Novel CmpL4 protein mutant and application thereof in production of L-glutamic acid

Abstract

The invention belongs to the technical field of biology, and particularly relates to a novel CmpL4 protein mutant. According to the amino acid sequence of the mutant, alanine at the 28th site corresponding to the amino acid sequence shown in SEQ ID NO: 1 is substituted by threonine, and / or proline at the 239th site is substituted by leucine. Compared with CmpL4 with a sequence shown in SEQ ID NO: 1, the CmpL4 mutant provided by the invention has the advantages that the L-glutamic acid yield and conversion rate of a strain containing the mutant are improved, so that the production cost of glutamic acid can be reduced, and the CmpL4 mutant can be possibly used for large-scale production of glutamic acid.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a novel CmpL4 protein mutant, and a method and application for constructing a strain with high L-glutamic acid production. Background Art

[0002] Corynebacterium glutamicum is an important industrial microorganism, widely used in the fermentation production of bulk chemicals such as L-glutamic acid. The cell wall of Corynebacterium glutamicum is divided into two layers, the inner and outer layers. The inner layer is mainly composed of peptidoglycan, arabinogalactose and mycolic acid covalently linked to form mAGP complex, which constitutes the main permeability barrier, among which the lipid components mainly composed of mycolic acid play a key role. Mycolic acid is synthesized intracellularly and is mainly composed of long-chain α-alkyl-β-hydroxy fatty acids. It is transported to the outside of the cell membrane in the form of trehalose corynomycolates (TMCM), converted into trehalose dicorynomycolates (TDCM) and participates in the synthesis of the cell wall. The resistance–nodulation–cell division (RND) superfamily transporter is mainly responsible for the efflux of TMCM. This type of protein is called MmpLs (Mycobacterial membrane protein Large) in mycobacteria. There are 14 mmpL genes in the genome of mycobacterium, among which MmpL3 is essential in mycobacteria. Its deletion will lead to the loss of TDCM in the cell wall, resulting in increased sensitivity of the bacteria to antibiotics (Chemistry & Biology, 2012, 19(4), 498-506).

[0003] There are four genes in the genome of Corynebacterium glutamicum annotated as MmpL homologs, namely CmpL1, CmpL2, CmpL3 and CmpL4, which are all involved in the synthesis and transport of lipid components in the cell wall of Corynebacterium glutamicum, but there are certain differences in substrate specificity and transport efficiency (Microbiology Open, 2014, 3(4), 484-496). Among them, CmpL1 and CmpL4 have a predicted topological structure similar to that of MmpL3 of Mycobacterium tuberculosis (12 TM domains and 2 non-TM loops).

[0004] Since the cell membrane wall structure of Corynebacterium glutamicum has an important influence on the synthesis and secretion of L-glutamate (Journal of Physical Engineering, 2022, 38(11), 4343-4351.), however, there are currently few reports on the modification of cell membrane wall-related genes of Corynebacterium glutamicum. Therefore, this field needs to further modify targets that may affect the membrane wall structure, so as to increase the strain's L-glutamate production. Summary of the invention

[0005] The present invention analyzes the genome sequence of the glutamate high-yielding strain SL4 obtained by the research team in the early stage, finds that there is a point mutation in its CmpL4, and further studies find that the 28th alanine is replaced by threonine, and / or the 239th proline is replaced by leucine, which can increase the glutamate yield of the strain, thereby improving the production efficiency of glutamate and reducing the production cost. On this basis, the present invention is completed.

[0006] In a first aspect, the present invention provides a CmpL4 mutant, wherein the amino acid sequence of the mutant corresponds to the amino acid sequence shown in SEQ ID NO: 1, in which the 28th alanine is replaced by threonine, and / or the 239th proline is replaced by leucine.

[0007] Furthermore, the amino acid sequence of the CmpL4 mutant is shown in SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7.

[0008] The "CmpL4" mentioned herein refers to a protein derived from Corynebacterium glutamicum, the encoding gene of which is a protein with Gene ID BBD29_01375, that is, a polypeptide with an amino acid sequence as shown in SEQ ID NO: 1.

[0009] In a second aspect, the present invention provides a polynucleotide encoding the CmpL4.

[0010] Specifically, the polynucleotide encoding CmpL4 of the present invention includes the polynucleotide shown in SEQ ID NO: 2, and a polynucleotide having a mutation at position 82, and / or a polynucleotide having a mutation at position 716. Further, the polynucleotide sequence encoding the CmpL4 mutant is shown in SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8.

[0011] In a third aspect, the present invention provides the use of the CmpL4 mutant or its encoding nucleotide in improving the yield and conversion rate of L-glutamate.

[0012] In a fourth aspect, the present invention provides an L-glutamic acid producing strain, into which the CmpL4 mutant of the first aspect or the encoding polynucleotide of the second aspect is introduced to improve the L-glutamic acid production and conversion rate of the strain.

[0013] The production strain of the present invention is Corynebacterium glutamicum, including but not limited to Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and mutants or strains producing L-glutamic acid prepared by the above strains.

[0014] In some embodiments, the glutamate producing strain may be a strain obtained by transformation based on Corynebacterium glutamicum ATCC 13032 or Corynebacterium glutamicum ATCC13869, wherein the transformation includes but is not limited to one or more genes selected from the following being enhanced or overexpressed:

[0015] a. yggB gene encoding mechanosensitive channel protein (CN108250278A);

[0016] b. fxpk gene encoding phosphoketolase (WO2006016705A1);

[0017] c. pyc gene encoding pyruvate carboxylase (WO2004069996A2);

[0018] d. gdh gene encoding glutamate dehydrogenase (CN103205390A);

[0019] e. Gene encoding carbonic anhydrase (WO2011024583A1).

[0020] In some embodiments, the glutamate producing strain may also have one or more genes selected from the group consisting of, but not limited to, the following attenuated or reduced in expression:

[0021] a. odhA gene encoding α-ketoglutarate dehydrogenase (WO2006028298A2);

[0022] b. amtR gene encoding a transcriptional regulatory gene (EP2276845A1);

[0023] c. acnR gene encoding a transcription repressor (CN111334535A).

[0024] In a specific embodiment of the present invention, the host cell is Corynebacterium glutamicum, which is further improved by introducing A111V mutation into the NCgl1221 homologous gene (BBD29_06760 or yggB) in the bacteria and C361Y into the citrate synthase GltA encoding gene to obtain the glutamate producing strain SCgGC7.

[0025] In the present invention, the host cells can be cultured according to conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, etc., and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to actual conditions.

[0026] In a fifth aspect, the present invention provides a method for producing L-glutamic acid, the method comprising culturing the host cell of the fourth aspect to produce L-glutamic acid, and further comprising the step of separating, extracting or recovering L-glutamic acid from the culture medium.

[0027] Beneficial effects of the present invention: The CmpL4 mutant provided by the present invention has improved L-glutamic acid production and conversion rate in a strain containing the mutant compared with CmpL4 of the sequence shown in SEQ ID NO: 1, thereby reducing the production cost of glutamic acid and potentially being used for large-scale production of glutamic acid. DETAILED DESCRIPTION

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used to implement or test the present invention, the methods and materials provided herein are preferred.

[0029] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental techniques and experimental methods used in the examples are all conventional technical methods unless otherwise specified. For example, the experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified.

[0030] The culture medium used in the examples is as follows:

[0031] The components of TSB plate culture medium are (g / L): glucose, 5g / L; yeast powder, 5g / L; soy peptone, 9g / L; urea, 3g / L; succinic acid, 0.5g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.1g / L; biotin, 0.01mg / L; vitamin B1, 0.1mg / L; MOPS, 20g / L; agar powder, 15g / L.

[0032] The components of TSB liquid culture medium are (g / L): glucose, 5g / L; yeast powder, 5g / L; soy peptone, 9g / L; urea, 3g / L; succinic acid, 0.5g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.1g / L; biotin, 0.01mg / L; vitamin B1, 0.1mg / L; MOPS, 20g / L.

[0033] The components of the seed culture medium used in the glutamate fermentation experiment are: glucose, 25g / L; KH2PO4·3H2O, 2.2g / L; urea, 3g / L; corn steep liquor, 33mL; MgSO4·7H2O, 0.9g / L; soybean cake hydrolyzate, 22mL; MOPS, 20g / L; initial pH 7.2.

[0034] The components of the fermentation medium used in the glutamate fermentation experiment are: glucose, 80g / L; KH2PO4, 1g / L; urea, 10g / L; corn steep liquor powder, 5g / L; MgSO4·7H2O, 0.4g / L; FeSO4·7H2O, 10mg / L; MnSO4·4H2O, 10mg / L; VB1, 200μg / L; MOPS, 40g / L; initial pH 7.5.

[0035] Example 1. Construction of CmpL4 mutant strain of Corynebacterium glutamicum

[0036] The RND family transporter CmpL4 (GeneID cgl0231 or NCgl0228) in the genome of Corynebacterium glutamicum has a topological structure similar to that of MmpL3 of Mycobacterium tuberculosis (12 TM domains and 2 non-TM loops), which has an important influence on lipid synthesis / transport of Corynebacterium glutamicum (Microbiology Open, 2014, 3(4), 484-96). Therefore, it is speculated that mutations in this protein may be effective for the synthesis of glutamate.

[0037] At the same time, it was found that in a strain SL4 (Liu Jiao, et al., Mutations in Peptidoglycan Synthesis Gene ponAImproveElectrotransformation Efficiency of Corynebacterium glutamicum ATCC13869. Appl. Environ. Microbiol., 2018, 84, e02225-02218) with high glutamate production screened by the inventor in the early stage, the 28th alanine of its CmpL4 was replaced by threonine, and the 239th proline was replaced by leucine. In order to verify the effect of these two mutation points on glutamate synthesis, the present invention was modified on the basis of a strain with glutamate synthesis ability, SCgGC7 (strain information and construction process reference CN115927325A).

[0038] (1) Construction of CmpL4 single-site mutant strains

[0039] Primers were designed based on the published genome sequence of Corynebacterium glutamicum ATCC 13869 (GenBank: CP016335.1) and the gene sequence of cmpL4 (Gene ID: BBD29_01375). Primers were used to amplify the CmpL4 gene with L4-F1 / L4-28-R1, L4-28-F2 / L4-R2, L4-F1 / L4-239-R1 and L4-239-F2 / L4-R2, respectively. A28T and CmpL4 P239L The upstream and downstream recombinant fragments of the mutant. Primers pK-F / R were designed based on the sequence information of plasmid pK18mobsacB, and the linearized vector fragment was obtained by reverse PCR amplification using plasmid pK18mobsacB as a template. The primers used in this example are shown in Table 1. The above three fragments were recovered and recombined to obtain the editing plasmid pK18-CmpL4 with the CmpL4 single site mutant. A28T and pK18-CmpL4 P239L .

[0040] SCgGC7 competent cells were prepared by the method reported in the literature (Biotechnology Letters, 2015, 37: 2445-52.), and 1 μg of pK18-CmpL4 was electroporated into the competent cells prepared above. A28T and pK18-CmpL4 P239LPlasmid, add 1mL of TSB medium preheated at 46℃, incubate at 46℃ for 6min, incubate at 30℃ for 3h, apply TSB solid medium containing 25μg / mL kanamycin, and culture at 30℃ for 24h to obtain the first recombinant transformant. The correct transformant was transferred to TSB medium containing 5g / L glucose for overnight culture, and then transferred to TSB medium containing 100g / L sucrose. After culturing at 30℃ for 4h, it was applied to TSB medium supplemented with 100g / L sucrose for screening, and the L-glutamic acid production strain SCgGC7-CmpL4 with mutant CmpL4 was obtained. A28T and SCgGC7-CmpL4 P239L . That is, the strain contains the mutated CmpL4.

[0041] Table 1 Primers for constructing single-site mutant editing plasmids

[0042] Primer Nucleotide sequence pK-F AAGCTTGGCACTGGCCGTCG pK-R GAATTCGTAATCATGTCATAGCTGT L4-F1 tgacatgattacgaattcATAACGAGTCCCTAGCTGAT L4-28-R1 ccaacaatggTcaaaataagtagccatgccg L4-28-F2 acttattttgAccattgttggtggtctggcc L4-R2 cgacggccagtgccaagcttTCAACTCAGGGGTCTCTTTA L4-239-R1 ggtaatcaaaAgcaagcctgcagcaatcaaa L4-239-F2 gcaggcttgcTtttgattaccgcggtgatcg

[0043] (2) Construction of CmpL4 double-site mutant strain

[0044] Since both CmpL4 sites in strain SL4 were mutated, a double-site mutant strain was constructed to further verify the effect of these two mutation points on glutamate synthesis. Primers were designed based on the published genome sequence of Corynebacterium glutamicum ATCC 13869 (GenBank: CP016335.1) and the gene sequence of cmpL4 (Gene ID is BBD29_01375). A28T The genome was used as a template to amplify the CmpL4 gene using L4-F1 / L4-239-R1 and L4-239-F2 / L4-R2. P239L The upstream and downstream recombinant fragments of the mutant. Primers pK-F / R were designed based on the sequence information of plasmid pK18mobsacB, and the linearized vector fragment was obtained by reverse PCR amplification using plasmid pK18mobsacB as a template. The primers used in this example are shown in Table 1. The above three fragments were recovered and recombined to obtain a vector fragment with CmpL4 P239L The editing plasmid pK18-CmpL4 of the mutant P239L -28.

[0045] SCgGC7-CmpL4 was prepared by the method reported in the literature A28T Competent cells (Biotechnology Letters, 2015, 37: 2445-52.), 1 μg of pK18-CmpL4 was electroporated into the competent cells prepared above P239L-28 plasmid, add 1mL of TSB medium preheated at 46℃, incubate at 46℃ for 6min, incubate at 30℃ for 3h, apply TSB solid medium containing 25μg / mL kanamycin, and culture at 30℃ for 24h to obtain the first recombinant transformant. The correct transformant was transferred to TSB medium containing 5g / L glucose for overnight culture, and then transferred to TSB medium containing 100g / L sucrose. After culturing at 30℃ for 4h, it was applied to TSB medium supplemented with 100g / L sucrose for screening, and the L-glutamic acid production strain SCgGC7-CmpL4 with mutant CmpL4 was obtained. A28T,P239L That is, the strain contains CmpL4 with double mutation sites.

[0046] Example 2: Effect of CmpL4 mutation on L-glutamic acid production

[0047] In order to verify the effect of CmpL4 mutation on glutamate production, the SCgGC7-CmpL4 constructed above was A28T , SCgGC7-CmpL4 P239L and SCgGC7-CmpL4 A28T,P239L The strains were subjected to fermentation tests, and strain SCgGC7 was used as a control.

[0048] The strains SCgGC7 and SCgGC7-CmpL4 A28T , SCgGC7-CmpL4 P239L and SCgGC7-CmpL4 A28T,P239L The culture was inoculated into the seed medium and cultured for 8 h. The culture was inoculated as seeds into 24-well plates containing 800 μL of fermentation medium per well. The initial OD 600 The control was about 0.5, the rotation speed of the well plate shaker was 800 rpm, 3 parallels were used for each strain, cultured at 30°C, 5 g / L urea was added for 23 hours, and the fermentation was terminated after 25 hours. The L-glutamic acid production and glucose consumption were detected, and the sugar-acid conversion rate from glucose to L-glutamic acid was calculated. The results are shown in Table 2.

[0049] Table 2. L-glutamic acid production and sugar-acid conversion rate

[0050]

[0051] From the table, we can see that CmpL4 A28T and CmpL4 P239L The mutation can significantly increase the L-glutamic acid yield and sugar-acid conversion rate, and the combination has a better effect, and has a good application prospect in the production of L-glutamic acid and its derivatives.

Claims

1. A novel CmpL4 protein mutant, characterized in that: The amino acid sequence of the mutant corresponds to the amino acid sequence shown in SEQ ID NO: 1, wherein the 28th alanine is replaced by threonine, and / or the 239th proline is replaced by leucine.

2. The novel CmpL4 protein mutant according to claim 1, characterized in that: The amino acid sequence of the mutant corresponds to the amino acid sequence shown in SEQ ID NO: 1, in which the 28th alanine is replaced by threonine, and the 239th proline is replaced by leucine.

3. A novel CmpL4 protein mutant according to any one of claims 1 to 3, characterized in that: The amino acid sequence of the novel CmpL4 protein mutant is shown in SEQ ID NO:3 or SEQ ID NO:5 or SEQ ID NO:

7.

4. A polynucleotide encoding the novel CmpL4 protein mutant according to any one of claims 1 to 3, preferably, the polynucleotide encoding the novel CmpL4 protein mutant is as shown in SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:

8.

5. A vector containing a polynucleotide encoding the novel CmpL4 protein mutant according to claim 4, preferably a recombinant expression vector, such as a bacterial plasmid, phage DNA, yeast plasmid, or a viral vector.

6. A recombinant host cell containing a polynucleotide encoding the novel CmpL4 protein mutant according to claim 4, wherein the host cell is a prokaryotic cell, preferably an Enterobacterium or a Corynebacterium, more preferably Corynebacterium glutamicum, more specifically Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and mutants or strains producing L-glutamate prepared by the above strains.

7. The recombinant host cell according to claim 6, characterized in that The host cell is a strain obtained by transformation based on Corynebacterium glutamicum ATCC 13032 and Corynebacterium glutamicum ATCC13869, wherein the transformation includes but is not limited to one or more genes selected from the following being enhanced or overexpressed: a. Encoding mechanosensitive channel proteins ygB Gene; b. Encoding phosphoketolase fxpk Gene; c. Encoding pyruvate carboxylase pyc Gene; d. Encoding glutamate dehydrogenase gd Gene; e. Gene encoding carbonic anhydrase.

8. The recombinant host cell according to claim 7, characterized in that The glutamate producing strain may also include, but is not limited to, one or more genes selected from the following being weakened or having reduced expression: a. Encoding α-ketoglutarate dehydrogenase odhA Gene; b. Encoding transcriptional regulatory genes ikB Gene; c. Encoding transcriptional repressors acn Gene; Preferably, the Corynebacterium glutamicum is further modified, wherein NCgl1221 The A111V mutation was introduced into the homologous gene, and the C361Y mutation was introduced into the GltA encoding gene.

9. Use of the novel CmpL4 protein mutant or its encoding polynucleotide according to any one of claims 1 to 3 in producing glutamate.

10. A method for producing glutamic acid, characterized in that: The method comprises culturing the recombinant host cell according to any one of claims 5 to 8 to produce glutamate, and further comprises the step of separating, extracting or recovering glutamate from the culture medium.

Images