figure 4 As shown, the most suitable ratio of Cas12a enzyme:crRNA is 2:3.

[0090] The optimization scheme for probe concentration is as follows: control the amplification temperature to 38°C, the amplification time to 15min, the Cas12a enzyme and crRNA concentration to 1000nM, and when these parameters remain unchanged, adjust the probe concentration to 5 gradients of 100μM, 50μM, 25μM, 10μM, and 1μM, and a negative control. The test results are as follows Figure 5 As shown, the most suitable probe concentration was 100 μM.

[0091] The optimization scheme for the ratio of crRNA1 and crRNA2 is as follows: control the amplification temperature to 38°C, the amplification time to 15min, and the probe concentration to 100μM. Under these parameters, adjust the ratio of crRNA1:crRNA2 to 0:3, 1:3, 2:2, 3:1, 3:0, a total of 5 gradients, and a negative control. The test results are as follows Figure 8 As shown, the most suitable ratio of crRNA1:crRNA2 is 1:3.

[0092] Example 3 RPA combined with CRISPR / Cas12a technology specificity evaluation

[0093] In order to verify the specificity of RPA combined with CRISPR / Cas12a technology in the detection of palm phytophthora in Example 2, the palm phytophthora isolated and identified from the diseased durian tissue in our laboratory was used as the experimental material, and its genomic DNA was extracted by the CTAB method. The genomic DNA of other 20 non-palm phytophthora (including fungi and phytophthora) were used as templates, including palm phytophthora, bell pythium, cowpea phytophthora, tobacco phytophthora, watermelon phytophthora, pepper phytophthora, camphor phytophthora, soybean phytophthora, taro phytophthora, infestation phytophthora, parasitic phytophthora, cryptophytophthora, digging phytophthora, phytophthora, litchi peronophyte, guava pythium, cabbage anthracnose, large tofu mold, Fusarium 9393, citrus brown rot and loquat anthracnose, sterile ddH2O was used as a negative control, and the detection system optimized in Example 2 was used for amplification to verify its specificity.

[0094] The results showed that compared with the genomic DNA of 20 other non-palm fungi, only the detection system with the addition of palm fungi DNA produced a fluorescent signal ( Figure 7 A). By visually observing the fluorescence and color in the reaction tube, it was found that, consistent with the fluorescence curve results, only the detection system with the addition of palm phytophthora DNA had specific amplification, emitting green fluorescence under blue light and pink fluorescence under ultraviolet light, while the reaction tubes with the addition of 20 other non-palm phytophthora genomic DNAs and the negative control tubes did not emit fluorescence ( Figure 7 Middle B).

[0095] The above experimental results show that the RPA combined with CRISPR / Cas12a system optimized in this study has good specificity for the detection of Phytophthora palmitoides, the cause of durian root rot.

[0096] Example 4 RPA combined with CRISPR / Cas12a technology sensitivity evaluation

[0097] The genomic DNA of Phytophthora palmi was extracted by CTAB method, and then its concentration was determined by Nanodrop micro-spectrophotometer, and then it was diluted with sterile water in a 10-fold gradient, so that the final concentration of the genomic DNA was 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, 1 fg / μL, 9 concentration gradients, and sterile water was used as a negative control. The detection conditions finally optimized in Example 2 were used for detection.

[0098] The results showed that when crRNA1 or crRNA2 was used alone, the reaction tubes with DNA concentrations ranging from 100 ng / μL to 100 fg / μL could emit strong fluorescence under blue light and ultraviolet light, and there was no fluorescence signal in the reaction tubes with concentrations below 100 fg / μL. Therefore, when crRNA1 or crRNA2 was used alone, the detection sensitivity was 100 fg / μL ( Figure 7 and Figure 8 ).

[0099] In order to further enhance the sensitivity of detection, the present invention attempts to combine two crRNAs for detection. According to the above optimization results, when crRNA1 and crRNA2 are mixed in a ratio of 1:3, the detection of fluorescent signals is best. By comparing the detection effect of a single crRNA and a combination of two crRNAs, it is found that when crRNA1 and crRNA2 are mixed in a ratio of 1:3, the reaction tube with a DNA concentration of 100 ng / μL to 10 fg / μL can emit strong fluorescence under blue light and ultraviolet light, and its detection sensitivity is 10 fg / μL ( Fig. 9 ), which is significantly better than the detection results of using any crRNA alone, and the detection sensitivity is increased by an order of magnitude ( Figure 7 and Figure 8 ). This result reveals the role of the combination of two crRNAs in improving the detection sensitivity of the CRISPR-Cas system.

[0100] Example 5 Detection of durian root rot disease samples

[0101] The mycelial blocks of Phytophthora palmitoides were inoculated into the healthy roots of the same type of durian and into the roots of four healthy durian fruits respectively. Then, the DNA of the diseased samples was extracted, and the RPA combined with CRISPR / Cas12a technology optimized in Example 2 was used to detect whether the collected samples were infected with Phytophthora palmitoides.

[0102] The results are as follows Fig.11 As shown, the palm rot fungus isolated and identified from the diseased durian tissue in our laboratory was used as the experimental material, and its DNA was extracted by the CTAB method as a template for the positive control, and a strong green fluorescence was emitted in the reaction tube; the reaction tube of the inoculated durian root disease sample emitted a fluorescence similar to that of the positive control, indicating that the RPA combined with CRISPR / Cas12a technology optimized in Example 2 can realize the rapid detection of durian root rot caused by palm rot fungus on durian.

Claims

1. A reagent for detecting durian root rot Phytophthora palmi, characterized in that, The reagents include a primer pair for detecting the genome of Phytophthora palmitoides, a durian root rot disease, and a crRNA for detecting Phytophthora palmitoides, a durian root rot disease; The primer pair is RPA-F and RPA-R, and the nucleotide sequence is as follows: RPA-F: 5'-CCAGAGGGTACAAAACGAATCGGCGCTACG-3'; RPA-R: 5'-CCTACCGGTATGCCTCGTGATCATTGG-3'; The crRNA includes crRNA1 and / or crRNA2, and the nucleotide sequences are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.

2. A kit comprising the reagent of claim 1 and a CRISPR-Cas system; The CRISPR-Cas system is CRISPR-Cas12a; The CRISPR-Cas system includes a ssDNA fluorescent probe and a Cas12a protein.

3. The kit according to claim 2, characterized in that: The Cas12a protein is selected from one of Mb4Cas12a, FnCas12a, LbCas12a or dLbCas12a.

4. The kit according to claim 2, characterized in that: The kit also includes an RPA reaction solution and a CRISPR / Cas12a buffer.

5. Use of the reagent according to claim 1 or the kit according to any one of claims 2 to 4 in any one of 1) to 2): 1) Detection of Phytophthora palmatum, a durian root rot disease; 2) Preparation of products for detecting Phytophthora palmitoides root rot in durian.

6. A method for detecting palm phytophthora of durian root rot based on RPA combined with CRISPR / Cas12a, comprising the step of amplifying the sample to be tested using the kit described in claim 2.

7. The detection method according to claim 6, comprising the following steps: 1) using the primer pair shown in SEQ ID NO: 2 and 3, performing RPA amplification on the nucleic acid molecule of the sample to be tested to obtain an RPA product; 2) mixing the RPA product in step 1) with the crRNA with a sequence as shown in SEQ ID NO: 4 and / or SEQ ID NO: 5, the ssDNA fluorescent probe described in claim 2, and the Cas12a protein to react, and reading the detection signal; 3) Determine whether the sample to be tested contains Phytophthora palmitoides, a durian root rot disease, according to the detection signal in 2).

8. The method according to claim 7, characterized in that: The RPA amplification conditions are 37-42°C for 5-30 minutes; In the step 2), the crRNA with a sequence as shown in SEQ ID NO: 4 and / or SEQ ID NO: 5 is used in the CRISPR reaction system. When the crRNA with a sequence as shown in SEQ ID NO: 4 and SEQ ID NO: 5 is used, the molar ratio of crRNA1 to crRNA2 is (1-3): (1-3); The final concentration of the crRNA and Cas12a protein is 200-1000 nM; The final concentration of the ssDNA fluorescent probe is 25-100 μM.

Images