A kit for detecting serum autoantibodies and its application

Abstract

The present invention belongs to the field of biological detection, and specifically relates to a kit for detecting serum autoantibodies and its application. The kit comprises a standard, an enzyme-labeled plate coated with a recombinant antigen protein, an enzyme-labeled secondary antibody, a color developing solution, and a reaction termination solution; the recombinant antigen protein is a recombinant HNRNPA3 antigen protein with a His tag. The kit for detecting breast cancer provided by the present invention has strong specificity and can specifically detect the content of HNRNPA3 autoantibodies. As an auxiliary diagnostic method for breast cancer with high expression of HNRNPA3 autoantibodies, it is crucial for the early screening and diagnosis of cancer.

Description

Technical Field

[0001] The invention belongs to the field of biological detection, and in particular relates to a kit for detecting serum autoantibodies and an application thereof. Background Art

[0002] In recent years, the incidence and mortality of breast cancer have shown an upward trend worldwide, becoming the main cancer for women in developing and developed countries. Early screening and diagnosis of breast cancer is the best way to reduce breast cancer mortality, so early disease prevention is crucial. Among the current breast cancer detection methods, mammography is a relatively common screening technology, but it has obvious limitations. Mammography lacks sensitivity, is not suitable for detecting primary breast cancer, and may lead to false positive results. Therefore, a more effective means of diagnosing early breast cancer is urgently needed. At present, the detection method of early breast cancer is mainly through the detection of tumor-associated antigens, such as alpha-fetoprotein CEA, antigen CA19-9, protein AFP, etc. The content of these markers increases with the growth of tumor size, so the sensitivity and specificity of tumor-associated antigens are relatively poor. Therefore, it is urgent to find a tumor marker to solve the current international problem.

[0003] Research in the 1960s confirmed that the human immune system can produce an immune response to tumors. The overexpression and abnormal mutation of tumor-related antigens cause cancer patients to produce autoimmune responses. Highly expressed autoantibodies can be detected in cancer patients to achieve early diagnosis of tumor patients. Autoantibodies are antibodies against one's own tissues, organs, and cell components. They may be produced months or years before the tumor is diagnosed and can be detected before the tumor patient has clinical symptoms. Antigens themselves are expressed at low concentrations in healthy cells. A small amount of stimulation can cause B cells to produce a large number of autoantibodies, which amplify the antigen signal to a certain extent. Therefore, the concentration of autoantibodies is much higher than that of antigens. Therefore, autoantibodies can be detected even when the expression of tumor antigens is very low. In addition, autoantibodies are stable and exist in serum for a long time, which is convenient for long-term storage and large-scale screening.

[0004] Therefore, a kit for the specific detection of autoantibodies can be used as a supplementary means for early cancer detection in medicine, achieving simple, rapid and sensitive detection of cancer. Finding tumor-specific target antigens and the autoantibodies induced by them is crucial for the application of autoantibodies in tumor detection, and is also the focus and difficulty of research in this field. Heterogeneous nuclear ribonucleoproteins (HNRNPs) are the most abundant nuclear proteins in higher eukaryotes and are also RNA-binding proteins. Heterogeneous nuclear ribonucleoproteins mainly include four subtypes: HNRNPA0, HNRNPA1, HNRNPA2B1 and HNRNPA3. HNRNPA3 is a relatively less studied member of the HNRNPs family and is an important protein. HNRNPA3, as a tumor antigen, induces the production of autoantibodies, and its involvement in the development of breast cancer has not yet been reported. The markers that have been reported so far lack research on early breast cancer or precancerous lesions. Summary of the invention

[0005] In order to overcome the shortcomings of the prior art, one of the objects of the present invention is to provide a kit for detecting serum autoantibodies, which can be used to specifically detect HNRNPA3 autoantibodies in serum as an auxiliary diagnostic method for cancers that highly express HNRNPA3 autoantibodies, and has the advantages of simple detection method and high accuracy.

[0006] A second object of the present invention is to provide an application of a kit for detecting serum autoantibodies.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] A kit for detecting serum autoantibodies comprises a standard, an enzyme-labeled plate coated with a recombinant antigen protein, an enzyme-labeled secondary antibody, a color developing solution, and a reaction termination solution; the recombinant antigen protein is a recombinant HNRNPA3 antigen protein with a His tag.

[0009] Furthermore, the standard substance is serum containing HNRNPA3 autoantibodies.

[0010] Furthermore, the coating concentration of the recombinant HNRNPA3 antigen protein is 0.5-1 μg / mL.

[0011] Furthermore, the optimal coating concentration of the recombinant HNRNPA3 antigen protein is 0.5 μg / mL.

[0012] Furthermore, the enzyme-labeled secondary antibody is a rabbit anti-human IgG antibody labeled with horseradish peroxidase.

[0013] Furthermore, the color developing solution is TMB color developing solution; and the reaction stopping solution is sulfuric acid.

[0014] The use of the above-mentioned kit for detecting serum autoantibodies in the preparation of breast cancer pre-lesion screening and diagnosis products.

[0015] Furthermore, the kit is used to detect the content of HNRNPA3 autoantibodies in serum samples.

[0016] Compared with the prior art, the beneficial effects of the present invention mainly lie in: the present invention discloses a kit for detecting serum autoantibodies and its application, which can detect serum HNRNPA3 autoantibodies of early breast cancer screened out by protein mass spectrometry technology, and the kit can specifically detect the content of HNRNPA3 autoantibodies, has strong specificity and high sensitivity, can be used for screening of early lesions of breast cancer and application in diagnostic products, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 is the amount of antibodies (IgG1, IgG2a, IgG2b, and IgG3) in the sera of normal and tumor mice;

[0018] Figure 2 It is the Western blot reaction diagram of HNRNPA3 recombinant protein;

[0019] Figure 3 It is the SDS-PAGE reaction diagram of HNRNPA3 recombinant protein;

[0020] Figure 4 The kit is used to specifically detect the content of HNRNPA3 autoantibodies;

[0021] Figure 5 The AUC of HNRNPA3 autoantibodies in the diagnosis of precancerous lesions and early breast cancer. DETAILED DESCRIPTION

[0022] The technical scheme of the present invention is further described below in conjunction with specific embodiments. However, it should be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be regarded as limiting the present invention. The specific conditions not specified in the examples are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used, unless otherwise specified, are conventional products obtained through commercial channels.

[0023] Example 1

[0024] Screening of serum HNRNPA3 autoantibodies in breast cancer mice using protein profiling technology:

[0025] (1) Establishment of mouse breast cancer model: The frozen human breast cancer MCF-7 cells were quickly dissolved in a 37°C water bath and cultured in DMEM medium containing 10% FBS, penicillin (100 U / mL) and streptomycin (100 μg / mL). The human breast cancer MCF-7 cells in the logarithmic growth phase were taken to prepare a cell suspension. Five healthy female mice of about 8 weeks old with good growth status were selected for the experimental group and 1×10 cells of the cell suspension were injected into the abdomen. 6 / mouse, the injection method is subcutaneous multiple injection, and 5 healthy female mice of about 8 weeks old in good growth condition are used as the control group. Immunization is performed once every 2 weeks for 3 consecutive times. After each immunization, the antibody titer in the mouse serum is determined by enzyme-linked immunosorbent assay. After 3 immunizations, the antibody is purified from the mouse serum using an antibody purification kit. The antibody concentration is adjusted to 1 mg / mL for standby use and stored at -20°C.

[0026] (2) Screening of target proteins using protein spectrum technology: Take the human breast cancer MCF-7 cells in the logarithmic growth phase in step (1), add lysis buffer to lyse the cell membrane, release the protein in the cells, and take the supernatant. Add the serum antibody purified in step (1) and the pretreated protein agarose beads to the supernatant, incubate overnight at 4°C, perform immunoprecipitation reaction, then centrifuge at 3000 g for 5 min at 4°C, remove the supernatant, wash the protein agarose beads 3 times with lysis buffer, and finally add SDS loading buffer as the sample for protein spectrum detection. Perform protein spectrum detection on the sample to screen the target protein that binds to the specific antibody.

[0027] The results are as follows Figure 1 The figure shows the antibody content in the serum of mice after three immunizations. It can be seen that the amount of IgG1 and IgG3 subtype antibodies in the serum of the experimental group was significantly higher than that of the control group, and the IgG1 subtype antibody content was the highest in the experimental group. We further identified the proteins bound to the IgG1 subtype antibodies using mass spectrometry analysis and screened out the antigen HNRNPA3.

[0028] The binding of serum antibodies to HNRNPA3 recombinant protein was verified by immunoblotting. Figure 2 The figure shows the Western blot reaction diagram of HNRNPA3 recombinant protein. The serum antibody binds to the HNRNPA3 recombinant protein and obvious bands appear, which verifies that the serum antibody has good specificity.

[0029] Example 2

[0030] Construction and expression of HNRNPA3 recombinant protein:

[0031] (1) Construction of recombinant plasmid: The recombinant expression protein in the present invention is recombinant human HNRNPA3 protein, the protein sequence number is P51991, and a His tag is added to the end. The molecular weight is 33 kDa. The HNRNPA3 gene was synthesized by chemical synthesis, the vector was pET28a, and the pET-HNRNPA3 recombinant plasmid was constructed, which was transformed into Escherichia coli BL21, spread on an LB plate containing kanamycin resistance, and inverted and cultured overnight at 37°C. 8 single colonies were picked and inoculated in 2mL liquid LB culture medium, shaken at 37°C overnight, and plasmid DNA was extracted using the Shanghai Biotech Plasmid Extraction Kit. The extracted plasmid DNA was then sequenced and identified. By comparing with the gene sequence published on GeneBank, the results were consistent, indicating that the pET-HNRNPA3 vector was successfully constructed.

[0032] (2) Expression of recombinant plasmids: The correctly sequenced plasmids pET28a and pET-HNRNPA3 were transferred into competent cells E. coliBL21 (DE3), and single colonies were picked and added to LB medium containing kanamycin. The culture was shaken at 37°C and 220 rpm overnight. The above bacterial solution was transferred to 25 mL fermentation medium at a ratio of 5%, and cultured until the OD600 was between 0.6 and 0.8. After cooling to 25°C, IPTG was added to a final concentration of 0.5 mM to induce protein expression for 12 h. No IPTG was added to the control group for induction. The bacterial solution was collected into a centrifuge tube, centrifuged at 12000 r / min for 10 min, and the supernatant was discarded and the precipitate was retained. The precipitate was resuspended in distilled water, and the loading buffer was added. After absorbing the bacterial solution, the supernatant and precipitate were centrifuged at 12000 r / min. SDS-PAGE gel electrophoresis was performed to observe the expression of HNRNPA3 protein.

[0033] The results of SDS-PAGE gel electrophoresis are as follows Figure 3 As shown, lane 1 corresponds to pET-HNRNPA3 and lane 2 corresponds to pET28a. The pET28a cells without the gene had no bands after induction, while the pET-HNRNPA3 cells had bands after induction, with a molecular weight of 33 kDa, which was consistent with the protein size, indicating that the recombinant protein was successfully expressed.

[0034] Test Example 1

[0035] Determination of the optimal antigen coating concentration for ELISA plates:

[0036] The optimal coating concentration of the ELISA plate was determined by indirect ELISA test using the chessboard method. The specific steps are as follows:

[0037] (1) ELISA plate coating: The HNRNPA3 recombinant protein constructed in Example 2 was diluted to different concentrations using PBS solution for coating. 100 μL of the protein was added to each reaction well and coated at 37°C for 2 h.

[0038] (2) Blocking of ELISA plate: discard the coating solution, wash three times with PBST, and block with 5% skim milk at 37°C for 2 h. Discard the blocking solution and wash three times with PBST.

[0039] (3) Sample detection by microplate reader: The 1 mg / mL mouse serum HNRNPA3 autoantibody prepared in Example 1 was diluted in a gradient ratio of 1:500, 1:1000, 1:2000, and 1:4000, and 100 μL of mouse serum with different dilution ratios was added to each row, and incubated at 37°C for 1 h. The primary antibody was discarded, and the cells were washed three times with PBST. 100 μL of horseradish peroxidase-labeled rabbit anti-human IgG antibody (1:5000) was added to each well, and the cells were incubated at 37°C for 1 h. The cells were washed five times with PBST buffer, and 100 μL of 2 mg / L TMB colorimetric solution was added to each well. The cells were developed in the dark for 5 min, and then 100 μL of 2M sulfuric acid was added to terminate the reaction. Turn on the microplate reader and read the OD 450 Numeric value.

[0040] Table 1 Determination of optimal coating concentration

[0041]

[0042] The results are shown in Table 1. Indirect ELISA assay shows that when the recombinant protein coating concentration is 0.5μg / mL-1μg / mL, the OD450 value is close to 1.0. When the recombinant protein coating concentration is 0.5μg / mL, the OD450 value is closest to 1.0, so the coating concentration of the best antigen for the ELISA plate is 0.5μg / mL.

[0043] Test Example 2

[0044] The kit specifically detects the level of autoantibody HNRNPA3:

[0045] (1) Human breast cancer MCF-7 cells were cultured in DMEM medium containing 10% FBS, penicillin (100 U / mL), and streptomycin (100 μg / mL), and MCF-10A cells were cultured in DMEM / F12 medium at 37°C and 5% CO. 2 under the conditions.

[0046] (2) Human breast cancer MCF-7 cells in the logarithmic growth phase were cultured at a rate of 5×10 5Each well was inoculated with 100 cells / well in a 96-well plate and cultured in an incubator. 2 mL of 10% FBS antibiotic-free culture medium was added to each well. When the cell density reached 60%, the human breast cancer MCF-7 cells were collected for later use.

[0047] (3) Mix 5 μL of siRNA with 120 μL of Opti-MEN serum-free medium and let stand at room temperature for 5 minutes. The siRNA sequence is:

[0048] siRNA-1:TTATGGGTCGCGGAGGGAACTT;

[0049] siRNA-2: CTCCTCCATAACTACCTCTGCTG.

[0050] (4) Dilute the transfection reagent Lipo-2000 to 1 μg / μL, take 7 μL and incubate with 120 μL Opti-MEM serum-free medium at room temperature for 5 min.

[0051] (5) After 10 minutes, slowly add the siRNA reagent prepared in step (3) to the transfection reagent prepared in step (4) to obtain a transfection mixture and incubate it at room temperature for 25 minutes.

[0052] (6) The breast cancer MCF-7 cells collected in step (2) were washed twice with preheated PBS, 1 mL of serum-free culture medium (DMEM / L15) was added to each well of the 96-well plate, and the transfection mixture obtained in step (5) was added and slowly mixed, and the cells were placed in an incubator for further 6 h. The original culture medium was discarded, and the culture medium was replaced with DMEM culture medium containing 10% FBS, penicillin (100 U / mL) and streptomycin (100 μg / mL). After culturing, the transfection efficiency was observed under an inverted fluorescence microscope to obtain transfected human breast cancer cells MCF-7-siRNA-HNRNPA3. After further culturing for 48 h, the level of autoantibody HNRNPA3 was detected.

[0053] The levels of HNRNPA3 autoantibodies in normal breast epithelial cells MCF-10A, human breast cancer cells MCF-7, and human breast cancer cells MCF-7-siRNA-HNRNPA3 were detected according to the following steps:

[0054] S1: Antigen coating: The optimal antigen coating concentration of the ELISA plate was determined to be 0.5 μg / mL by Experiment 1. Antigen coating was performed according to the optimal coating concentration, and the plate was incubated at 37°C for 1 h, and then coated overnight at 4°C.

[0055] S2: Blocking: Prepare the blocking solution in advance, pour out the coating solution, wash, add 200 μL of blocking solution to each well, and incubate at 37°C for 2 hours.

[0056] S3: Primary antibody incubation: Add the obtained normal breast epithelial cells MCF-10A, human breast cancer cells MCF-7, and human breast cancer cells MCF-7-siRNA-HNRNPA3 to the cell extraction buffer, and then centrifuge at 12000rpm for 15 min to obtain the supernatant for use. Add 100μL of the supernatant of the above cells respectively, incubate at 37°C for 1 h, HNRNPA3 autoantibodies will bind to it, and wash with PBST buffer to remove unbound antibodies and other proteins.

[0057] S4: Secondary antibody incubation: Add 100 μL horseradish peroxidase-labeled anti-human IgG antibody, incubate at 37°C for 1 h, and wash five times with PBST buffer to remove unbound secondary antibody.

[0058] S5: Color development: Add 100 μL of 2 mg / L TMB color development solution to the reaction wells and develop the color for 10 min at room temperature in the dark.

[0059] S6: Stop: Add 100 μL of 2M sulfuric acid to stop the reaction.

[0060] S7: Result determination: The OD450 value was detected by an enzyme-labeled instrument to observe the relationship between the signal strength and the HNRNPA3 autoantibody content.

[0061] The results are as follows Figure 4 As shown, the levels of HNRNPA2B1 autoantibodies in human breast cancer cells MCF-7 and healthy normal breast epithelial cells MCF-10A are significantly different. By detecting the level of HNRNPA3 autoantibodies, the purpose of detecting breast cancer can be achieved. The level of HNRNPA3 autoantibodies in healthy normal breast epithelial cells MCF-10A samples is low, while the level of HNRNPA3 autoantibodies in human breast cancer cells MCF-7 samples is significantly higher than that in normal breast epithelial cells MCF-10A. siRNA induces HNRNPA3 gene silencing, and the level of HNRNPA3 autoantibodies in the sample MCF-7-siRNA-HNRNPA3 group is significantly reduced. It shows that the above kit can specifically detect the level of HNRNPA3 autoantibodies, and the level of HNRNPA3 autoantibodies can be used as a means of detecting early breast cancer.

[0062] Test Example 3

[0063] The diagnostic value of HNRNPA3 autoantibodies in precancerous lesions and early breast cancer:

[0064] The standard was serum containing high levels of HNRNPA3 autoantibodies screened by protein spectrum technology. Serum of different dilutions was tested under the condition of optimal antigen coating concentration of 0.5 μg / mL to draw a standard curve.

[0065] For 40 samples, including 10 healthy sample serum as the control group, 15 breast cancer prelesions and 15 early breast cancer serum samples as the observation group, the HNRNPA3 autoantibody level was detected using the operating steps of Experimental Example 2, and the results obtained were plotted with the ROC curve, and the AUC value was calculated to evaluate the diagnostic value. The larger the AUC value, the higher the diagnostic value of the test.

[0066] The results are as follows Figure 5 As shown in the figure, the AUC values ​​of HNRNPA3 autoantibodies in diagnosing precancerous lesions and early breast cancer were 0.819 and 0.716, respectively. When the AUC was between 0.7 and 0.9, it indicated that the model had good classification ability, indicating that HNRNPA3 autoantibodies could specifically distinguish breast cancer from healthy controls. By detecting the level of HNRNPA3 autoantibodies in serum, the purpose of screening precancerous lesions and early breast cancer could be achieved.

[0067] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them. The basic principles and main features of the present invention have been described above with specific implementation schemes. On the basis of the present invention, some modifications or replacements may be made thereto, but these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of protection claimed by the present invention.

Claims

1. Use of a kit for detecting serum autoantibodies in the preparation of screening and diagnostic products for early breast cancer lesions, characterized in that: The kit is used to detect the content of HNRNPA3 autoantibodies in serum samples; the kit comprises a standard, an enzyme-labeled plate coated with a recombinant antigen protein, an enzyme-labeled secondary antibody, a color developing solution, and a reaction termination solution; the standard is serum containing HNRNPA3 autoantibodies; and the recombinant antigen protein is a recombinant HNRNPA3 antigen protein with a His tag.

2. The use of a kit for detecting serum autoantibodies according to claim 1 in preparing a product for screening and diagnosing early breast cancer lesions, characterized in that: The coating concentration of the recombinant HNRNPA3 antigen protein is 0.5-1 μg / mL.

3. The use of a kit for detecting serum autoantibodies according to claim 2 in preparing a product for screening and diagnosing early breast cancer lesions, characterized in that: The optimal coating concentration of the recombinant HNRNPA3 antigen protein is 0.5 μg / mL.

4. The use of a kit for detecting serum autoantibodies according to claim 1 in preparing a product for screening and diagnosing pre-breast cancer lesions, characterized in that: The enzyme-labeled secondary antibody is a rabbit anti-human IgG antibody labeled with horseradish peroxidase.

5. The use of a kit for detecting serum autoantibodies according to claim 1 in preparing a product for screening and diagnosing early breast cancer lesions, characterized in that: The color developing solution is TMB color developing solution; the reaction stopping solution is sulfuric acid.

Images