A Boletus edulis strain Wu3500 and its molecular marker and application

Abstract

The present invention provides a Boletus edulis strain Wu3500 and its molecular marker and application. The strain Wu3500 was deposited in Guangdong Provincial Microbiological Culture Collection Center on January 2, 2024, and the deposit number is: GDMCC No: 64234.

Description

Technical Field

[0001] The invention relates to the technical field of edible fungi, and in particular to a Boletus edulis strain Wu3500 and a molecular marker and application thereof. Background Art

[0002] Buchwaldoboletus xylophilus belongs to the genus Buchwaldoboletus of the family Boletaceae in the order Boletales in the kingdom of fungi. It is a rare potential edible boletus resource, commonly found in the subtropical to tropical regions of Asia. The type specimen of this species is native to Sri Lanka, and is distributed in South Asia and Southeast Asia. In my country, it is mainly distributed in the subtropical to tropical regions, such as Yunnan, Hainan and Guangdong. This species has special nutritional habits and has certain saprophytic habits, so it has potential value for development and utilization.

[0003] The fruiting bodies of Boletus edulis are medium-sized, often clustered, sometimes solitary. The cap is yellow-brown or brown, and the edge of the cap is rolled inward when young; the stipe is reddish-brown or brown, and the surface of the stipe is often decorated with longitudinal stripes or fine granules, and the hyphae at the base are yellow; the flesh is yellow or light yellow, and quickly turns blue after being injured; the spores are ovoid or elliptical (Petch 1922; Xie et al. 2021).

[0004] It is reported that this species can be successfully cultivated artificially through bag cultivation, but the current shortage of germplasm resources has restricted the selection and breeding of excellent germplasm resources and high-quality large-scale factory production.

[0005] In addition, strain marker identification is also an important part of edible fungus breeding and an important means of strain resource protection. Traditional morphological or biochemical markers are generally identified by morphological traits or physical and chemical properties, which are easily affected by environmental or human factors and may cause marker failure. Compared with traditional marker methods, molecular marker identification techniques, such as RAPD, ISSR, SCAR, SRAP, etc., have the characteristics of strong specificity, no environmental influence, repeatability and high accuracy. The development of molecular markers can be roughly divided into three stages. The first is represented by RFLP, AFLP and RAPD; the second is represented by SSR markers and ISSR; the third molecular markers are SNP, Indel markers, etc. In recent years, with the rapid development of omics research, the use of genomic data to develop specific molecular markers has become increasingly popular (Lv Yuanda et al., 2014; Zhu Guozhong et al., 2015; Sun Yuqian et al., 2020; Yang Xiumei et al., 2024), which significantly simplifies the process of finding species-specific markers.

[0006] Therefore, there is a need in the art for germplasm resources of Boletus edulis with different genetic backgrounds and better performance to promote the screening of excellent strains of this species and lay an important seed source foundation for the future large-scale factory production of this species with high quality, high yield and stable yield; and there is a need for molecular markers that can specifically detect and identify Boletus edulis strains. Summary of the invention

[0007] In order to solve the above problems, in a first aspect, the purpose of the present invention is to provide a Buchwaldoboletus xylophilus strain Wu3500, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on January 2, 2024, with the deposit number: GDMCC No: 64234.

[0008] In a second aspect, the present invention aims to provide protoplasts, spores, fruiting bodies or mycelium produced by the Suillus edulis strain Wu3500 as described in the first aspect.

[0009] In a third aspect, the present invention aims to provide a mushroom stick comprising the Suillus edulis strain Wu3500 as described in the first aspect or the protoplasts, spores, fruiting bodies or mycelium as described in the second aspect.

[0010] In a fourth aspect, the present invention aims to provide a food product comprising the Boletus edulis strain Wu3500 as described in the first aspect or the protoplasts, spores, fruiting bodies or mycelium as described in the second aspect. In an optional embodiment, the food product may be a nutrient, a condiment or an additive. In an optional embodiment, the food product may be a mushroom product.

[0011] In a fifth aspect, the present invention aims to provide a method for cultivating or breeding a Suillus edulis strain, the method comprising cultivating the Suillus edulis strain using the Suillus edulis strain Wu3500 as described in the first aspect or the protoplast, spore, fruiting body or mycelium as described in the second aspect. In a preferred embodiment, the breeding can be self-breeding or hybrid breeding.

[0012] In a sixth aspect, the present invention aims to provide a use of the Boletus edulis strain Wu3500 as described in the first aspect or the protoplasts, spores, fruiting bodies or mycelium as described in the second aspect in the production of food products. In an optional embodiment, the food product can be a nutrient, a condiment or an additive. In an optional embodiment, the food product can be a mushroom product.

[0013] In a specific embodiment, the Suillus edulis strain Wu3500 as described in the first aspect or the protoplasts, spores, fruiting bodies or mycelium as described in the second aspect may be included in the raw materials and / or finished products of the food product.

[0014] In the seventh aspect, the object of the present invention is to provide a molecular marker for detecting or identifying the Boletus edulis strain Wu3500 as described in the first aspect or the protoplasts, spores, fruiting bodies or mycelium as described in the second aspect, wherein the molecular marker is: BXW350, whose nucleotide sequence is shown in SEQ ID NO: 1; BXW200, whose nucleotide sequence is shown in SEQ ID NO: 2; or BXW260, whose nucleotide sequence is shown in SEQ ID NO: 3.

[0015] In a specific embodiment, when detecting or identifying the Boletus edulis strain Wu3500 as described in the first aspect or the protoplasts, spores, fruiting bodies or mycelium as described in the second aspect, any one, any two or all three of the molecular markers BXW350, BXW200 and BXW260 can be used, for example, molecular markers BXW350, BXW200, BXW260, BXW350 and BXW200, BXW350 and BXW260, BXW200 and BXW260, or BXW350, BXW200 and BXW260 can be used.

[0016] In the eighth aspect, the object of the present invention is to provide a primer for detecting or identifying the Boletus edulis strain Wu3500 as described in the first aspect or the protoplasts, spores, fruiting bodies or mycelium as described in the second aspect, the primers are primer pair BXW350_F / R, whose nucleotide sequence is shown in SEQ ID NO: 4 and 5; primer pair BXW200_F / R, whose nucleotide sequence is shown in SEQ ID NO: 6 and 7; or primer pair BXW260_F / R, whose nucleotide sequence is shown in SEQ ID NO: 8 and 9.

[0017] In a specific embodiment, when detecting or identifying the Boletus edulis strain Wu3500 as described in the first aspect or the protoplasts, spores, fruiting bodies or mycelium as described in the second aspect, any one, any two or all three of the primer pairs BXW350_F / R, BXW200_F / R and BXW260_F / R can be used, for example, the primer pairs BXW350_F / R, BXW200_F / R, BXW260_F / R, BXW350_F / R and BXW200_F / R, BXW350_F / R and BXW260_F / R, BXW200_F / R and BXW260_F / R, or BXW350_F / R, BXW200_F / R and BXW260_F / R can be used.

[0018] In a ninth aspect, the present invention aims to provide a kit for detecting or identifying the Boletus edulis strain Wu3500 as described in the first aspect or the protoplasts, spores, fruiting bodies or mycelium as described in the second aspect, wherein the kit comprises a reagent for detecting the molecular marker as described in the seventh aspect. In an optional embodiment, the kit comprises a primer as described in the eighth aspect.

[0019] In the tenth aspect, the object of the present invention is to provide a method for detecting or identifying the Suillus edulis strain Wu3500 as described in the first aspect or the protoplasts, spores, fruiting bodies or mycelium as described in the second aspect, using the DNA of the sample to be tested as a template and using the kit as described in the ninth aspect for detection.

[0020] In some embodiments, the method comprises using the DNA of the sample to be tested as a template, and using a kit comprising the primer pair BXW350_F / R to detect whether the sample to be tested contains the sequence BXW350. In other embodiments, the method comprises using the DNA of the sample to be tested as a template, and using a kit comprising the primer pair BXW200_F / R to detect whether the sample to be tested contains the sequence BXW200. In yet other embodiments, the method comprises using the DNA of the sample to be tested as a template, and using a kit comprising the primer pair BXW260_F / R to detect whether the sample to be tested contains the sequence BXW260.

[0021] Compared with the prior art, the technical solution of the present invention has the following advantages:

[0022] (1) The Boletus edulis strain of the present invention has a different genetic background, and has stable mushroom production and high mushroom yield. It only takes 25 to 30 days to produce cultivars, which greatly shortens the cultivation cycle and is conducive to reducing costs in large-scale production.

[0023] (2) The present invention invents a method for developing specific molecular markers for the Boletus edulis strain Wu3500 using shallow genome sequencing technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] FIG1 shows the amplification results of strain Wu3500-specific sequences BXW350, BXW200 and BXW260 in different strains. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments.

[0026] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work shall fall within the scope of protection of the present invention.

[0027] The technical solution of the present invention is further illustrated below through specific implementation methods.

[0028] Except for the Suillus edulis strain, the reagents and equipment used in the examples are all conventional products that can be purchased commercially.

[0029] Example 1: Breeding of strain Wu3500

[0030] The breeding process of strain Wu3500 includes the following steps:

[0031] (1) Collect young fruiting bodies of Boletus edulis from Conghua District, Guangzhou City, Guangdong Province, China;

[0032] (2) Clean the surface debris. On a sterile clean bench, break the fruiting body into two halves by hand, and use a sterilized surgical blade to cut a 3-7 mm square of tissue from the mushroom flesh at the junction of the cap and the stipe;

[0033] (3) The tissue blocks were placed in a mother culture medium (conventional PDA solid culture medium, formula: 200 g potato (water-boiled extract), 20.0 g glucose, distilled water to 1000 mL, 16.0 g agar, pH natural), and cultured in a constant temperature incubator at 24-28° C. in the dark for 2 weeks. The plate was activated to obtain the mother strain of Boletus edulis.

[0034] Example 2 Species taxonomic molecular identification of strain Wu3500

[0035] (1) Preparation of genomic DNA: A tissue block of 3 to 5 mm in size was cut from the dried fruiting body of Boletus edulis Wu3500, and genomic DNA from the tissue block was extracted by a modified CTAB method, which specifically includes the following steps:

[0036] <1> Take an appropriate amount of molecular materials or fresh samples in a 1.5mL centrifuge tube. Add a small amount of quartz sand and PVP (polyvinyl pyrrolidone) and quickly freeze-dry in liquid nitrogen. After fully grinding with a sterilized grinding rod, take 750μl of 4×CTAB (hexadecyltrimethylammonium bromide) preheated at 65℃ into a centrifuge tube, put it in a 65℃ water bath for 1.5-2h, and gently mix it every 30min.

[0037] <2> Take out the centrifuge tube from the water bath, cool it to room temperature, add 750 μl of phenol-chloroform-isoamyl alcohol mixture [phenol: chloroform: isoamyl alcohol = 25:24:1], shake it thoroughly for 3-5 minutes, place it in a centrifuge, and centrifuge it at 12000 rpm for 10 minutes at room temperature.

[0038] <3> Use a pipette to remove the supernatant from the centrifuge tube and transfer it to a new 1.5 mL centrifuge tube. Add an equal volume of chloroform-isoamyl alcohol [chloroform:isoamyl alcohol = 24:1], shake thoroughly for 3-5 minutes, place in a centrifuge, and centrifuge at 12000 rpm for 10 minutes at room temperature.

[0039] <4> Use a pipette to remove the supernatant from the centrifuge tube and transfer it to a new 1.5 mL centrifuge tube. Add an equal volume of chloroform-isoamyl alcohol [chloroform:isoamyl alcohol = 24:1], shake thoroughly for 3-5 minutes, place in a centrifuge, and centrifuge at 12000 rpm for 10 minutes at room temperature.

[0040] <5> Use a pipette to remove the supernatant from the centrifuge tube and transfer it to a new 1.5 mL centrifuge tube. Add 2 / 3 volume of isoamyl alcohol, mix gently, place at -20°C, and let settle for 12-24 hours.

[0041] <6> Take out the centrifuge tube and let it cool to room temperature. Place it in a centrifuge and centrifuge at 12000 rpm for 5 minutes at room temperature, and discard the supernatant.

[0042] <7> Add 400 μl of 70% ethanol, shake gently, centrifuge at 12,000 rpm for 5 min at room temperature, and discard the supernatant.

[0043] <8> Add 400 μl of 70% ethanol, shake gently, centrifuge at 12,000 rpm for 5 min at room temperature, and discard the supernatant.

[0044] <9> Add 400 μl of anhydrous ethanol, shake gently, centrifuge at 12000 rpm for 5 min at room temperature, and discard the supernatant.

[0045] <10> After inverting the centrifuge tube on clean absorbent paper, place it in a 37°C incubator with the lid open to dry and allow the anhydrous ethanol to fully evaporate.

[0046] <11> Dissolve the DNA in 150-200 μl double distilled water and store it at -20°C until it is completely dissolved.

[0047] (2) PCR amplification and sequencing: Use ITS primers (ITS1F:

[0048] CTTGGTCATTTAGAGGAAGTAA, SEQ ID NO: 11; ITS4: TCCTCCGCTTATTGATATGC, SEQ ID NO: 12), and the above DNA samples were amplified by PCR.

[0049] PCR amplification was performed in a 25 μl reaction system: 12.5 μl of PCR Taq Plus MasterMix with dye, 1-2 μl of DNA template (the dosage was determined according to the actual concentration of the template), 1 μl of each forward and reverse primer (10 μM), and finally the volume was fixed to 25 μl with double deionized water (ddH2O). PCR amplification reactions were performed on an ABI 2720 Thermal Cycler (Applied Biosystem, Foster City CA, USA).

[0050] The PCR amplification reaction program was 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, annealing temperature of 53°C, annealing time of 40 s, and extension time of 72°C for 1 min. The cycle was repeated 35 times; the final extension was 72°C for 8 min, and the sample was cooled to 4°C for storage.

[0051] The PCR amplification product was detected by 1% agarose gel and then Sanger sequencing was performed to obtain a DNA sequence shown in SEQ ID NO: 10.

[0052] (3) Sequence comparison: Blast comparison of the NCBI GenBank database showed that the ITS sequence of Wu3500 was 99.85% similar to that of Boletus edulis collected from Xishuangbanna, Yunnan (specimen certificate number FHMU5930, strain number BU001, deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration, deposit number: CGMCC No. 21959, GenBank accession number MW783439); the ITS similarity with Boletus edulis FHMU5933 from the same origin was 100%; and the ITS similarity with Boletus edulis SL2087 from Singapore was 100%. Combined with the research results of Xie et al. (2021), the strain was identified as a Boletus edulis strain.

[0053] Example 3 Development of specific molecular markers for Boletus edulis strain Wu3500

[0054] (1) Whole genome sequencing

[0055] Three strains or specimens of Boletus edulis from different origins were selected: Wu3500 (Guangdong, strain of the present application), FHMU5848 (Hainan), and FHMU 5930 (i.e., BU001, Yunnan). Their genomic DNA was extracted and sequenced based on the MGI DNBSEQ-T7 platform, with a sequencing volume of 3G / sample.

[0056] (2) Screening of strain differential sequences

[0057] <1> For the fastq raw data after sequencing, fastp was used to perform data quality control based on default parameters.

[0058] <2> After obtaining high-quality fastq sequencing data, SPAdes software was used to assemble the genome based on default parameters, and then BUSCO was used to assess the quality of the genome assembly.

[0059] <3> After obtaining the assembled genome data, the strain-specific nucleic acid sequences BXW350, BXW200, and BXW260 were screened out using the Genome VarScan plug-in mounted on the TBtools software. The sequence of BXW350 is shown in SEQ ID NO: 1; the sequence of BXW200 is shown in SEQ ID NO: 2; and the sequence of BXW260 is shown in SEQ ID NO: 3.

[0060] <4> Design primers for PCR amplification

[0061] The BXW350 primers were designed as follows:

[0062] BXW350_F:cgcagaatgatcacccacct (SEQ ID NO: 4, Tm value 57.78℃)

[0063] BXW350_R: tccgccatttggatctgctt (SEQ ID NO: 5, Tm value 57.16°C)

[0064] The BXW200 primers were designed as follows:

[0065] BXW200_F:cagagcctaccaacctgagc (SEQ ID NO: 6, Tm value 58.42°C)

[0066] BXW200_R: tcttctcaagtgcttccacga (SEQ ID NO: 7, Tm value 55.91°C)

[0067] The BXW260 primers were designed as follows:

[0068] BXW260_F: acccctgcctcataccctcg (SEQ ID NO: 8, Tm value 60.68℃)

[0069] BXW260_R:tacgccttggcaggttcc (SEQ ID NO: 9, Tm value 59.57℃)

[0070] Conventional PCR amplification was performed using the above primers, and the amplified product was detected by 1% agarose gel and then Sanger sequencing was performed.

[0071] PCR amplification was performed in a 25 μl reaction system: 12.5 μl of PCR Taq Plus MasterMix with dye, 1-2 μl of DNA template (the dosage was determined according to the actual concentration of the template), 1 μl of each forward and reverse primer (10 μM), and finally the volume was fixed to 25 μl with double deionized water (ddH2O). PCR amplification reactions were performed on an ABI 2720 Thermal Cycler (Applied Biosystem, Foster City CA, USA).

[0072] The PCR amplification reaction program was 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, annealing temperature of 53°C, annealing time of 40 s, and extension time of 72°C for 1 min. The cycle was repeated 35 times; the final extension was 72°C for 8 min, and the sample was cooled to 4°C for storage.

[0073] Agarose gel test results ( Figure 1A , Figure 1B and Figure 1C ) showed that BXW350, BXW200, and BXW260 of strain Wu3500 were successfully amplified and detected, while strain BU001 (=FHMU 5930) failed to successfully amplify BXW350, BXW200, and BXW260. Therefore, BXW350, BXW200, and BXW260 were regarded as specific DNA sequences unique to strain Wu3500.

[0074] Example 4 Artificial bottling of strain Wu3500 .

[0075] (1) Preparation of shake flask liquid culture: Use PDB liquid culture medium (formula: 200g potato (water-boiled extract), 20.0g glucose, distilled water to 1000mL, pH natural), put the prepared culture medium into 500ml Erlenmeyer flasks, 300-400ml per bottle, and sterilize by high pressure. Then, the mother culture mycelium is broken and inoculated into the liquid culture medium, and placed in a constant temperature rotary oscillator for 6-7 days, with an oscillation frequency of 150r / min-180r / min, a culture temperature of 28±1℃, and dark light culture.

[0076] (2) Preparation of cultivars: Grains, sawdust and soil are mixed evenly in a certain proportion, magnesium sulfate and potassium dihydrogen phosphate are dissolved in water at a ratio of 0.1% (w / w) of the culture medium, and then evenly mixed into the pile of materials, and then fully stirred, and water is added to make the water content of the culture medium reach about 50.0% to 70%, and the pH value is 4.0 to 5.0. The liquid strain in the shake bottle is inoculated into the sterilized cultivars, and cultured at 28±1°C in the dark for 25 to 30 days, and the mycelium will fill the cultivar, and the cultivars are obtained.

[0077] (3) Covering the soil for mushroom production: Use peat soil to cover the above-mentioned cultivars for mushroom production. After 10 to 15 days of covering the soil, they can be harvested.

[0078] As shown in Table 1, after multiple batches of cultivation experiments, it was verified that Boletus edulis has stable production properties, a high mushroom yield, an average yield of more than 130g, and is suitable for large-scale artificial cultivation.

[0079] Table 1 Results of artificial cultivation test of strains

[0080]

[0081]

[0082] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions in the specification are only to illustrate the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and these changes and improvements fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A Buchwaldoboletus xylophilus strain Wu3500, characterized in that: The strain Wu3500 was deposited in Guangdong Provincial Microbiological Culture Collection Center on January 2, 2024, with the deposit number: GDMCC No: 64234.

2. The protoplasts, spores, fruiting bodies or mycelium produced by the Suillus edulis strain Wu3500 as claimed in claim 1.

3. A mushroom log comprising the Boletus edulis strain Wu3500 according to claim 1 or the protoplasts, spores, fruiting bodies or mycelium according to claim 2.

4. A food product comprising the Suillus edulis strain Wu3500 according to claim 1 or the protoplasts, spores, fruiting bodies or mycelium according to claim 2.

5. The food product according to claim 4, characterized in that The food product is a nutrient, a condiment, an additive or a mushroom product.

6. A method for cultivating Boletus edulis, characterized in that: The method comprises cultivating Boletus edulis using the Boletus edulis strain Wu3500 as claimed in claim 1 or the protoplasts, spores, fruiting bodies or mycelium as claimed in claim 2.

7. A method for breeding Boletus edulis, characterized in that: The method comprises breeding Boletus edulis using the Boletus edulis strain Wu3500 as claimed in claim 1 or the protoplasts, spores, fruiting bodies or mycelium as claimed in claim 2, and the breeding is self-breeding or hybrid breeding.

8. Use of the Suillus edulis strain Wu3500 according to claim 1 or the protoplasts, spores, fruiting bodies or mycelium according to claim 2 in the production of food products.

9. The use according to claim 8, characterized in that The food product is a nutrient, a condiment, an additive or a mushroom product.

10. The use according to claim 8 or 9, characterized in that: The Suillus edulis strain Wu3500 as described in claim 1 or the protoplasts, spores, fruiting bodies or mycelium as described in claim 2 are included in the raw materials and / or finished products of the food product.

11. A molecular marker for detecting or identifying the Boletus edulis strain Wu3500 according to claim 1 or the protoplast, spore, fruiting body or mycelium according to claim 2, characterized in that: The molecular marker is: BXW350, and its nucleotide sequence is shown in SEQ ID NO: 1; and / or BXW200, the nucleotide sequence of which is shown in SEQ ID NO: 2; and / or BXW260, the nucleotide sequence of which is shown in SEQ ID NO:

3.

12. A primer for detecting or identifying the Suillus edulis strain Wu3500 according to claim 1 or the protoplast, spore, fruiting body or mycelium according to claim 2, characterized in that: The primers are primer pair BXW350_F / R, and the nucleotide sequences thereof are shown in SEQ ID NOs: 4 and 5; and / or the primers are primer pair BXW200_F / R, the nucleotide sequences of which are shown in SEQ ID NOs: 6 and 7; And / or the primer is a primer pair BXW260_F / R, whose nucleotide sequences are shown in SEQ ID NOs: 8 and 9.

13. A kit for detecting or identifying the Suillus edulis strain Wu3500 according to claim 1 or the protoplasts, spores, fruiting bodies or mycelium according to claim 2, wherein the kit comprises the primers according to claim 12.

14. A method for detecting or identifying the Suillus edulis strain Wu3500 according to claim 1 or the protoplasts, spores, fruiting bodies or mycelium according to claim 2, characterized in that: The test sample DNA is used as a template and the test kit as claimed in claim 13 is used for detection.

Images