Nucleic acid, nucleic acid combination, primer pair combination and application thereof

Abstract

The invention discloses a nucleic acid, a nucleic acid combination, a primer pair combination and application thereof. The nucleic acid sequentially comprises a forward specific sequence, an enzyme digestion sequence and a reverse specific sequence from the 5'end to the 3 'end. The invention also discloses a nucleic acid combination, a primer pair combination, a method for preparing the nucleic acid or the nucleic acid combination, and a kit. The invention also discloses a method for reducing primer dimers in a multiplex PCR system, a method for identifying microorganisms, and application of any one or more of the nucleic acid, the combination of the nucleic acid, the combination of the primer pair and the kit in microorganism identification. According to the nucleic acid, the nucleic acid combination, the primer pair combination and the application thereof, generation of primer dimers can be greatly reduced, cost control is facilitated, tedious operation steps are reduced, and the nucleic acid, the nucleic acid combination, the primer pair combination and the application have good application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to a nucleic acid, a combination of nucleic acids, a combination of primer pairs and applications thereof. Background Art

[0002] Multiplex PCR amplification technology can simultaneously amplify more DNA nucleic acid fragments than conventional PCR can handle in a single reaction. This technology is suitable for situations where a large number of target sequences need to be detected, such as pathogen detection, genetic variation analysis, and genotype identification. Multiplex PCR amplification generally adds no less than 2 pairs of primers to a reaction tube and performs PCR reactions at the same time; the number of primer pairs generally ranges from dozens to hundreds or thousands. With so many primers concentrated in one tube for reaction, problems such as primer dimers and non-specific amplification pose great challenges to multiplex PCR amplification. Therefore, how to effectively avoid primer dimers and improve the efficiency of multiplex PCR amplification is the focus of current research in the methodology of multiplex PCR technology.

[0003] The rhAmp PCR technology developed by Integrated DNA Technologies (IDT) in the United States uses rhAmp primers with RNA bases to perform multiple PCR amplification on the target region. RNase H2 performs targeted cleavage and release of RNA bases in the DNA:RNA hybrid double strand, and the 3' end blocking sequence activates the rhAmp primer. RNase H2 is highly specific and only cuts RNA bases that are completely complementary and matched, which can reduce nonspecific hybridization and primer dimers and improve the success rate of multiple PCR amplification. However, the cost of its primer synthesis is relatively high. In addition, there are literature reports that in multiple PCR experiments, U bases are introduced into primers, and after amplification, UDG and other mixed enzymes are used to digest excess primers; the amplified fragments do not contain U bases because they are synthesized with normal NTPs, and excessive primers will be cut by UDG and other mixed enzymes because they contain U bases, which can achieve the effect of eliminating primer dimers. However, UDG and other mixed enzymes will be added during the experiment, and the purchase cost of multiple enzymes is relatively high, and the experimental operation is also cumbersome.

[0004] Therefore, it is necessary to develop a low-cost and efficient multiplex PCR method to achieve the goal of reducing primer dimers. Summary of the invention

[0005] Because the methods for avoiding primer dimers in multiplex PCR amplification in the prior art have the disadvantages of high cost and cumbersome operation, the present invention provides a nucleic acid, a combination of nucleic acids, a combination of primer pairs and applications thereof, which can reduce primer dimer formation and improve multiplex PCR amplification efficiency at low cost and high efficiency.

[0006] The technical idea of ​​the present invention is as follows Figure 1 As shown, it is divided into 2 rounds of PCR amplification, the first round of PCR amplification is used to enrich the target product, wherein the amplified library fragment (containing a 20bp specific cutting sequence that can be specifically recognized by the cas9 protein) is optimized and designed, and the amplified library fragment can specifically bind to the redundant primers, which can significantly reduce the possibility of non-target primers forming primer dimers and producing non-specific amplification in the multiple PCR amplification reaction; then the cas9 protein is used to specifically cut the amplified library sequence, and the required target product is specifically retained; then after the second round of PCR amplification, the target product is added with a linker sequence that can identify the sample, and the formed complete library can be used for sequencing on the machine. This method can greatly reduce the dimer product and improve the efficiency of multiple PCR amplification. The preparation of the amplified library adopts an optimized plasmid synthesis method, which can produce the required amplified library efficiently and at low cost.

[0007] The present invention solves the above technical problems through the following technical solutions.

[0008] The first aspect of the present invention provides an isolated nucleic acid, characterized in that the nucleic acid comprises, in order from the 5' end to the 3' end: a forward specific sequence, an enzyme cleavage sequence and a reverse specific sequence;

[0009] The nucleotide sequence of the forward specific sequence is selected from any one of the following tables:

[0010]

[0011]

[0012]

[0013]

[0014]

[0015] and / or,

[0016] The reverse specific sequence is selected from any one of the following table:

[0017]

[0018]

[0019]

[0020]

[0021]

[0022] The genome or gene sequence corresponding to the NCBI Gene ID in the above table can be retrieved through the National Center for Biotechnology Information (NCBI), and the nucleotide sequence of the forward specific sequence is the nucleotide sequence from "the starting site of the sequence corresponding to the NCBI Gene ID of the forward specific sequence" to "the ending site of the sequence corresponding to the NCBI Gene ID of the forward specific sequence" on the corresponding genome or gene sequence. For example, according to the above table, the nucleotide sequence of the forward specific sequence can be the 147th to 166th nucleotides in the full-length genome sequence obtained by searching "CDFH01096962.1" on NCBI. The reverse specific sequence in the present invention is also obtained by the same method.

[0023] In some embodiments of the present invention, the cleavage sequence comprises a target sequence that can be recognized and cleaved by a Cas protein, and the Cas protein is, for example, a Cas9 protein;

[0024] In some preferred embodiments of the present invention, the restriction enzyme sequence also satisfies one or both of the following conditions:

[0025] (1) the target sequence comprises a PAM sequence, such as CGG; the target sequence preferably comprises a nucleotide sequence as shown in SEQ ID NO: 4; and,

[0026] (2) The 5' end of the restriction enzyme sequence comprises a forward universal sequence, and / or the 3' end of the restriction enzyme sequence comprises a sequence that is reverse complementary to the reverse universal sequence; the forward universal sequence comprises the nucleotide sequence shown in SEQ ID NO: 2, and / or the reverse universal sequence comprises the nucleotide sequence shown in SEQ ID NO: 3;

[0027] In some more preferred embodiments of the present invention, the enzyme cleavage sequence comprises the nucleotide sequence shown in SEQ ID NO:1.

[0028] The second aspect of the present invention provides a combination of nucleic acids, wherein the combination comprises two or more nucleic acids as described in the first aspect.

[0029] "Multiple" refers to more than two, for example, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 150 or 200. Those skilled in the art can select two or more nucleic acids from the nucleic acids provided in the first aspect of the present invention for detection according to the specific target microbial species and amplification purpose.

[0030] The third aspect of the present invention provides a combination of primer pairs, the combination comprising two or more pairs of primer pairs, the primer pairs comprising forward primers and reverse primers, the forward primer comprising a forward specific sequence and a forward universal sequence from the 5' end to the 3' end, the reverse primer comprising a sequence that is reverse complementary to the reverse specific sequence and a reverse universal sequence from the 5' end to the 3' end; the forward specific sequence and / or the reverse specific sequence are defined in the nucleic acid described in the first aspect.

[0031] In the present invention, "multiple pairs" refers to more than two pairs, for example, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 150 or 200 pairs. Those skilled in the art can select two or more pairs of primer pairs for detection according to the specific target microorganism species and amplification purpose.

[0032] In some embodiments of the present invention, the forward universal sequence comprises the nucleotide sequence shown in SEQ ID NO:2, and / or the reverse universal sequence comprises the nucleotide sequence shown in SEQ ID NO:3.

[0033] The fourth aspect of the present invention provides a combination of primer pairs, the combination comprising two or more pairs of primer pairs, the primer pairs comprising forward primers and reverse primers, the forward primer comprising a forward specific sequence, the reverse primer comprising a sequence that is reverse complementary to the reverse specific sequence; the forward specific sequence and / or the reverse specific sequence are defined in the nucleic acid described in the first aspect.

[0034] The nucleic acid described in the first aspect of the present invention corresponds to the nucleic acid contained in the "amplification library" in the embodiment, which is a double-stranded DNA, so the sequence of one of the positive chains is defined, and the specific sequences at both ends are taken from the sequence with NCBI Gene ID "CDFH01096962.1" as an example, and the forward specific sequence and the reverse specific sequence in the positive chain are respectively consistent with the sequences of positions 147 to 166 and positions 329 to 348 of CDFH01096962.1; the combination of primer pairs described in the third aspect of the present invention (corresponding to the combination of "amplification primers for amplification library" in the embodiment) and the combination of primer pairs described in the fourth aspect (corresponding to the "primer panel" in the embodiment) are both single-stranded DNA, with the specific sequence coming from NCBI Gene Taking the sequence with ID "CDFH01096962.1" as an example, the forward specific fragment of their forward primers is consistent with the sequence of positions 147 to 166 of CDFH01096962.1, but the reverse specific fragment is the reverse complementary pairing sequence of the sequence of positions 329 to 348 of CDFH01096962.1.

[0035] The fifth aspect of the present invention provides a method for preparing the nucleic acid as described in the first aspect or the combination as described in the second aspect, the method comprising using a vector containing the restriction sequence defined in the nucleic acid as described in the second aspect as a template, and using the combination of primer pairs as described in the third aspect for PCR amplification.

[0036] In some embodiments of the present invention, the backbone of the vector is Puc57.

[0037] The sixth aspect of the present invention provides a kit, which comprises one or more selected from the nucleic acid as described in the first aspect, the combination as described in the second aspect and the combination of primer pairs as described in the fourth aspect.

[0038] In some embodiments of the present invention, the kit further comprises a Cas protein, such as a Cas9 protein, and / or a gRNA, wherein the gRNA comprises a specific recognition and cleavage sequence, wherein the specific recognition and cleavage sequence comprises a nucleotide sequence as shown in the target sequence defined in the nucleic acid described in the first aspect; and / or, the kit further comprises reagents for high-throughput sequencing, such as a sequencing adapter primer pair.

[0039] In some preferred embodiments of the present invention, the gRNA further comprises a backbone sequence, wherein the backbone sequence is located at the 3' end of the specific recognition and cleavage sequence, and the backbone sequence preferably comprises a sequence as shown in SEQ ID NO:7.

[0040] In some specific embodiments of the present invention, one, two or three bases at the 5' end and / or the 3' end of the gRNA further contain a 2'-O-methyl modification.

[0041] The seventh aspect of the present invention provides a method for reducing primer dimers in a multiplex PCR system, the method comprising adding an amplification library to the multiplex PCR system, the nucleic acid contained in the amplification library comprising, from the 5' end to the 3' end, a forward specific sequence, an enzyme cleavage sequence and a reverse specific sequence, the forward specific sequence and the reverse specific sequence being capable of complementary pairing with multiple primers in the multiplex PCR system, and the enzyme cleavage sequence being defined in the nucleic acid described in the first aspect.

[0042] In the present invention, the "reduction" refers to adding the amplification library to the multiplex PCR system to specifically bind to the excess multiple primers in the PCR system through complementary base pairing, thereby reducing primer dimers formed by non-target primers in the multiplex PCR amplification reaction compared to the multiplex PCR system to which the amplification library is not added.

[0043] In some embodiments of the present invention, the multiple primers are a combination of primer pairs as described in the fourth aspect; preferably, the amplification library is a combination of nucleic acids as described in the second aspect.

[0044] In some preferred embodiments of the present invention, the method further comprises enzymatically cleaving the amplified product using the CRISPR / Cas system, preferably the Cas protein in the CRISPR / Cas system is a Cas9 protein, and / or the gRNA in the CRISPR / Cas system is as defined in the kit described in the sixth aspect.

[0045] In some specific embodiments of the present invention, in the multiplex PCR system, the added amount of the amplified library is 3 ng / μL-8 ng / μL, for example, 5 ng / μL, and / or the working concentration of the multiple primers in the multiplex PCR system is 0.0012 pmol / μL-0.012 pmol / μL, for example, 0.0048 pmol / μL.

[0046] An eighth aspect of the present invention provides a method for identifying microorganisms, the method comprising amplifying a sample to be tested using the method described in the seventh aspect.

[0047] In some embodiments of the present invention, the method further comprises the step of identifying the product after enzyme cleavage and analyzing the type of microorganisms in the sample to be tested.

[0048] In some preferred embodiments of the present invention, the identification is high-throughput sequencing.

[0049] In some embodiments of the present invention, the identification includes the step of connecting the product after enzyme cleavage with a sequencing adapter primer sequence to obtain a sequence to be sequenced.

[0050] In some embodiments of the present invention, the linker primer sequence comprises an upstream linker primer as shown in SEQ ID NO:5, the 5' end of the upstream linker primer preferably comprises a phosphorylation modification, and / or comprises a downstream linker primer as shown in SEQ ID NO:6.

[0051] In some embodiments of the present invention, the method is for non-diagnostic purposes; and / or, the microorganism is a pathogenic microorganism.

[0052] The ninth aspect of the present invention provides the use of any one or more of the nucleic acids as described in the first aspect, the combination of nucleic acids as described in the second aspect, the combination of primer pairs as described in the third aspect, the combination of primer pairs as described in the fourth aspect, and the kit as described in the sixth aspect in identifying microorganisms.

[0053] In some embodiments of the present invention, the application is for non-diagnostic purposes; and / or, the microorganism is a pathogenic microorganism.

[0054] In the present invention, the application scenarios of "non-diagnostic purposes" include but are not limited to identifying which microorganisms are contained in the test sample for scientific research purposes in the laboratory. The "test sample" can come from the human body or other animal body, or from the surface or inside of a non-biological body, such as the surface or inside of a solid (such as a medical device), or a liquid (such as a water source to be tested).

[0055] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0056] The reagents and raw materials used in the present invention are commercially available.

[0057] The positive and progressive effects of the present invention are:

[0058] 1. Use low-cost amplified library sequences combined with specific primers to reduce the generation of dimers.

[0059] The amplification library sequence preparation method is as follows Figure 2 As shown, a universal artificial sequence is designed and sent out for synthesis as a vector. Puc57 can be selected as the vector backbone, and the fragment is used as a template for the amplified library sequence. Then, primers containing sequences specific to different bacteria or target products are designed. The primers include two parts: a bacteria-specific sequence (used to bind to the primer part) and a universal template sequence; finally, the primers are used to amplify the above template to obtain an amplified library fragment library. Because the amplified library fragment contains a binding part for a specific primer, during the PCR process, by adding an appropriate amount of amplified library fragments, the primers can be adsorbed to reduce the generation of primer dimers and non-specific amplified products. At the same time, this method only synthesizes one vector, and the rest are amplified using primers to obtain the amplified library sequence, so its production cost is extremely low, and it can be produced and prepared in batches at low cost.

[0060] Only one vector (costing less than 300 yuan) is used, and amplification primers (bacteria-specific sequences and universal template sequences) are designed to amplify the vector and prepare an amplification library (adsorbed dimer). The cost of using the amplification library is less than 0.001 yuan per time, and different amplification libraries can be prepared according to different usage requirements, which is low-cost and flexible to use.

[0061] 2. Improved PCR efficiency

[0062] This method uses the specific cutting property of Cas9 to design a 20bp specific Cas9 cutting site in the universal fragment of the amplified library. After the first round of PCR amplification is completed, the amplified library adsorbs primers to reduce the production of dimers. In order to prevent the amplified library from occupying too much data and compress the sequencing data volume of the target fragment, the specific cutting of Cas9 can achieve specific removal of the amplified library fragment, improve the detection rate of the target product, and reduce the sequencing cost. The use of Cas9 protein to specifically remove the amplified library has no effect on the target fragment.

[0063] The method provided by the present invention is different from the conventional method. In terms of multiplex PCR amplification, it is conventional to think that (1) first of all, primer dimers should be avoided as much as possible in the design, but there are too many primers in the multiplex PCR system, and primer dimers are inevitable in the design process; (2) changes are made to the primer structure to avoid dimers, such as using a "U-shaped" primer structure; (3) or base modification is performed at the 3' end of the primer, and then RNase H2 releases the 3' end block during amplification, but the cost of synthesizing the special modified primer panel is too high. This method can significantly reduce the production of dimers during the amplification process by introducing an intermediate-amplification library, and then reduce dimers from the source through the specially designed Cas9 recognition and cutting sequence. At the same time, the operation is simple, and the two-round amplification time is short. Can it better meet the timeliness requirements in the field of pathogenic microorganism detection?

[0064] In the present invention, because the upstream and downstream primers contain some universal amplification sequences of the vector, the same KZ-CAS9-XG vector is amplified, and non-paired library sequences may appear, but the results will not be affected. Because when preparing the amplified library, the ratio of each primer in the mixed primer input is consistent, due to the presence of universal primers, the diversity of product molecules during amplification will not be greatly affected, and the amplified library will be excised subsequently, and will not enter the sequencing stage. At the same time, this method also saves the cost of the amplified vector (only one vector template needs to be prepared), greatly saves costs, and is more suitable for product production conversion.

[0065] In summary, the nucleic acid, the combination of nucleic acid, the combination of primer pairs and their applications provided by the present invention can be used to achieve low-cost and efficient multiplex PCR, by preparing an amplification library at low cost, and using the amplification library to adsorb redundant primers, thereby achieving the goal of reducing primer dimers; In addition, in order to prevent the amplification library from occupying too much sequencing data, the amplification library is specifically removed by the Cas9 protein of the gene editing method, thereby achieving efficient detection of the target product. Therefore, the nucleic acid, the combination of nucleic acid, the combination of primer pairs and their applications provided by the present invention can greatly reduce the generation of primer dimers, help control costs, reduce cumbersome operating steps, and have good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 Schematic diagram of the process of testing and sequencing using amplified libraries (taking the Illumina platform as an example).

[0067] Figure 2 Schematic diagram of the construction of the amplification library. DETAILED DESCRIPTION

[0068] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0069] Example 1 Preparation of amplified library sequences

[0070] Design a universal amplification library sequence, named KZ-CAS9-XG as follows; randomly design a fragment with a size close to the real amplicon, and then perform blast comparison in NCBI to ensure that there is no artificially designed fragment. The fragment size is 248bp, and a 20 bp Cas9 cutting sequence and a 3 bp PAM region recognition site (cgg) are introduced into the fragment. The designed KZ-CAS9-XG fragment is sent to Beijing Qingke Biotechnology Co., Ltd. for synthesis into a vector. Puc57 can be selected as the vector backbone, and the vector is used as a template for the amplification library sequence.

[0071] >KZ-CAS9-XG

[0072]

[0073] Note: The bold and underlined parts of the sequence are the cas9 recognition and cleavage sequences (including the PAM sequence).

[0074] Design the universal primer fragments of the vector, zaiti-F: 5'-GCTTGTGTCCCAACAGGC-3' (SEQ ID NO: 2), zaiti-R: 5'-AATATAGGATCGGACAGCCC-3' (SEQ ID NO: 3). Through multiple PCR primer design, 200 pairs of pathogen-specific primer fragments were selected to form a primer set (Table 1). Then the universal primer fragments of the vector (SEQ ID NO: 2 and SEQ ID NO: 3) were combined with these specific fragments (the forward universal primer zaiti-F was connected to the forward specific primer, and the reverse universal primer zaiti-R was connected to the reverse specific primer). The universal fragment was connected to the 3' end of the specific fragment and designed into a complete amplification library amplification primer (that is, the 5' to 3' end was sequentially connected to the specific primer fragment and the universal primer fragment of the vector), and the designed primers were sent to a primer synthesis company for synthesis. After the synthesis is completed, equal concentrations are mixed to prepare a primer mix, and the amplification reaction is further performed using the KZ-CAS9-XG vector as a template to prepare an amplification library.

[0075] Table 1 Specific primer sequences and amplification efficiencies in the primer set

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087] The experimental system configuration is shown in Table 2:

[0088] Table 2 Experimental system preparation

[0089] Reagents volume Amplification enzyme 2× 25μL Primer mix (0.5 μM) 3μL KZ-CAS9-XG vector (2ng / μL) 5μL Enzyme-free sterile water Add to 50 μL

[0090] In the system described in Table 2, the amplification enzyme was purchased from Nanjing Vazyme Biotech Co., Ltd. with the catalog number Vazyme#NA301.

[0091] The amplification program is shown in Table 3:

[0092] Table 3 PCR amplification program

[0093]

[0094] After PCR is completed, the product is purified and sorted. The sorting steps are as follows:

[0095] (1) Take out VAHTS DNA Clean Beads (purchased from Nanjing Novozyme Biotechnology Co., Ltd., catalog number: N411-03) from 2-8°C 30 min in advance and let it stand to balance to room temperature. Prepare 80% ethanol.

[0096] (2) Invert or vortex to mix the magnetic bead solution thoroughly, then add the corresponding volume (0.8×) of sorting magnetic beads to the PCR product, centrifuge for 3 seconds, and vortex or pipette 10 times to mix.

[0097] (3) Combine at room temperature for 5 minutes.

[0098] (4) Take a new PCR tube and add the corresponding volume (0.2×) of sorting magnetic beads to it for later use. Centrifuge the centrifuge tube in step (3) for about 3 seconds and place it on a magnetic rack. After the solution is clear (>2 minutes), carefully transfer the supernatant to the PCR tube with (0.2×) sorting magnetic beads added, centrifuge for 3 seconds, and vortex or pipette 10 times to mix.

[0099] (6) Combine at room temperature for 5 minutes.

[0100] (7) Centrifuge the PCR tube for about 3 seconds and place it on a magnetic rack. After the solution is clear (> 2 minutes), carefully remove the supernatant.

[0101] (8) Keep the centrifuge tube in the magnetic rack and add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads. Let it stand at room temperature for 30 seconds and carefully remove the supernatant.

[0102] (9) Repeat step (8).

[0103] (10) Keep the centrifuge tube on the magnetic rack at all times, open the lid and let the magnetic beads dry at room temperature until cracks just appear (about 2 minutes).

[0104] (11) Remove the centrifuge tube from the magnetic rack, add an appropriate amount of enzyme-free sterile water (≥30 μL), vortex or use a pipette to gently blow to mix thoroughly, let it stand at room temperature for 5 min, and then let it stand on the magnetic rack for 5 min. After the solution is clarified, carefully pipette the supernatant into a clean tube to complete the product purification and sorting.

[0105] After purification, the concentration was measured using a qubit fluorometer (Thermo Fisher Scientific) and placed at -20°C for later use. Finally, the prepared amplified library sequence (any one) included a forward primer selected from Table 1, a sequence shown in SEQ ID NO: 1, and a reverse primer selected from Table 1 in order from the 5' end to the 3' end. Figure 2 As shown, the sequences in the amplified library all contain specific target bacterial sequences and cleavage sites specifically recognized by Cas9.

[0106] Example 2 Multiplex PCR Experiment Verification and Comparison

[0107] The multiplex PCR experiment process is as follows Figure 1 shown.

[0108] (I) Effect verification using 11 standard strains

[0109] Eleven standard strains (see Table 4 for strain information) were selected to prepare DNA as test templates.

[0110] Table 4 11 standard strains from which DNA was extracted as test templates

[0111]

[0112]

[0113] The DNA of each bacterium was mixed and reserved according to 1000 copies, and the gRNA was synthesized by Qingke Biotechnology. The specific recognition and cleavage sequence gacactaattgcctctgcca (SEQ ID NO: 4) designed by the present invention was constructed at the 5' end of 5'-GUUUUAGAGCUA GAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCAC CGAGUCGGUGCUUUU-3' (SEQ ID NO: 7) to obtain cas9 sgRNAoligo, and further 2'-O-methyl modification was added to the 5' and 3' end 3 bases of cas9 sgRNA oligo. The purpose of adding modification is to ensure the stability of RNA and prevent degradation by nucleases in cells, thereby enhancing the durability and editing efficiency of gRNA. Cas9 protein comes from spCas9-gRNA target efficiency detection kit (Cat. No. VK007-10, manufacturer: Beijing Weishanglide Biotechnology Co., Ltd.). A primer panel containing 200 species of bacteria is designed (see the specific primer sequences shown in Table 1; it can be complementary to the specific fragment located at the 5' end of the sequence of the amplified library prepared in Example 1, so as to achieve the binding of the amplified library to the surplus primer panel sequence), and the prepared mixed DNA sample of 11 species of bacteria is used as an amplification template. The primer combination is used for multiple PCR amplification reaction, and the amplified product is used for library construction and high-throughput sequencing. This method is applicable to common sequencing platforms such as Illumina sequencing platform and BGI sequencing platform, and technicians can choose by themselves. In this embodiment, the BGI sequencing platform is used as an example for explanation. The second round of adapter primers were designed as adapter primers of the BGI platform, UA-F: 5'-GAACGACATGGCTACGATCCGACTT-3' (SEQ ID NO: 5), where the 5' end of UA-F introduced phosphorylation modification (phos-); Mgi-R: TGTGAGCCAAGGAGTTGNNNN NNNNTTGTCTTCCTAAGACCGCTTGGCCTCCGACTT (SEQ ID NO: 6), NNNNNNN NNN represents the index sequence of sequencing, where the 10 N bases of Index are designed as needed (conventional technical means in this field) as tags to distinguish samples, and the remaining Index sequences are universal sequencing primer sequences of the BGI platform. The experimental method uses 2 rounds of PCR amplification to build a library, selects the amplified library described in Example 1, and selects the preferred synthetic CRISP R / Cas9 system for detection. The experimental process is as follows:

[0114] One round of PCR targeted enrichment

[0115] Table 5 PCR reaction system

[0116] Reagents volume Amplification enzyme 2× 25μL Primer panel 3μL Amplification of the library 1μL 11 kinds of standard strain DNA 10μL Sterile water Up to 50μL

[0117] In the system described in Table 5, the amplification enzyme was purchased from Nanjing Novazon Biotech Co., Ltd., with the catalog number Vazyme#NA301. The amount of amplification library added ranged from 3 ng / μL to 8 ng / μL, with the best effect range being 5 ng / μL.

[0118] Prepare the PCR reaction system according to Table 5, and the amplification system is shown in Table 6:

[0119] Table 6 PCR amplification program

[0120]

[0121] First round PCR product purification

[0122] (1) Take out the VAHTSDNAClean Beads from 2-8°C 30 minutes in advance and let it stand to balance to room temperature. Prepare 80% ethanol.

[0123] (2) Invert or vortex to mix the magnetic bead solution thoroughly, then add the corresponding volume (1.3×) of magnetic beads to the PCR product, centrifuge for 3 seconds, and vortex or pipette 10 times to mix.

[0124] (3) Combine at room temperature for 5 minutes.

[0125] (4) Centrifuge the PCR tube for about 3 seconds and place it on a magnetic rack. After the solution becomes clear (>2 minutes), carefully remove the supernatant.

[0126] (5) Keep the centrifuge tube in the magnetic rack and add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads. Let it stand at room temperature for 30 seconds and carefully remove the supernatant.

[0127] (6) Repeat step (5).

[0128] (7) Keep the centrifuge tube on the magnetic rack at all times, open the lid and let the magnetic beads dry at room temperature until cracks just appear (about 2 minutes).

[0129] (8) Remove the centrifuge tube from the magnetic rack, add an appropriate amount of enzyme-free sterile water (≥20 μL), vortex or use a pipette to gently blow to mix thoroughly, let it stand at room temperature for 5 minutes, let it stand on the magnetic rack for 5 minutes, wait for the solution to become clear, and carefully pipette the supernatant into a clean tube. This completes one round of PCR product purification.

[0130] Targeted enzyme cleavage

[0131] Table 7 Enzyme digestion system

[0132]

[0133]

[0134] The 10×Reaction buffer in Table 7 is 10×spCas9 buffer (Cat. No. VK007-11 of Beijing Weishanglide Biotechnology Co., Ltd.).

[0135] Prepare the enzyme digestion system shown in Table 7, mix thoroughly, incubate 27 μL of the system at 37°C for 10 min, then add 23 μL of the purified first-round PCR product, incubate at 37°C for 30 min, inactivate at 65°C for 5 min, and perform 1.3× magnetic bead purification again after completion.

[0136] Second round PCR system

[0137] According to the number of samples, an appropriate amount of Mgi-R was selected, and the second round of PCR system was configured according to Table 8. The amplification program is shown in Table 9. Among them, the amplification enzyme was VAHTS HiFi Amplification Mix (Novozyme, catalog number N616).

[0138] Table 8 Second round PCR system

[0139] Amplification enzyme 2× 25μL UA-F(10uM) 1μL Mgi-R(10uM) 1μL First round PCR products after restriction digestion 23μL

[0140] Table 9 PCR amplification program

[0141]

[0142] Purification of the second-round PCR product

[0143] (1) Take out the VAHTS DNA Clean Beads from 2-8°C 30 minutes in advance and let them stand to balance to room temperature. Prepare 80% ethanol.

[0144] (2) Invert or vortex to mix the magnetic bead solution thoroughly, then add the corresponding volume (0.7×) of sorting magnetic beads to the PCR product, centrifuge for 3 seconds, and vortex or pipette 10 times to mix.

[0145] (3) Combine at room temperature for 5 minutes.

[0146] (4) Take a new PCR tube and add the volume of PCR product (0.15×) sorting magnetic beads to it for later use. Centrifuge the centrifuge tube in step (3) for about 3 seconds and place it on a magnetic rack. After the solution is clear (>2 minutes), carefully transfer the supernatant to the PCR tube with (0.15×) sorting magnetic beads added, centrifuge for 3 seconds, and vortex or pipette 10 times to mix.

[0147] (5) Combine at room temperature for 5 minutes.

[0148] (6) Centrifuge the PCR tube for about 3 seconds and place it on a magnetic rack. After the solution is clear (> 2 minutes), carefully remove the supernatant.

[0149] (7) Keep the centrifuge tube in the magnetic rack and add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads. Let it stand at room temperature for 30 seconds and carefully remove the supernatant.

[0150] (8) Repeat step (8).

[0151] (9) Keep the centrifuge tube on the magnetic rack at all times, open the lid and let the magnetic beads dry at room temperature until cracks just appear (about 2 minutes).

[0152] (10) Remove the centrifuge tube from the magnetic rack, add an appropriate amount of enzyme-free sterile water (≥20 μL), vortex or use a pipette to gently blow to mix thoroughly, let it stand at room temperature for 5 minutes, and then let it stand on the magnetic rack for 5 minutes. After the solution is clarified, carefully pipette the supernatant into a clean tube to complete the purification and sorting of the library.

[0153] (11) Use a qubit fluorometer (Thermo Fisher Scientific) to test the concentration of the purified and sorted library. If the concentration is greater than 1 ng / μL, it can be sequenced.

[0154] (12) The constructed multiplex amplicon libraries were pooled according to 1M reads per sample and sequenced.

[0155] Results Analysis

[0156] At the same time, a comparative test was also conducted during the experiment. The other experimental steps were the same during the experiment, and the experimental test was conducted without adding the amplified library sequence and without using Cas9 protease cleavage. The results are shown in Table 10. The detection reads of each bacteria based on this method are the most and the effect is the best. The data normalization comparison is based on the number of reads detected by 1M sequencing.

[0157] Table 10 PCR amplification efficiency test results

[0158]

[0159]

[0160] (II) Effect verification using 12 clinical samples

[0161] In addition, 12 clinical samples were selected and compared with the results of pathogenic microorganism metagenomic sequencing using the method described in the present invention to verify the accuracy of the method. The experimental operation method is the same as above, and the pathogenic metagenomic sequencing adopts the standard experimental process and bioinformatics analysis process. The detection reads of this method are normalized according to 1M sequencing volume, and the metagenomic sequencing volume is not less than 20M.

[0162] Table 11 Validation results in clinical samples

[0163]

[0164] The results are shown in Table 11. Compared with the results of metagenomic sequencing, the pathogens detected by this method are consistent, with a positive coincidence rate of 100%. In addition, this method also detected human herpes virus type 1, Haemophilus parainfluenzae or cytomegalovirus (CMV) in 3 samples (sample 1, sample 2 and sample 4). The number of reads detected by this method according to 1M sequencing volume is significantly higher than that of the metagenomics, which shows the effectiveness of this method.

Claims

1. An isolated nucleic acid, characterized in that The nucleic acid comprises, from the 5' end to the 3' end, a forward specific sequence, an enzyme cleavage sequence and a reverse specific sequence; The nucleotide sequence of the forward specific sequence is selected from any one of the following tables: and / or, The reverse specific sequence is selected from any one of the following table:

2. The nucleic acid according to claim 1, wherein The cleavage sequence comprises a target sequence that can be recognized and cleaved by a Cas protein, and the Cas protein is, for example, a Cas9 protein; Preferably, the restriction enzyme sequence also satisfies one or both of the following conditions: (1) the target sequence comprises a PAM sequence, for example, CGG; the target sequence preferably comprises a nucleotide sequence as shown in SEQ ID NO: 4; and, (2) The 5' end of the restriction enzyme sequence comprises a forward universal sequence, and / or the 3' end of the restriction enzyme sequence comprises a sequence that is reverse complementary to the reverse universal sequence; the forward universal sequence comprises the nucleotide sequence shown in SEQ ID NO: 2, and / or the reverse universal sequence comprises the nucleotide sequence shown in SEQ ID NO: 3; More preferably, the enzyme cleavage sequence comprises the nucleotide sequence shown in SEQ ID NO:

1.

3. A nucleic acid combination, characterized in that The combination comprises two or more nucleic acids as described in claim 1 or 2.

4. A combination of primer pairs, characterized in that: The combination comprises two or more pairs of primer pairs, wherein the primer pairs comprise a forward primer and a reverse primer, wherein the forward primer comprises a forward specific sequence and a forward universal sequence from the 5' end to the 3' end, and the reverse primer comprises a sequence that is reverse complementary to the reverse specific sequence and a reverse universal sequence from the 5' end to the 3' end; the forward specific sequence and / or the reverse specific sequence are defined in the nucleic acid according to claim 1; Preferably, the forward universal sequence comprises the nucleotide sequence shown in SEQ ID NO:2, and / or the reverse universal sequence comprises the nucleotide sequence shown in SEQ ID NO:

3.

5. A combination of primer pairs, characterized in that: The combination comprises two or more pairs of primer pairs, wherein the primer pairs comprise a forward primer and a reverse primer, wherein the forward primer comprises a forward specific sequence, and the reverse primer comprises a sequence that is reverse complementary to the reverse specific sequence; the forward specific sequence and / or the reverse specific sequence are defined in the nucleic acid as described in claim 1.

6. A method for preparing a nucleic acid as claimed in claim 1 or 2 or a combination as claimed in claim 3, characterized in that: The method comprises using a vector comprising the restriction sequence defined in the nucleic acid of claim 2 as a template and performing PCR amplification using a combination of primer pairs as claimed in claim 4; Preferably, the backbone of the vector is Puc57.

7. A kit, characterized in that: The kit comprises one or more selected from the group consisting of the nucleic acid according to claim 1 or 2, the combination according to claim 3, and the combination of the primer pair according to claim 5; Preferably, the kit further comprises a Cas protein such as a Cas9 protein, and / or a gRNA, wherein the gRNA comprises a specific recognition and cleavage sequence, wherein the specific recognition and cleavage sequence comprises a nucleotide sequence as shown in the target sequence defined in the nucleic acid according to claim 2; and / or, the kit further comprises a reagent for high-throughput sequencing, such as a sequencing adapter primer pair; More preferably, the gRNA further comprises a backbone sequence, wherein the backbone sequence is located at the 3' end of the specific recognition and cleavage sequence, and the backbone sequence preferably comprises a sequence as shown in SEQ ID NO: 7; Further preferably, one, two or three bases at the 5' end and / or the 3' end of the gRNA further contain a 2'-O-methyl modification.

8. A method for reducing primer dimers in a multiplex PCR system, characterized in that: The method comprises adding an amplification library to the multiplex PCR system, wherein the nucleic acid contained in the amplification library comprises, in order from the 5' end to the 3' end: a forward specific sequence, a restriction sequence and a reverse specific sequence, wherein the forward specific sequence and the reverse specific sequence can be complementary to the multiple primers in the multiplex PCR system, and the restriction sequence is defined in the nucleic acid according to claim 2; Preferably, the multiple primers are a combination of primer pairs as described in claim 5; preferably, the amplification library is a combination of nucleic acids as described in claim 3; More preferably, the method further comprises enzymatically cleaving the amplified product using a CRISPR / Cas system, preferably the Cas protein in the CRISPR / Cas system is a Cas9 protein, and / or the gRNA in the CRISPR / Cas system is defined in the kit according to claim 7; Further preferably, in the multiplex PCR system, the added amount of the amplified library is 3 ng / μL-8 ng / μL, for example, 5 ng / μL, and / or the working concentration of the multiplex primers in the multiplex PCR system is 0.0012 pmol / μL-0.012 pmol / μL.

9. A method for identifying microorganisms, characterized in that: The method comprises amplifying the sample to be tested using the method as claimed in claim 8; Preferably, the method further comprises the step of identifying the product after enzyme cleavage and analyzing the type of microorganisms in the sample to be tested; More preferably, the identification is high-throughput sequencing; preferably, the identification includes the step of connecting the product after enzyme cleavage with a sequencing adapter primer sequence to obtain a sequence to be sequenced; more preferably, the adapter primer sequence comprises an upstream adapter primer as shown in SEQ ID NO:5, the 5' end of the upstream adapter primer preferably comprises a phosphorylation modification, and / or comprises a downstream adapter primer as shown in SEQ ID NO:6; Further preferably, the method is for non-diagnostic purposes; and / or, the microorganism is a pathogenic microorganism.

10. Use of any one or more of the nucleic acid according to claim 1 or 2, the combination of the nucleic acid according to claim 3, the combination of the primer pair according to claim 4, the combination of the primer pair according to claim 5 and the kit according to claim 7 in identifying microorganisms; Preferably, the application is for non-diagnostic purposes; and / or, the microorganism is a pathogenic microorganism.

Images