Construction method of noninvasive animal model for simulating human male hormone-type alopecia, model and application thereof

Abstract

The invention relates to a construction method of a noninvasive animal model for simulating human male hormone-type alopecia, and the model and application thereof, and the construction method comprises the following steps: 1) taking a mouse subjected to adaptive culture, and carrying out unhairing treatment; and (2) a testosterone propionate solution is administrated to the unhaired mouse meeting the requirements in an enema mode, the administration dosage of testosterone propionate is 1-10 mg / kg per time, the testosterone propionate is administrated once every 2-4 days, the administration frequency is 4-8 times, and the androgenetic alopecia mouse model is obtained. The administration mode of the testosterone propionate solution is enema administration, noninvasive operation only needs to be carried out once every three days, and invasive injury or stress stimulation caused by injection to mouse skin is avoided. The induction period is compressed from 30-42 days shown by most experiments to 7-21 days, and the stable modeling state is continuously kept in the subsequent 21-42 days, so that the abnormal degrouping conditions of animal depression, death, weight loss and the like caused by long-term injection are avoided.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a method for constructing a non-invasive animal model for simulating human androgenic alopecia, and a mouse model prepared by the method and application thereof. Background Art

[0002] Androgenic alopecia is essentially a phenomenon of hair growth cycle arrest caused by the simultaneous action of testosterone (Testosterone, T) and dihydrotestosterone (Dihydrotestosterone, DHT) on androgen receptors.

[0003] DHT is an endogenous androgenic steroid and hormone, an agonist of androgen receptors, with an affinity 2-3 times higher than testosterone, and an efficacy of inducing androgen receptor signals 3 times higher than testosterone. Literature has pointed out that in individuals with androgenic alopecia, the level of circulating testosterone is not significantly different from that of healthy individuals. Therefore, the study of the effect of dihydrotestosterone on androgen receptor agonism is an important branch of the fight against androgenic alopecia.

[0004] The 5α-reductase encoded and expressed by the human SRD5a2 gene is a specific enzyme that converts testosterone in the body to dihydrotestosterone. T itself does not cause androgenic alopecia, but the 5α-reductase present in the prostate and hair follicles can convert T into DHT. DHT causes hair follicle atrophy and subsequent irreversible hair loss, i.e. androgenic alopecia. Therefore, it is particularly important to develop drugs that inhibit the activity of the 5α-reductase target and reverse the over-activation state of the androgen receptor.

[0005] At present, most studies on androgenic alopecia use the drug-induced model of C57 mice. The specific method is: dihydrotestosterone is used to inject C57 male mice with drugs every day, with 4-5 sites, and the volume limit of a single dose at each site is 20 microliters.

[0006] However, the current model has the following problems: 1) The effectiveness of drugs that inhibit 5α-reductase cannot be verified when the model is prepared by DHT injection; 2) The drug is cumbersome to prepare due to its low solubility. DHT dry powder standard must be dissolved in a small volume of oil before dilution, and it needs to be weighed by an analytical balance, ultrasonicated, heated, and other operations to assist in dissolution; 3) Subcutaneous injections are performed at multiple points on the back and the volume is limited. The subcutaneous cavity in the triangular area of ​​the back of mice is limited, and it is difficult to inject more than 200 microliters of injection solution every day for more than 1 week. The solvent is easy to accumulate and cause damage and ulceration; overlap with the hair growth observation area affects subsequent scoring observations; 4) Therapeutic drugs are often injected subcutaneously at multiple points on the back. The injection location of the model affects the experimental administration, resulting in difficulties in site selection and absorption, and difficult experimental operations. Summary of the invention

[0007] Technical issues

[0008] In view of this, the technical problem to be solved by the present invention is how to provide a method for constructing a non-invasive animal model for simulating human androgenic alopecia, and a mouse model and application prepared by the method. The administration method of the testosterone propionate solution of the present invention is enema administration, and only one non-invasive operation is required every 3 days to avoid invasive damage or stress stimulation caused by injection to the mouse skin. The induction cycle of the present invention is compressed from 30-42 days shown in most experiments to 7 to 21 days, and a stable modeling state is maintained for the subsequent 21 to 42 days to avoid abnormal group degeneration such as depression, death, and weight loss caused by long-term injection. The present invention can also solve the problem that modeling administration and general treatment methods cannot be carried out simultaneously. It is more in line with the welfare protection of experimental animals in animal research.

[0009] Solution

[0010] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0011] In a first aspect, the present invention provides a method for constructing a non-invasive animal model for simulating human androgenic alopecia, comprising the following steps:

[0012] 1) Take the adaptively cultured mice and perform hair removal treatment;

[0013] 2) For hair loss mice that meet the requirements, testosterone propionate solution is administered by enema, the dosage of testosterone propionate is 1-10 mg / kg / time, once every 2-4 days, and the number of administrations is 4-8 times, so as to obtain an androgenic alopecia mouse model.

[0014] Furthermore, in step 2), the administration frequency of testosterone propionate is once every 3 days.

[0015] Furthermore, in step 2), the administration frequency is 5 to 7 times.

[0016] Further, in step 2), the concentration of the testosterone propionate solution is 40-70 mg / mL, optionally 40-60 mg / mL, optionally 50 mg / mL.

[0017] Further, in step 2), in the testosterone propionate solution, the testosterone propionate is testosterone propionate veterinary medicine, and optionally, the solvent is corn oil.

[0018] Furthermore, in step 1), the depilatory treatment method comprises: applying depilatory cream on the back of the mouse after shaving, leaving it on for 1 to 5 minutes, and wiping off the depilatory cream; optionally, the depilatory cream is left on for 2 to 3 minutes.

[0019] Furthermore, in step 1), mice with darker back skin color or obvious local black spots are removed after hair removal, so that the back skin color of the mice is basically uniform.

[0020] Furthermore, after the end of the drug administration, the hair growth cycle was significantly delayed during observation for 20 to 42 days, and the model was considered successful when the back observation score was continuously ≤3 points. The successful modeling required the simultaneous compliance with the requirements of two main evaluation methods: (1) compared with the wild-type group, the hair growth color score of the back observation area (blind evaluation by 5 people) showed a significant difference; (2) the grayscale analysis of the back observation area picture showed a significant difference. Auxiliary indicators include: HE staining and immunohistochemistry showed that the diameter of the hair follicle enlargement was reduced compared with the wild-type group, which was significantly different.

[0021] In a second aspect, a mouse model for preparing and screening drugs for preventing and / or treating androgenic alopecia is provided, wherein the model is constructed by the construction method described in the first aspect.

[0022] In a third aspect, there is provided an application of the construction method described in the first aspect in screening drugs for preventing and / or treating androgenic alopecia, wherein the drug is a drug targeting a 5α-reductase target or inhibiting the activity of 5α-reductase.

[0023] Beneficial Effects

[0024] (1) The testosterone propionate solution of the present invention is administered by enema, and only one non-invasive operation is required every three days, avoiding invasive damage or stress stimulation to the mouse skin caused by injection. The induction period of the present invention is compressed from 30-42 days shown in most experiments to 7 to 21 days, and a stable modeling state is maintained for the subsequent 21 to 42 days, avoiding abnormal group loss such as depression, death, weight loss, etc. caused by long-term injection.

[0025] (2) The present invention can also solve the problem that modeling and drug administration cannot be carried out simultaneously with general treatment methods, and is more in line with the welfare protection of animal research experiments.

[0026] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and implement it according to the contents of the specification, and to make the above and other purposes, technical features and advantages of the present invention easier to understand, one or more preferred embodiments are listed below and described in detail with the accompanying drawings as follows. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] One or more embodiments are exemplarily described by the pictures in the accompanying drawings, and these exemplary descriptions do not constitute limitations on the embodiments. The special word "exemplary" here means "used as an example, embodiment or illustrative". Any embodiment described as "exemplary" here is not necessarily interpreted as being superior or better than other embodiments.

[0028] Figure 1 , is the scoring standard specified according to the hair growth on the back of mice after modeling according to the methods of Examples 1 to 4 in the test examples of the present invention. The value in the circle in the upper left corner is the score corresponding to the hair growth status.

[0029] Figure 2 , are the hair growth conditions of mice on the 7th day after modeling according to the methods of Examples 1 to 4 in Test Example 1 of the present invention, wherein; A is the hair growth conditions of mice on the 7th day after modeling according to the method of Example 1; B is the hair growth conditions of mice on the 7th day after modeling according to the method of Example 2, with certain degree of skin lesions due to multi-point injections; C is the hair growth conditions of mice on the 7th day after modeling according to the method of Example 3; D is the hair growth conditions of mice on the 7th day after modeling according to the method of Example 4, with the mouse skin in a state of slight redness and inflammation; the modeling effects of Examples 1 and 3 are equivalent, and no other adverse effects occur.

[0030] Figure 3 , the hair growth arrest before the second hair growth cycle 14 days after modeling according to the methods of Examples 1 to 4 in Test Example 1 of the present invention, wherein; A is the hair growth of mice 14 days after modeling according to the method of Example 1; B is the hair growth of mice 14 days after modeling according to the method of Example 2, and the skin lesions have not recovered; C is the hair growth of mice 14 days after modeling according to the method of Example 3; D is the hair growth of mice 14 days after modeling according to the method of Example 4, and the growth rate is faster; Example 1 has significantly delayed hair growth compared with Example 3, and there are no other adverse reactions.

[0031] Figure 4 , is a graph of hair growth on the back of the model mice of Test Example 4 of the present invention one month after being given gene therapy for modifying 5α-reductase activity, wherein Group A is the treatment effect of the model mice of Example 1; Group C is the treatment effect of the model mice of Example 3. DETAILED DESCRIPTION

[0032] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Unless otherwise expressly stated, throughout the specification and claims, the term "including" or its variations such as "comprising" or "including" will be understood to include the stated elements or components, without excluding other elements or other components.

[0033] In addition, in order to better illustrate the present invention, numerous specific details are provided in the specific embodiments below. It should be understood by those skilled in the art that the present invention can also be implemented without certain specific details. In some embodiments, raw materials, elements, methods, means, etc. well known to those skilled in the art are not described in detail, so as to highlight the main purpose of the present invention.

[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0035] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0036] This study tried different concentrations of testosterone propionate to determine whether the model could be successfully established, optimized the formulation and storage methods, used different administration sites, and continuously observed the hair growth within two hair growth cycles (42 days) after model establishment. The five blind evaluations were performed as follows: (1) Acquiring back images: Continuously photographing the hair growth on the back of the model mice using the same parameters; (2) Scoring criteria: 1-6 points, with skin color (pink) as 1 point and hair growth coverage of 100% as 6 points. Each score was equally divided into 6 levels (see Figure 1 ); (3) Five-person blind evaluation: Invite more than 5 people to conduct blind evaluation. The scorers cannot obtain information about the mouse grouping and intervention conditions, and only score according to the level of back hair growth. The following conclusions were obtained by giving mice acute hepatotoxicity (heart, liver and kidney function biochemistry) simultaneously. The advantages of this patent are all verified by experiments.

[0037] In the following examples, adaptive feeding, hair removal and screening were performed before establishing the mouse model of androgenic alopecia. Some specific methods are as follows:

[0038] Arrival and adaptive feeding of model mice

[0039] Order 40-42 day old C57BL / 6J mice (purchased from Jicui Yaokang), and require a birth date card. Raise mice in a GMP laboratory with 12 hours of light and 12 hours of darkness at a constant temperature and humidity. All animal experiments comply with relevant regulations on animal experiments. The adaptive feeding time can be selected for 7-9 days, and the adaptive feeding must be completed before 49 days of age. This time node is very critical.

[0040] During the adaptive breeding period, if mice bite each other and cause serious damage to the back skin, or if there are large black spots on the back skin (caused by inconsistent hair growth cycles), these should be eliminated in time.

[0041] Hair removal and screening of mice

[0042] Hair removal operation: 2-3 days before the formal experiment (day-3 to day-2), use depilatory cream and sterile cotton balls to depilate the circled area on the back of the mouse. This process must be performed under gas anesthesia (otherwise the mouse will be stressed and the skin will be damaged and red). When applying the depilatory cream, try to apply it evenly to the roots of the mouse hair. The depilatory area is preferably 0.5cm behind the mouse's neck to about 0.5cm above the tail, so as to leave enough observation and injection area. This process needs to be gentle and mild. The depilatory cream stays on for less than 3 minutes, and then use a cotton ball to wipe the hair slightly in the direction of the hair. It can be wiped clean without water.

[0043] Screening: At the time of hair removal or within 2 days of subsequent preparation for feeding, some mice may develop black spots on their backs. According to research, under the premise of strictly selecting mice of the same age, the possibility of individuals with uneven hair development cycles on the back is still very high, but it is relatively controllable, and the distribution is controllable at around 5%-10% (referring to the percentage of gray-black pixels in the entire observation area). Before the formal modeling experiment, the mice should be observed in advance to see if they have black spots on their backs. Mice with black spots should be avoided from being included in the formal experiment to avoid interfering with formal observations and hair scoring.

[0044] The successful establishment of the mouse model was observed by the significant periodic difference in hair growth.

[0045] Grouping

[0046] 30 mice before 49 days of age after adaptive feeding were selected, and mice with skin damage and black spots were excluded. The mice were depilated and screened according to the above method, and 25 mice were shortlisted and randomly divided into groups of 5, one of which was used as a wild-type control, and the other groups were subjected to the model preparation of Examples 1 to 4.

[0047] Example 1: Preparation of a mouse model of androgenic alopecia by enema administration of testosterone propionate

[0048] Drugs used: High-purity, impurity-free testosterone propionate veterinary medicine is used as the agent, corn oil is used as the solvent, and the concentration is 50 mg / mL.

[0049] Administration method and dosage: The mice that meet the requirements after hair removal will continue to be raised, and on the second day, they will be given enema of testosterone propionate solution, with testosterone propionate 10 mg / kg body weight administered once every 3 days until the 14th day, for a total of 5 times.

[0050] After administration, the mice were observed every day in a short cycle (28 days) or a long cycle (42 days). If the hair score of the mice remained at 3-4 points on the 9th, 10th and 11th days, the model was considered to be successfully established.

[0051] Example 2: Preparation of a mouse model of androgenic alopecia by injection of testosterone propionate

[0052] Drugs used: High-purity, impurity-free testosterone propionate veterinary medicine is used as the agent, with a concentration of 50 mg / mL and corn oil as the solvent.

[0053] Dosage and dosage: The mice that meet the requirements after hair removal are kept and injected subcutaneously at 5 points on the back starting from the second day. Testosterone propionate is administered at 10 mg / kg body weight once every 3 days until the 14th day, for a total of 5 times.

[0054] After administration, the mice were observed every day in a short cycle (28 days) or a long cycle (42 days). If the hair score of the mice remained at 3-4 points on the 9th, 10th and 11th days, the model was considered to be successfully established.

[0055] Example 3: Preparation of a mouse model of androgenic alopecia by injection of dihydrotestosterone

[0056] Drugs used: Experimental androtanolone (dihydrotestosterone) was selected, and the solvent was corn oil to prepare an injection solution with a concentration of 50 mg / mL.

[0057] Dosage and dosage: The mice that meet the requirements after hair removal were kept and injected subcutaneously at 5 points on the back starting from the second day. Dihydrotestosterone was administered at 10 mg / kg body weight once every 3 days until the 14th day, for a total of 5 times.

[0058] After administration, the mice were observed every day in a short cycle (28 days) or a long cycle (42 days). If the hair score of the mice remained at 3-4 points on the 9th, 10th and 11th days, the model was considered to be successfully established.

[0059] Example 4: Preparation of a mouse model of androgenic alopecia by injection of testosterone propionate

[0060] Drugs used: High-purity, impurity-free testosterone propionate veterinary medicine is selected as the agent, with a concentration of 50 mg / mL (corn oil is used as the solvent); endotoxin (LPS, Lipopolysaccharides) is combined, and the concentration of endotoxin is 10 μg / mL (physiological saline is used to dissolve endotoxin).

[0061] Dosage and dosage: The mice that meet the requirements after hair removal are kept and injected subcutaneously at 5 points on the back starting from the second day. Testosterone propionate is administered at 10 mg / kg body weight once every 3 days until the 14th day, for a total of 5 times. Endotoxin is injected into the tail vein once a week at 50 μg / kg body weight.

[0062] The modeling mice of Examples 1 to 4 were observed every day after administration, with a short cycle (28 days) or a long cycle (42 days). If the hair score of the mice remained at 3-4 points on the 9th, 10th and 11th days, the modeling was considered successful.

[0063] The conditions of the medicinal solutions in the above-mentioned Examples 1 to 4 are shown in Table 1:

[0064] Table 1. Effects of different solution preparation schemes

[0065]

[0066]

[0067] The results in Table 1 show that injection solutions require higher precision and are relatively complicated to prepare, while solutions used for enema are relatively easy to operate.

[0068] Test Example 1: Hair growth on the back of male hair loss model mice

[0069] After 2 weeks (14 days) of continuous injection induction, the mice will experience a significant delay in the hair growth cycle.

[0070] Multiple batches of experiments have shown that the model is successful if the mouse hair score remains at 3-4 points on the 9th, 10th, and 11th days of continuous observation. After the model is formed, it remains stable in the next two hair growth cycles (about 28-35 days), and the hair growth of the modeled mice is always slow. All functional verification experiments should be performed during the known stable period of the model (i.e., 28-35 days).

[0071] It should be noted that the verification test of subcutaneous injection drugs needs to be staggered with the subcutaneous modeling injection to avoid excessive burden on the mice (if the modeling drug (such as testosterone propionate) needs to be injected on Monday or Thursday, then the candidate efficacy drug (such as dermal papilla cell drug) used to verify the efficacy should be scheduled for injection on Tuesday, Wednesday or Friday).

[0072] In the above Examples 1 to 4, Examples 2 to 3 require subcutaneous injection, and the time of subcutaneous injection should not exceed 20 days (if the modeling time is too long (greater than 20 days), the corn oil injected subcutaneously will accumulate in the back of the mouse neck and be difficult to metabolize), and skin damage caused by subcutaneous injection may occur (such as Figure 2 ), Example 1 does not require injection and has low operating risk.

[0073] Figure 2 The results show that the modeling effects of Examples 1 and 3 are comparable, and no other adverse effects occur ( Figure 2 A, 2C). In the modeling method of Example 2, a certain degree of skin lesions occurred due to multi-point injection ( Figure 2 B), if the modeling stage can only rely on subcutaneous injection, then it is insufficient as a drug validation model because it limits the administration method of the validated drug; the method of Example 4 also has a slight red inflammatory state ( Figure 2 D).

[0074] Test Example 2 Detection of Physiological Indexes of Mice During Acute Observation Period During the Induction Modeling Process

[0075] On the 7th day of administration of the mice in Examples 1 to 4, blood was collected from some groups. The biochemical indices of the mice were tested, and the blood samples were tested by chemiluminescence experiment using a fully automatic biochemical analyzer (URIT-8400). The indices mainly included liver function, kidney function, blood lipids, blood sugar and myocardial function, and the blank control was a healthy mouse. The results are shown in Table 3.

[0076] Table 3 Physiological indexes of mice during acute observation period

[0077]

[0078]

[0079]

[0080] Test Example 3: Hair growth on the back of mice after successful modeling

[0081] The mice of Examples 1 to 4 were depilated again on the 14th day after the modeling was completed, before the second hair growth cycle (about 15-16 days), and the hair growth on their backs was observed. The results were as follows: Figure 3 .

[0082] Figure 3 The results showed that the four groups of mice had different degrees of delayed hair growth, and the back skin damage of the mice in Example 2 had not yet fully recovered ( Figure 3 B), the hair growth rate of the mice in Example 4 was faster ( Figure 3 D), Example 1 ( Figure 3A) than Example 3 ( Figure 3 C) has a more obvious arrest of the hair growth cycle, indicating that the modeling effect of Example 1 administered by enema is better.

[0083] Test Example 4: 5α-reductase-based treatment of successfully modeled mice

[0084] The mice in Examples 1 to 4 were all given gene therapy for the modification of 5α-reductase activity. The specific method is as follows: (1) a small nucleotide smear preparation containing siSRD5a2 was prepared, and the required RNA sequence is shown in Table 4. (2) the above preparation was applied to the back of the mice that had been successfully modeled, and a nano-chip permeation instrument was used for transdermal treatment. (3) the hair growth on the back of the mice was observed and scored. The hair growth on the back of the mice after 1 month of administration is shown in the figure below. Figure 4 shown.

[0085] Table 4 siSRD5a2 sequence

[0086] sequence name Sequence(5'-3') siSRD5a2(1) (SEQ ID NO:1) CGUAUGUUUCUGGAGCCAAUU siSRD5a2(2) (SEQ ID NO:2) AAUUGGCUCCAGAAACAUACG

[0087] Figure 4 The results showed that the gene therapy of 5α-reductase activity modification had an effect on Example 3 ( Figure 4 The model mice of group C) could not produce effective therapeutic effects, so the mouse model of male hormonal alopecia induced by dihydrotestosterone is not suitable for verifying the efficacy of related gene therapy drugs. Figure 4 The modeled mice in Group A) recovered normal hair growth, indicating that the use of testosterone propionate / corn oil modeled mice is suitable for modeling needs related to 5α-reductase activity targets, and the model is simple to operate, has a short induction cycle, and has no toxic side effects.

[0088] The induction drug (testosterone propionate) solution of the present invention is easy to prepare and can quickly achieve stable and uniform diffusion of the drug.

[0089] The drug (testosterone propionate) and solvent preparation method selected by the present invention have better absorption effect, and do not need to be combined with other sensitizing or pyrogenic substances such as LPS to induce mice to produce a verification reaction, making the model more consistent with the pathogenic mechanism of androgenic alopecia and avoiding interference from other pathological factors.

[0090] The testosterone propionate solution of the present invention is administered by enema, which only requires one non-invasive operation every three days, thus avoiding invasive damage or stress stimulation to the mouse skin caused by injection;

[0091] The induction period of the present invention is compressed from 30-42 days shown in most experiments to 7 to 21 days, and a stable modeling state is maintained for the subsequent 21 to 42 days, avoiding abnormal group dropouts such as animal depression, death, weight loss, etc. caused by long-term injection.

[0092] The present invention establishes a new color card evaluation scheme and a scheme for estimating the number of animals entering the experiment based on multiple batches of experimental data, which can effectively estimate the final number of animals to be entered in the experiment preparation stage, facilitating the implementation of the overall experimental plan.

[0093] The testosterone propionate of the present invention adopts the method of inducing model mice by enema administration, which can stably achieve the simulation of human male follicle loss model in a short period of time. The expected plan and observation judgment nodes are highly consistent with the physiological characteristics of mice, which is convenient for the main research. It can also solve the problem that modeling administration and general treatment methods cannot be carried out simultaneously. It is more in line with the welfare protection of animal research experiments.

[0094] The foregoing description of specific exemplary embodiments of the present invention is for the purpose of illustration and demonstration. These descriptions are not intended to limit the present invention to the precise form disclosed, and it is clear that many changes and variations can be made based on the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present invention and its practical application, so that those skilled in the art can realize and utilize various different exemplary embodiments of the present invention and various different selections and changes. Any simple modifications, equivalent changes and modifications made to the above exemplary embodiments should fall within the scope of protection of the present invention.

Claims

1. A method for constructing a non-invasive animal model for simulating human androgenic alopecia, characterized in that: The following steps are involved: 1) Take the adaptively cultured mice and perform hair removal treatment; 2) For hair loss mice that meet the requirements, testosterone propionate solution is administered by enema, the dosage of testosterone propionate is 1-10 mg / kg / time, once every 2-4 days, and the number of administrations is 4-8 times, so as to obtain an androgenic alopecia mouse model.

2. The construction method according to claim 1, characterized in that: In step 2), the administration frequency of testosterone propionate is once every 3 days.

3. The construction method according to claim 1 or 2, characterized in that: In step 2), the administration frequency is 5 to 7 times.

4. The construction method according to any one of claims 1 to 3, characterized in that: In step 2), the concentration of the testosterone propionate solution is 40-70 mg / mL, optionally 40-60 mg / mL, optionally 50 mg / mL.

5. The construction method according to any one of claims 1 to 4, characterized in that: In step 2), in the testosterone propionate solution, the testosterone propionate is testosterone propionate veterinary medicine, and optionally, the solvent is corn oil.

6. The construction method according to any one of claims 1 to 5, characterized in that: In step 1), the depilatory treatment method includes: applying depilatory cream on the back of the mouse after shaving, leaving it on for 1 to 5 minutes, and wiping off the depilatory cream; optionally, the depilatory cream is left on for 2 to 3 minutes.

7. The construction method according to any one of claims 1 to 6, characterized in that: In step 1), mice with dark back skin color or obvious local black spots are removed after hair removal, so that the back skin color of mice is basically uniform.

8. The construction method according to any one of claims 1 to 6, characterized in that: Observation was performed after the administration, and the model was considered successful when the hair growth cycle was significantly delayed.

9. A mouse model for preparing a drug screening for preventing and / or treating androgenic alopecia, characterized in that: The model is constructed by the construction method described in any one of claims 1 to 8.

10. Use of the construction method according to any one of claims 1 to 8 in screening drugs for preventing and / or treating androgenic alopecia, wherein the drug is a drug targeting 5α-reductase or inhibiting 5α-reductase activity.

Images