Multi-cell co-cultured organoid micro-fluidic chip for remodeling cervical cancer tumor microenvironment and use method thereof
By designing a multi-cell co-culture organoid microfluidic chip, using bonding molding structure and micro-perfusion network channel, the problems of high difficulty in filling, high failure rate and difficult interaction between immune cells in the existing technology are solved, and high efficiency is achieved organoid perfusion and immune cell interaction reduce production costs and improve yield rates.
Patent Information
- Application Number
- CN202411447790.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-16
- Publication Date
- 2024-12-20
AI Technical Summary
In the multi-cell co-culture, existing organoid microfluidic chips have problems such as difficult glue filling, high failure rate, easy passage blockage, high production difficulty, high cost, and inability to simulate the interaction between real immune cells and tumor organoids.
A multi-cell co-culture organoid microfluidic chip was designed, using a bonded upper and lower structure, including organoid culture medium perfusion channel, group channel barrier, tumor fibroblast culture layer and micro-perfusion network channel. Signal communication and interaction between different organoids is achieved through micro-perfusion network channels and selective permeability barriers, avoiding perfusion of matrix gel, and using U-shaped structures and factors secreted by fibroblasts to promote organoid sphere formation.
It has achieved the need for multicellular coculture at the micrometer scale, improved the efficiency of organoid perfusion, maintained the specific nutrition and microenvironment of various organs, simulated the interaction of immune cells and tumor microenvironment in vivo, reduced production costs and increased The yield rate.
Smart Images
Figure CN119161982A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of organoid microfluidic chips, and in particular to a multi-cell co-culture organoid microfluidic chip and a use method thereof. Background Art
[0002] Organoids are microscopic three-dimensional structures that can self-assemble when pluripotent stem cells (PSC) and adult stem cells (ASC) are cultured in vitro. Organoids can simulate human organs in structure and function, and have good application potential in regenerative medicine, gene editing, precision medicine, organ development, disease modeling, etc. In 2017, it was named "Biotechnology of the Year" by Nature. The development of organoid technology was detailed in the New England Journal of Medicine in 2019 and appeared on the cover of Science magazine.
[0003] Microfluidic chips, also known as lab-on-chip, are technologies for manipulating fluids at the micrometer scale and were positioned as "disruptive technologies" by the Ministry of Science and Technology in 2017. Organ chip technology, which combines microfluidic chips with cell culture, can simulate the functions of human organ units and was named one of the top ten emerging technologies in the world in 2016 by the World Economic Forum.
[0004] The "organ-on-a-chip" technology, which integrates organ-on-a-chip technology with organoids, has unique advantages because it can controllably regulate signaling pathways in real time during organoid development and fully simulate the in vivo microenvironment and mechanical forces. Single organ-on-a-chip has important advantages for exploring the function of a single organ, but single organ-on-a-chip technology cannot simulate the systemic interaction of organs in response to injury, disease, and treatment. This makes it difficult to simulate and study diseases involving multiple organs and vascular flow (such as cancer, metabolism, fibrosis, inflammation, and infection) in in vitro experiments.
[0005] At present, the research on multi-organ chip-related disease models has mainly focused on the co-culture of monolayer cell lines from multiple organs. This type of chip can realize the study of the influence and crosstalk between different types of cells, but it cannot give full play to the unique role of organoid technology in organ simulation, and cannot realize the characteristics of vascular and immune system flow, so that each cell cannot maintain its own growth microenvironment and unique phenotype. The pluggable multi-organ chip co-culture chip published in Nature Biomedical Engineering (IF=25.671) by the Department of Engineering and Medical Center of Columbia University in the United States in 2022, for the first time, simultaneously realized (1) each organ maintains its own specific microenvironment, (2) realizes interactive communication between different organs through the flow of vascular endothelial channels, and (3) separates the vascular channel and organ culture chamber through a selective permeability barrier. However, this organ chip is cultured at a larger size and cannot achieve microfluidic liquid perfusion and organoid growth at the micrometer level.
[0006] There are three major challenges that the above defects fail to address: First, the organoid culture chips currently represented by the gel drop method contain matrix gel, which generally has the problems of difficulty in gel injection, high failure rate, insufficient organoid perfusion, and easy blockage of channels after gel drop. Second, the current organoid microfluidic chips are difficult to make, with high production and use costs, and it is difficult to meet the design requirements of organoid microfluidic chips for multi-cell co-culture at the micron scale. Third, the current co-culture of immune cells and organoids is mostly established in the small holes of single-hole microarray organoids in a static state, which makes it difficult to achieve the interaction between immune cells and tumor organoids in real situations.
[0007] In view of this, we propose a multi-cell co-culture organoid microfluidic chip and a method for using the same. Summary of the invention
[0008] The purpose of the present invention is to provide a multi-cell co-cultured organoid microfluidic chip, which ensures the specific nutrition and microenvironment of each organ, and helps to maintain its specific phenotype. At the same time, it can simulate the interaction of immune cells in the body, conduct signal communication and interaction between cells in the tumor microenvironment, and fully simulate the in vivo environment and interaction of the immune microenvironment of cervical cancer.
[0009] To achieve the above object, the present invention provides the following technical solutions: A multi-cell co-culture organoid microfluidic chip comprises an organoid microfluidic chip single channel, wherein the organoid microfluidic chip single channel is divided into an upper and lower layer of bonded formation, wherein the upper layer is sequentially provided with an organoid culture medium perfusion channel and a grouping channel barrier, and the lower layer is provided with an organoid culture chamber, a tumor fibroblast culture layer and a microperfusion network channel, the organoid culture medium perfusion channel is connected to the microperfusion network channel, partitions are respectively provided between different organoid microfluidic chip single channels, and the organoid chambers in the same single channel are connected by the microperfusion network channel.
[0010] Preferably, the organoid culture medium perfusion channel and the grouping channel barrier are sequentially arranged on the lower surface of the upper chip, and the organoid culture chamber, the tumor fibroblast culture layer and the microperfusion network channel are arranged downward on the upper surface of the lower chip.
[0011] Preferably, the multi-cell co-cultured organoid microfluidic chip is characterized by: = 1 \* GB3 ① Organoids can be spheroided without the need to perfuse matrix gel in the organoid culture chamber: the unique U-shaped structure of the chamber and factors such as fibroblast growth factor (FGF)-2 secreted by tumor fibroblasts in the organoid culture chamber can prevent tumor cells from adhering to the wall, so that tumor cells have a scaffold between cells without the need to perfuse matrix gel, and directly spheroidize to form organoids. = 2 \* GB3 ② It contains 8 single channels of organoid microfluidic chips, each of which contains multiple organoid chambers, which can simultaneously reflect the performance of up to 8 drugs in the cervical cancer tumor microenvironment. = 3 \* GB3 ③ The interaction between immune cells and tumor cells and tumor stroma can be observed in vitro, and the role of different components in the cervical cancer tumor microenvironment can be studied by adjusting the ratio between different cells.
[0012] Preferably, the multi-cell co-culture organoid microfluidic chip is characterized in that the number of single channels of the organoid microfluidic chip is 2, 3, 4, 5, 6, 7, or 8.
[0013] Preferably, the multi-cell co-culture organoid microfluidic chip is characterized in that the microperfusion network channel is designed with a selective permeability barrier that restricts tumor organoids.
[0014] Preferably, the multi-cell co-culture organoid microfluidic chip is characterized in that the outer dimensions of the chip are 40 mm in width and 40 mm in length.
[0015] Preferably, the multi-cell co-culture organoid microfluidic chip is characterized in that the inner layer of the chip is spaced at least 10 mm from the periphery of the chip.
[0016] Preferably, the multi-cell co-culture organoid microfluidic chip is characterized in that the interval between single channels of the chip is at least 4 mm.
[0017] Preferably, the multi-cell co-culture organoid microfluidic chip is characterized in that after the upper and lower layers of the chip are bonded and formed, an organoid culture chamber is formed, and the organoid culture chamber can be divided into multiple observation spaces. The interval between the same single-channel chambers is at least 2 mm, the chamber depth is 2.5 mm, the diameter is 1.5 mm, and the diameter of the micro-perfusion network channel between the chambers is 50 um.
[0018] The microperfusion network channel is designed with a diameter-restricted selective permeability barrier that limits tumor organoids while ensuring the independent growth of organoids and signal interaction between organoids.
[0019] The lower layer of the chip is designed with a micro-perfusion network channel to maximize the perfusion efficiency of the organoids, ensuring nutrient supply and the discharge of metabolic waste.
[0020] Preferably, the organoid culture medium perfusion channel, the organoid culture chamber and the microperfusion network channel are connected by setting perfusion holes. The design of the perfusion holes facilitates the perfusion of cells or culture medium in the chip, and facilitates the external connection of pipelines in the co-culture chip microfluidic system. After the upper and lower layers of the chip are bonded and formed, an organoid culture chamber is formed, and the organoid culture chamber can form multiple observation spaces. In the culture chamber, cervical cancer organoid single cells can grow into organoids through self-assembly in the matrix gel.
[0021] Preferably, the present invention provides a method for using a multi-cell co-culture organoid microfluidic chip, the steps of which are: = 1 \* GB3 ① Place the chip upright, and perfuse tumor fibroblasts containing DMEM culture medium with 10% fetal bovine serum from the side perfusion holes from bottom to top and from left to right; = 2 \* GB3 ② After standing for 24 hours, perfuse cervical cancer organoid single cells containing organoid special culture medium from the side perfusion holes from bottom to top and from left to right; = 3 \* GB3 ③ After standing for 3 days, after observing that the cervical cancer organoids are slightly spherical under a microscope, perfuse the organoid culture medium containing human recombinant IL-2 mixed with the patient's peripheral blood mononuclear cells from bottom to top and from left to right through the perfusion holes, and let it stand to allow the immune cells to adhere to the organoid culture chamber system; = 4 \* GB3 ④ The organoid culture medium perfusion channel is connected to an external peristaltic pump to circulate the culture medium containing the patient's peripheral blood mononuclear cells. The organoid cells, patient immune cells and patient fibroblasts interact and self-assemble in the organoid culture chamber, and gradually grow into mature organoids.
[0022] Preferably, the present invention provides a circulating perfusion system for a multi-cell co-cultured organoid microfluidic chip, wherein the perfusion holes at both ends of the organoid culture medium perfusion channel are connected to a peristaltic pump and a culture medium through pipes, respectively, and the peristaltic pump and the culture medium are connected through pipes. With the peristaltic pump as the power, a circulating perfusion system for the organoid nutrition channel and the drug channel is established, which is convenient for the collection and detection of the perfusion fluid.
[0023] By means of the above technical solution, the present invention provides a multi-cell co-culture organoid microfluidic chip and a method of use. It has at least the following beneficial effects: (1) The present invention can be widely used to simulate the interaction between two or more cells and multi-cellular drug effects and toxicity assessment, which are difficult to simulate in vitro experiments, by simultaneously meeting the co-culture and free combination of more than three different cells at the micrometer scale. It fills the gap in the industry and has a wide range of application value.
[0024] (2) The present invention greatly increases the efficiency of organoid perfusion by adding microperfusion channels, improves the exchange efficiency of nutrients and metabolites, and can meet the needs of long-term culture of organoids.
[0025] (3) The present invention ensures the specific nutrition and microenvironment of each organ through the addition of channel barriers, which helps to maintain its specific phenotype. At the same time, various organs can use circulatory channels to simulate the circulatory system in the body, communicate and interact between organoids, and fully simulate the in vivo environment and interaction of multi-organ diseases.
[0026] (4) The present invention is adapted to conventional microfluidic chip detection means and real-time dynamic observation. At the same time, the presence of the liquid storage tube and the circulation of the culture medium facilitate the replacement of the culture medium at any time, and can detect and evaluate more than ten components of the circulating culture medium, such as pH, nutrients, metabolic waste, compound concentration, signal molecules, exosomes, etc., which greatly enriches the detection means.
[0027] (5) The present invention maximizes the advantages of soft lithography technology, uses silicon wafers with high manufacturing precision as lithography molds, and uses PDMS as a matrix for processing. It can be mass-produced, and the single-chip production cost is low and the yield rate is high, which has great commercial potential. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] The accompanying drawings described herein are used to provide a further understanding of the present invention and constitute a part of this application: Figure 1 This is a schematic diagram of the structure of the multi-cell co-culture organoid microfluidic chip of the present invention; Figure 2 It is a cross-sectional view of the overall structure of the microfluidic chip in the present invention; In the figure: 1. Organoid culture medium perfusion channel; 2. Microperfusion network channel; 3. Organoid culture chamber; 4. Poly-lysine (PDL) and collagen I coating; 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18.
[0029] Figure 3 The overall top view and front view of the microfluidic chip of the present invention; Figure 4 Schematic diagram of the circulating perfusion system of the chip in the present invention.
[0030] Figure 5 The images of organoids and immune cells in the chip three days after the addition of immune cells. Green represents human cervical cancer organoids labeled with GFP fluorescence, and red represents T cells labeled with CD3 fluorescence. The scale bar is 100um. DETAILED DESCRIPTION
[0031] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0032] See also Figure 1-Figure 3 As shown, it includes a single channel of an organoid microfluidic chip, and the single channel of the organoid microfluidic chip is divided into an upper and lower layer of bonded molding, wherein the upper layer is a PDMS material perfused by a photolithography technology model, and an organoid culture medium perfusion channel and a grouping channel barrier are sequentially arranged, and the lower layer is a PS material perfused by a numerical control technology model, and an organoid culture chamber, poly-lysine (PDL) and collagen I coating and a micro-perfusion network channel are arranged, the organoid culture medium perfusion channel and the micro-perfusion network channel are connected, and partitions are respectively arranged between single channels of different organoid microfluidic chips, and the organoid chambers between the same single channel are connected by a micro-perfusion network channel.
[0033] Furthermore, the number of single channels of the organoid microfluidic chip is 2, 3, 4, 5, 6, 7, and 8.
[0034] The length and width of the chip are 40mm respectively. The distance between the organoid culture medium perfusion channel 1 and the side of the chip is 6mm and the diameter is 0.8mm, which is convenient for connecting the needle to introduce the culture medium and cells; the distance between the organoid culture chamber 3 and the organoid culture medium perfusion channel 1 is 4.5mm. Each organoid culture chamber has a diameter of 1.5mm and a depth of 2.5mm. The distance between organoid culture chambers in the same single channel is 2mm, and the distance between single channels is 4mm.
[0035] A micro-perfusion network channel 2 with a diameter of 0.15 mm is designed in the single channel to ensure the independent growth of organoids and the signal interaction between organoids. Each single channel has an independent perfusion inlet and outlet, which maximizes the perfusion efficiency of organoids and ensures the supply of nutrients and the discharge of metabolic waste.
[0036] Furthermore, the poly-lysine (PDL) and collagen I coating 4 can facilitate the attachment of primary extracted tumor fibroblasts to the wall, thereby secreting related factors such as FGF-2. The organoid culture chamber 3 and factors such as FGF-2 and collagen fibers can make the organoids spherical without adding matrix glue.
[0037] After the upper and lower layers of the chip are bonded together, an organoid culture chamber 3 is formed. The entire chip contains up to 48 organoid culture observation spaces. In the culture chamber, organoid single cells can grow into organoids through self-assembly.
[0038] See also Figure 4 , a method for using a multi-cell co-culture organoid microfluidic chip, the steps of which are: 1) Place the chip upright and perfuse tumor fibroblasts in DMEM medium containing 10% fetal bovine serum from bottom to top and from left to right through the side perfusion holes; 2) After standing for 24 hours, perfuse cervical cancer organoid single cells containing organoid-specific culture medium from bottom to top and from left to right through the side perfusion holes; 3) After the cervical cancer organoids were observed to be slightly spherical under a microscope for 3 days, the organoid culture medium containing human recombinant IL-2 mixed with the patient's peripheral blood mononuclear cells was perfused from bottom to top and from left to right through the perfusion holes and allowed to stand to allow the immune cells to adhere to the organoid culture chamber system; 4) The organoid culture medium perfusion channel is connected to an external peristaltic pump to circulate the culture medium containing the patient's peripheral blood mononuclear cells. The organoid cells, patient immune cells and patient fibroblasts interact and self-assemble in the organoid culture chamber, and gradually grow into mature organoids.
[0039] See also Figure 4 , a circulating perfusion system of a multi-cell co-cultured organoid microfluidic chip, wherein the organoid culture medium perfusion channel 1 and the microperfusion network channel 2 are respectively connected to a peristaltic pump and a culture medium through a pipeline, and the peristaltic pump and the culture medium are connected through a pipeline. With the peristaltic pump as the power, a circulating perfusion system of the organoid nutrition channel and the drug channel is established to facilitate the collection and detection of the perfusion fluid. .
[0040] See also Figure 5After isolating mononuclear cells from the peripheral blood of volunteers, T cells were expanded in vitro and T cells in PBMC cells were labeled with flow cytometry antibodies (CD3 / red). Cervical cancer organoids were transfected with lentivirus using GFP and luciferase to make them spontaneously green fluorescent. The specific method was as follows: the optimized luciferase reporter gene luc2 was amplified from the plasmid pGL4.10[luc2]. Primers, F: GAACTAAACCGTCGACGCCACCATGGAAGACGCCAAACATAAAG; R: CCATGGTGGCGTCGACTGGTCCAGGATTCTCTTCGACATCCTGCTTGTTTCAACAGGGAGAAGTTAGTGGCTCCGCTTCCGGACACGGCGATTTCCGCCCTTC, introduced a P2A sequence. The PCR fragment (as above) was inserted into the SalI site of pLV-Pgk: GFP-IRESPuro, 50 of GFP ORF. VSV-G pseudotyped lentiviral particles were produced by polyethylene glycol-mediated transient transfection in HEK293T cells. Four days after transfection, the supernatant was collected and the viral particles were concentrated by ultracentrifugation (20,000g, 1h, 4°C). After the organoids were enzymatically hydrolyzed into single cells, they were transfected with lentivirus. After 3 to 4 days, puromycin was added to the culture medium to screen for transgene-expressing cells. Subsequently, the labeled PBMC cells and cervical cancer organoid cells were cultured in the organoid microfluidic chip of the present invention according to the aforementioned method and observed in the culture chamber on day 0 and day 3, respectively, as shown in the figure.
[0041] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.
[0042] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.
Claims
1. An organoid microfluidic chip for multi-cell co-culture, comprising a single channel organoid microfluidic chip, characterized in that: The single channel of the organoid microfluidic chip is divided into two bonded layers, wherein the upper layer is sequentially provided with an organoid culture medium perfusion channel and a grouping channel barrier, and the lower layer is provided with an organoid culture chamber, a tumor fibroblast culture layer and a microperfusion network channel. The organoid culture medium perfusion channel is connected to the microperfusion network channel, and partitions are respectively provided between the single channels of different organoid microfluidic chips, and the organoid chambers in the same single channel are connected by a microperfusion network channel.
2. The multi-cell co-culture organoid microfluidic chip according to claim 1, characterized in that: The organoid culture medium perfusion channel and the grouping channel barrier are sequentially arranged on the lower surface of the upper chip, and the organoid culture chamber, the tumor fibroblast culture layer and the microperfusion network channel are downwardly arranged on the upper surface of the lower chip.
3. The multi-cell co-culture organoid microfluidic chip according to claim 1, characterized in that: In the organoid microfluidic chip, ① the organoid culture chamber does not need to be perfused with matrix gel to make the organoid spheroid: the organoid culture chamber uses the unique U-shaped structure of the chamber and factors such as fibroblast growth factor (FGF)-2 secreted by tumor fibroblasts to prevent tumor cells from adhering to the wall, so that tumor cells have a scaffold between cells without the need for matrix gel perfusion, and directly spheroidize to form organoids. ② It contains 8 single channels of organoid microfluidic chips, each single channel contains multiple organoid chambers, which can simultaneously reflect the performance of up to 8 drugs in the cervical cancer tumor microenvironment. ③ The interaction between immune cells and tumor cells and tumor stroma can be observed in vitro, and the role of different components in the cervical cancer tumor microenvironment can be studied by adjusting the ratio between different cells.
4. The multi-cell co-culture organoid microfluidic chip according to claim 1, characterized in that: The number of single channels of the organoid microfluidic chip is 2, 3, 4, 5, 6, 7, or 8.
5. The multi-cell co-culture organoid microfluidic chip according to claim 1, characterized in that: The microperfusion network channel is designed with a selectively permeable barrier that is confined to the tumor organoid.
6. The multi-cell co-culture organoid microfluidic chip according to claim 1, characterized in that: The chip has an outer dimension of 40 mm in width and 40 mm in length.
7. The multi-cell co-culture organoid microfluidic chip according to claim 1, characterized in that: The inner layer of the chip is spaced at least 10 mm from the periphery of the chip.
8. The multi-cell co-culture organoid microfluidic chip according to claim 1, characterized in that: The interval between the single channels of the chip is at least 4 mm.
9. The multi-cell co-culture organoid microfluidic chip according to claim 1, characterized in that: After the upper and lower layers of the chip are bonded and formed, an organoid culture chamber is formed. The organoid culture chamber can be divided into multiple observation spaces. The interval between the same single-channel chambers is at least 2mm, the chamber depth is 2.5mm, the diameter is 1.5mm, and the diameter of the micro-perfusion network channel between chambers is 50um.
10. A method for using a multi-cell co-culture organoid microfluidic chip, wherein the characteristic steps are: ① Place the chip upright, and perfuse tumor fibroblasts containing DMEM culture medium with 10% fetal bovine serum from the side perfusion holes from bottom to top and from left to right; ② After standing for 24 hours, perfuse cervical cancer organoid single cells containing organoid special culture medium from the side perfusion holes from bottom to top and from left to right; ③ After standing for 3 days, after observing that the cervical cancer organoids are slightly spherical under a microscope, perfuse organoid culture medium containing human recombinant IL-2 mixed with the patient's peripheral blood mononuclear cells from the perfusion holes from bottom to top and from left to right, and let it stand to allow the immune cells to adhere to the organoid culture chamber system; = 4 \* GB3 ④ The organoid culture medium perfusion channel is connected to a peristaltic pump to circulate the culture medium containing the patient's peripheral blood mononuclear cells. The organoid cells, patient immune cells and patient fibroblasts interact and self-assemble in the organoid culture chamber, and gradually grow into mature organoids.
11. A circulating perfusion system for a multi-cell co-cultured organoid microfluidic chip, characterized in that: The organoid culture medium perfusion channel is connected to the peristaltic pump and the culture medium through the perfusion hole, and the peristaltic pump and the culture medium are connected through a pipeline.
12. A circulation perfusion system for organoid nutrition channels and drug channels, characterized in that: Powered by a peristaltic pump, it is convenient for collecting and detecting the perfusion fluid.