A meiosis-related gene, CrMER3, and its application in seedless breeding of citrus.

Abstract

This invention discloses a meiosis-related gene, CrMER3, and its application in seedless citrus breeding, belonging to the fields of citrus biotechnology and genetic breeding. The CrMER3 gene comprises CrMER3A, CrMER3a, and CrMER3A... ‑103bp Three genotypes, their complete nucleotide sequences and coding region nucleotide sequences are shown in SEQ ID NO:1-6, respectively. CrMER3a is present in many existing citrus varieties and can be widely used in seedless citrus breeding. The KASP molecular marker used to identify whether a citrus variety carries the CrMER3a seedless gene corresponds to the 2295th base of the CrMER3 gene. In citrus varieties carrying / not carrying the CrMER3a gene, this base is C / T. This molecular marker or its amplification primers can be used for marker-assisted selection breeding of citrus seedless varieties.

Description

Technical Field

[0001] This invention belongs to the field of citrus biotechnology and genetic breeding, specifically involving a meiosis-related gene CrMER3 and its application in seedless citrus breeding. Background Technology

[0002] Citrus originated in China and is the world's largest category of fruit, as well as the most important fruit tree in southern my country, possessing extremely high economic and nutritional value. Seedlessness is a crucial indicator in evaluating the quality of citrus fruit, highly favored by consumers and possessing significant commercial value in the market, thus making it a key objective in citrus breeding. Currently, seedless citrus varieties in my country mainly originate from bud mutation selection and hybridization breeding. Bud mutation selection relies on natural mutations, with random directions and low probability; a smaller portion comes from hybridization breeding, utilizing the cytoplasmic male sterility of Satsuma mandarins to cultivate seedless varieties. However, due to the relatively narrow genetic background of the parental lines, higher generations of varieties exhibit disadvantages such as weak aroma, weak resistance, and premature aging. Citrus's long juvenile period, polyembryonic nature, and complex genetic background make it extremely difficult to cultivate high-quality seedless varieties through traditional hybridization breeding methods. Currently, no genes suitable for seedless citrus breeding have been reported. Discovering seedless-related genes in citrus resources and using them for hybridization breeding is of great significance for improving the efficiency of seedless citrus breeding, broadening the genetic background of hybridization breeding parents, and enriching the diversity of citrus varieties.

[0003] The main reasons for seedlessness in citrus include male sterility, embryo abortion, and self-incompatibility. The parthenocarpic ability of most citrus varieties is the basis for producing seedless citrus fruits. Abnormalities in meiotic genes can lead to disordered meiosis in both male and female organs, resulting in organ abortion. This allows for the production of seedless citrus fruits without the need for isolation, making it an ideal seedless variety. The 'Qianyang Seedless' Ponkan is a seedless bud mutation bred from common Ponkan. It exhibits vigorous growth, early fruiting, and high yields, and is sterile in both male and female reproductive organs, making it China's first completely seedless Ponkan variety. Naturally occurring seedless bud mutations are valuable resources for studying the mechanisms of seedlessness in citrus and are crucial for citrus seedless functional genomics research and seedless breeding. KASP (Kompetitive Allele Specific PCR) technology is characterized by high throughput, low cost, high accuracy, and simplicity and speed. It can accurately perform biallelic genotyping of target SNPs and InDels, and plays an increasingly important role in molecular marker-assisted breeding of citrus. Summary of the Invention

[0004] This invention addresses the current lack of molecular markers for studying the mechanism of seedlessness in citrus and for seedless breeding, by providing a meiosis-related gene, CrMER3, and its application in seedless citrus breeding. Through cytological observation and genome sequencing, this invention identified a seedless variation site in the 'Qianyang Seedless' Ponkan orange. The citrus CrMER3 gene commonly exhibits two alleles (CrMER3A and CrMER3a). Compared to CrMER3A, CrMER3a terminates prematurely due to a single-base T deletion in its coding region, producing a truncated protein. In contrast, a 103bp deletion occurs within the CrMER3A gene segment of the 'Qianyang Seedless' Ponkan orange, altering its transcription product and leading to premature protein coding termination; this deletion is named CrMER3A. -103bp The two alleles CrMER3a and CrMER3A of 'Qianyang Seedless' Ponkan orange. -103bp None of them can encode the functional CrMER3 protein, leading to meiotic disorder and sterility of both male and female organs, which is the reason for the seedlessness of 'Qianyang Seedless' Ponkan oranges. Among them, CrMER3A -103bp It is a mutant gene unique to the 'Qianyang Seedless' Ponkan orange, while CrMER3a exists in many existing citrus varieties and can be widely used for seedless citrus breeding.

[0005] One of the objectives of this invention is to provide a CrMER3 gene related to seedlessness in citrus and its application. The CrMER3 gene can be used as a candidate gene for improving seedless citrus varieties.

[0006] The second objective of this invention is to provide a KASP molecular marker for identifying whether a citrus variety carries the seedless gene CrMER3a and its application. This marker can provide useful information for the genotype selection of parental lines in seedless citrus breeding and hybridization, and provide a simple, rapid, and effective auxiliary method for early diagnosis of offspring fertility, thereby improving the efficiency of genetic improvement of seedless citrus.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] A CrMER3 gene associated with seedlessness in citrus, including CrMER3A, CrMER3a, and CrMER3A, is present in citrus. -103bp Three genotypes: CrMER3A, CrMER3a, and CrMER3A -103bp The complete nucleotide sequences are shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively.

[0009] The coding region nucleotide sequences of the above three citrus seedless CrMER3 genes are shown in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively.

[0010] The application of the CrMER3 gene, which is related to seedlessness in citrus, in seedless citrus breeding. For example, the CrMER3 gene can be precisely and directionally edited using CRISPR / Cas9 gene editing technology without altering the genetic background of the citrus variety, causing the CrMER3 protein to lose its function, thereby achieving the goal of rapidly improving seedless citrus; or, by hybridizing CrMER3A / CrMER3a genotype varieties, homozygous CrMER3a / CrMER3a citrus plants can be obtained, creating new seedless citrus germplasm.

[0011] A KASP molecular marker, KASP-CrMER3, for identifying whether a citrus variety carries the seedless gene CrMER3a is disclosed. The molecular marker corresponds to the 2295th base of the CrMER3 gene on chromosome 2 of the Ponkan genome. In citrus varieties carrying the CrMER3a gene, the 2295th base of the CrMER3 gene is C, while in citrus varieties not carrying the CrMER3a gene, the 2295th base of the CrMER3 gene is T.

[0012] A KASP-CrMER3 primer for amplifying the above molecular markers.

[0013] The KASP-CrMER3 primers include the CrMER3A allele upstream primer KASP-CrMER3-F, the CrMER3a allele upstream primer KASP-CrMER3-H, and the common downstream primer KASP-CrMER3-C;

[0014] The preferred nucleotide sequence of the upstream primer KASP-CrMER3-F for the CrMER3A allele is: 5'-gaaggtgaccaagttcatgctGCTATGCCCCAGCAAAAAATGATTTT-3' (SEQ ID NO:7, the lowercase part is the specific fluorescent tag sequence FAM);

[0015] The preferred nucleotide sequence of the upstream primer KASP-CrMER3-H for the CrMER3a allele is: 5'-gaaggtcggagtcaacggattGCTATGCCCCAGCAAAAAATGATTTC-3' (SEQ ID NO: 8, the lowercase part is the specific fluorescent tag sequence HEX);

[0016] The nucleotide sequence of the shared downstream primer KASP-CrMER3-C is: 5'-AGAATCAAGAGCTTGCCTTTTCAAAT-3' (SEQ ID NO:9).

[0017] Application of the KASP-CrMER3 molecular marker or its amplification primers in marker-assisted selection breeding of seedless citrus.

[0018] A method for identifying whether a citrus variety carries the nucleus-free gene CrMER3a includes the following steps: extracting whole-genome DNA from the tissue of the citrus variety to be tested, performing PCR amplification of the whole-genome DNA of the sample to be tested using primers for amplifying the KASP-CrMER3 molecular marker, reading the fluorescence signal of the PCR amplification product, and obtaining the typing result of the sample to be tested.

[0019] The beneficial effects of this invention are as follows: Through the study of the completely seedless citrus natural mutant 'Qianyang Seedless' Ponkan orange, this invention cloned the first meiosis-related gene CrMER3 in citrus. The 'Qianyang Seedless' Ponkan orange exhibits normal vegetative growth, but both male and female organs are sterile, and the fruit is completely seedless. This invention provides the application of CrMER3 in seedless citrus breeding, and develops the KASP molecular marker KASP-CrMER3 to identify whether citrus varieties carry the seedless gene CrMER3a, achieving rapid, high-throughput, and accurate tracking of the CrMER3a gene, and accelerating the efficient utilization of the CrMER3a gene in marker-assisted selection breeding. Attached Figure Description

[0020] Figure 1 This is an observation of male fertility in 'Qianyang Seedless' Ponkan (QS) and common Ponkan (WT) in Example 1. Figures A and D show fully opened flowers, scale bar = 1 mm. Figures B and E show I2-KI staining of mature pollen, scale bar = 100 μm. Figures C and F show paraffin sections of mature anthers: aPG, aborted pollen grains; E, epidermis; En, anther chamber wall; Fb, fibrous tissue; PG, pollen grains; St, cleft area; scale bar = 50 μm. Figures G, H, I, and J show tetrad compressions, scale bar = 10 μm.

[0021] Figure 2 Figure A shows the results of comparative genomic analysis for variant identification in Example 2. Figure A is a schematic diagram of the 103bp deletion of the CrMER3 gene identified in 'Qianyang Seedless' Ponkan oranges. Figure B shows the results of agarose gel electrophoresis verifying the variant.

[0022] Figure 3 This is a schematic diagram of the CrMER3 gene structure of 'Qianyang Seedless' Ponkan orange and ordinary Ponkan orange in Example 2, where gray squares represent gene exons and gray lines represent gene introns.

[0023] Figure 4 The image shows the genotyping results of citrus varieties with known genotypes using the developed KASP marker in Example 3. The right side shows the Sanger sequencing peak diagram corresponding to the genotyping results. NTC: blank control without template.

[0024] Figure 5 The results of typing 83 samples from a natural citrus population using the KASP molecular marker KASP-CrMER3 provided by this invention in Example 4.

[0025] Figure 6 This document presents the CrMER3 gene knockout line of citrus, a model material obtained using CRISPR / Cas9 gene editing technology in Example 5, and its phenotypic identification. Figures A and E show mature flower buds (scale bar = 1 mm); Figures B and F show mature pollen stained with I2-KI (scale bar = 100 μm); Figures C and G show paraffin sections of mature anthers (scale bar = 40 μm); Figures D and H show tetrad pressed sections (scale bar = 10 μm). Detailed Implementation

[0026] The present invention will now be described in further detail with reference to specific embodiments to enable those skilled in the art to understand it. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the scope of the invention.

[0027] Example 1: Male fertility observation of 'Qianyang Seedless' Ponkan orange

[0028] 'Qianyang Seedless' Ponkan orange is a seedless variety developed from a bud mutation of the common seeded Ponkan orange. Its vegetative growth is identical to that of the seeded Ponkan orange, but it is sterile in both male and female reproductive stages. A comprehensive observation of its male fertility was conducted, and it was compared with that of the seeded Ponkan orange. The methods are as follows:

[0029] 1) Pollen viability observation:

[0030] Pollen was stained and observed using I2-KI staining solution. Two to three mature anthers were placed on a glass slide, and 1-2 drops of 1% I2-KI solution were added. The anthers were crushed with tweezers to release the pollen grains. The residue was removed, a coverslip was placed over the anthers, and the slide was gently pressed down. The slides were then allowed to stand for 2 minutes before observation and photography under a universal microscope (Olympus BX61). Fertile pollen was deep blue, while sterile pollen remained unstained.

[0031] 2) Observation of anther paraffin sections:

[0032] Flower buds at different developmental stages were collected and fixed in FAA fixative (50% ethanol, 5% glacial acetic acid, 10% formaldehyde, v / v) at room temperature for 24 h. They were then dehydrated sequentially in 70%, 85%, 95%, and 100% (v / v) ethanol, followed by gradient xylene permeation and embedding in paraffin. Sections were cut into 6 μm thick sections using a microtome, stained with 0.25% (w / v) toluene blue dye, and photographed using a microscope (Olympus BX61).

[0033] 3) Observation of meiotic tetrads:

[0034] Fresh flower buds at the meiotic division stage, with sepals approximately at the middle of the petals, were collected and fixed in Carnoy's fixative (ethanol:acetic acid = 3:1) for 24 hours, then stored in 70% ethanol at 4°C. The fixed flower buds were then examined, and the anthers were removed and washed 3-5 times in distilled water. Two to three anthers were placed on a glass slide, and one drop of carbofuran stain was added. The tetrads were extruded from the anthers, large tissue fragments were removed, and the slide was covered. The samples were then observed and photographed using a microscope (Olympus BX61).

[0035] like Figure 1 As shown, compared with the common seeded Ponkan (WT), the mature pollen of the 'Qianyang Seedless' Ponkan (QS) is non-viable, and the meiotic process is defective, producing a large number of abnormal tetrads. This indicates that the seedlessness of QS is due to abnormal meiotic processes leading to sterility in both males and females.

[0036] Example 2: Analysis of the reasons for seedlessness in 'Qianyang Seedless' Ponkan oranges

[0037] This invention, based on genomic analysis and meiotic cytological phenotypes, and through PCR-specific amplification verification, cloned the gene and determined that the seedlessness of the 'Qianyang Seedless' Ponkan orange is due to a mutation in the CrMER3 gene. Specifically, universal primers were designed for verification based on the predicted CrMER3 DNA and cDNA sequences from the assembled genomes of ordinary seeded Ponkan oranges and 'Qianyang Seedless' Ponkan oranges. The primer sequences are shown below:

[0038] CrMER3 forward primer (CrMER3-F): 5'-ATGATGGATTCATACGCACTGAAATCTG-3';

[0039] CrMER3 reverse primer (CrMER3-R): 5'-TTAGAGAAACGAAAAAACACTCTCAAACCC-3'.

[0040] Illumina data from EG and QS were aligned to the EG genome using BWA-MEM software. SNPs and indels were identified using GATK software. PacBio data from EG and QS were aligned to the EG genome using minimap2 software, and structural variations (SVs) were identified using Sniffles. The results showed that a 103bp deletion specifically exists in the CrMER3 gene in 'Qianyang Seedless' Ponkan oranges. Figure 2 As shown.

[0041] PCR products were amplified using DNA from leaves of 'Qianyang Seedless' Ponkan oranges and ordinary seeded Ponkan oranges as templates. The two CrMER3 alleles present in ordinary seeded Ponkan oranges were CrMER3A and CrMER3a; the two CrMER3 alleles present in 'Qianyang Seedless' Ponkan oranges were CrMER3a and CrMER3A.-103bp Compared to CrMER3A, CrMER3a has a single-base T deletion at the 7th exon; CrMER3A... -103bp Compared to CrMER3A, a total of 103 bp was deleted at the 15th intron and the 16th exon, both of which led to premature termination of protein translation. CrMER3A, CrMER3a, and CrMER3A were amplified. -103bp The DNA lengths are 8165 bp, 8164 bp, and 8062 bp, respectively, with coding region sequence lengths of 3687 bp, 804 bp, and 1554 bp, encoding 1228 amino acids, 267 amino acids, and 517 amino acids, respectively. A schematic diagram of the CrMER3 gene structure is shown below. Figure 3 As shown, the exon and intron structures of the gene were plotted using GSDS. This demonstrates that when the functional CrMER3 protein is missing in citrus fruits, the meiotic process is disrupted, leading to seedless fruit.

[0042] Example 3: Obtaining the KASP molecular marker for identifying whether a citrus variety carries the seedless gene CrMER3a

[0043] The CrMER3 gene was identified in natural citrus populations and found that CrMER3A(A) was prevalent in citrus varieties. -103bp The CrMER3a gene is unique to the 'Qianyang Seedless' Ponkan orange, while in some varieties it exists in a heterozygous (Aa) state. Based on the phenotype of the 'Qianyang Seedless' Ponkan orange, it is known that in traditional hybridization breeding, obtaining homozygous (aa) CrMER3a, thereby acquiring the nonfunctional CrMER3 protein, can create new seedless citrus germplasm. The KASP molecular marker, designed based on the 2295th base (T / C) of the CrMER3 gene, can be used to identify whether citrus varieties carry the seedless gene CrMER3a.

[0044] 1. The developed KASP molecular marker sequence is as follows:

[0045] KASP-CrMER3-F: 5'-gaaggtgaccaagttcatgctGCTATGCCCCAGCAAAAAATGATTTT-3' (SEQ ID NO: 7, the lowercase part is the specific fluorescent tag sequence FAM);

[0046] KASP-CrMER3-H: 5'-gaaggtcggagtcaacggattGCTATGCCCCAGCAAAAAATGATTTC-3' (SEQ ID NO: 8, the lowercase part is the specific fluorescent tag sequence HEX);

[0047] KASP-CrMER3-C: 5'-AGAATCAAGAGCTTGCCTTTTCAAAT-3' (SEQ ID NO: 9).

[0048] 2. KASP Reaction Test:

[0049] (1) Extraction of whole genome DNA from leaf samples: conventional CTAB method, adjusting the DNA concentration to approximately 50 ng / μL.

[0050] (2) Reaction system: 2.5 μL of 2×KASP Master mix (LGC, KBS-1050-122), 2.5 μL of genomic DNA, and 0.07 μL of primer mixture (made by mixing equal volumes of KASP-MER3-F (36 μM), KASP-MER3-H (36 μM), and KASP-MER3-C (90 μM), for a total volume of 5.07 μL. Reaction program: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61℃ gradient annealing and extension for 60 s, 10 cycles, with the annealing and extension temperatures decreasing by 0.6℃ per cycle; 94℃ denaturation for 20 s, 55℃ annealing and extension for 60 s, 26 cycles (Roche LC480 real-time PCR instrument). A blank control (NTC) without DNA template was also included in the experiment, with one or more blank controls per plate.

[0051] (3) Fluorescence data reading and analysis. Fluorescence data were read using a quantitative real-time PCR instrument (Roche LC480). Fluorescence signals were read at 37℃ for 60 seconds. The selected fluorescence types were FAM and HEX. The genotyping results of the samples are shown below. Figure 4 As shown.

[0052] 3. To test the practicality of the KASP markers of this invention, Sanger sequencing was used to verify the KASP molecular marker genotyping results.

[0053] The amplification primers are as follows:

[0054] Forward primer CrMER3-TF:5'-GAACGGACAGGACACATTCTCTCA-3';

[0055] Reverse primer CrMER3-TR:5'-CTGTGCAGCTTCTTGTGCTCC-3'.

[0056] The PCR reaction system was as follows: 25 μL PCR Mix (purchased from Nanjing Novizan Biotechnology Co., Ltd.), 2 μL DNA template, 2 μL each of forward and reverse primers, and ddH2O to a final volume of 50 μL. The thermal cycling parameters were: 95℃ for 3 min; 95℃ for 30 sec, 58℃ for 30 sec, 72℃ for 15 sec, 32 cycles; 72℃ for 7 min, 1 cycle; stored at 4℃. 5 μL of the amplification product was aspirated and detected by 1.0% agarose gel electrophoresis in a horizontal electrophoresis tank. Once the band size was approximately 500 bp, the remaining 45 μL was sent for sequencing (Beijing Qingke Biotechnology Co., Ltd. Wuhan Branch). The sequencing results are as follows. Figure 4 As shown. The KASP-CrMER3 molecular marker developed in this invention can accurately identify whether citrus varieties carry the CrMER3a gene.

[0057] Example 4: Application of KASP-MER3 in molecular marker-assisted selection of seedless citrus breeding parents

[0058] The molecular marker KASP-CrMER3 was used to identify whether 83 samples from a natural citrus population carried the CrMER3a gene, as described in Example 3. The genotyping results for each material are as follows. Figure 5 As shown in the figure, the points clustered at 45° represent 16 citrus varieties that carry the CrMER3a gene and exist in a heterozygous state (Aa). These citrus varieties can be used as parents for seedless citrus breeding to create new seedless citrus germplasm that is homozygous (aa) for CrMER3a.

[0059] The CrMER3 gene provided by this invention can be used as a candidate gene for seedless breeding of citrus. The KASP-CrMER3 molecular marker provided has achieved accurate typing in identifying whether citrus varieties carry the seedless gene CrMER3a, and can realize efficient tracking and detection of the CrMER3a gene. It can be used for molecular marker-assisted breeding of the seedless gene CrMER3a in citrus.

[0060] Example 5: Obtaining and phenotypic identification of the CrMER3 gene knockout line of the citrus model material, *Citrus medica*.

[0061] To verify the function of the CrMER3 gene, the CrMER3 gene of *F. hindsii* was edited. An sgRNA, TACAGGAGAAGCTCCGTGAC, was designed and constructed into the pCAMBIA1300-pYAO:hSpCas9-eGFP vector. The CrMER3 gene was knocked out via Agrobacterium-mediated epicotyl transformation. High-throughput tracking of mutation technology (Hi-TOM) was used to detect the mutation types and frequencies of the obtained transgenic positive seedlings, yielding six homozygous edited plants. Fertility identification revealed that the phenotype of the homozygous CrMER3-edited plants was consistent with that of the 'Qianyang Seedless' Ponkan orange, with normal floral organ development, pollen sterility, disordered meiosis, and the production of abnormal tetrads. Figure 6 ).

[0062] The above embodiments are intended to facilitate understanding by those skilled in the art. The implementation of the present invention is not limited to the above embodiments. Any modifications, equivalent substitutions, combinations, improvements, etc., made within the spirit and principle of the present invention are included within the protection scope of the present invention.

Claims

1. Related to seedless citrus CrMER3 The application of genes in seedless citrus breeding is characterized by, include: Using gene editing technology on citrus CrMER3 Gene editing enables CrMER3A The loss of function of gene-encoded proteins can be used to create new seedless citrus germplasm; or seedless citrus can be obtained through hybridization breeding. CrMER3a Genetically homozygous citrus plants were used to create new seedless citrus germplasm. The aforementioned CrMER3A The complete nucleotide sequence of the gene is shown in SEQ ID NO:1; The aforementioned CrMER3a The complete nucleotide sequence of the gene is shown in SEQ ID NO:

2.

2. The application according to claim 1, characterized in that: The aforementioned use of gene editing technology on citrus CrMER3 Gene editing enables CrMER3A Loss of function of gene-encoded proteins includes: the use of gene editing technology on citrus fruits... CrMER3 Gene editing enables CrMER3A Gene mutation CrMER3a Gene or CrMER3A -103 bp Gene; The aforementioned CrMER3A -103 bp The complete nucleotide sequence of the gene is shown in SEQ ID NO:

3.

3. A primer, characterized in that: The primers described above are used to amplify and identify whether citrus varieties carry the citrus seedless gene. CrMER3a The KASP molecular marker, which corresponds to chromosome 2 of the Ponkan genome. CrMER3 The 2295th base of the gene, in carrying CrMER3a Citrus varieties with genetic defects CrMER3 The 2295th base of the gene is C, which is not carried by the gene. CrMER3a Citrus varieties with genetic defects CrMER3 The 2295th base of the gene is T; The primers include CrMER3A Allelic upstream primer KASP- CrMER3 -F, CrMER3a Allelic upstream primer KASP- CrMER3 -H, and the shared downstream primer KASP- CrMER3 -C; The CrMER3A Allelic upstream primer KASP- CrMER3 The nucleotide sequence of -F is: 5'-gaaggtgaccaagttcatgctGCTATGCCCCAGCAAAAAATGATTTT-3'; The CrMER3a Allelic upstream primer KASP- CrMER3 The nucleotide sequence of -H is: 5'-gaaggtcggagtcaacggattGCTATGCCCCAGCAAAAAATGATTTC-3'; The shared downstream primer KASP- CrMER3 The nucleotide sequence of -C is: 5'-AGAATCAAGAGCTTGCCTTTTCAAAT-3'.

4. The application of the primers described in claim 3 in marker-assisted selection breeding of seedless citrus.

5. A method for identifying whether a citrus variety carries a seedless gene. CrMER3a The method is characterized by, Includes the following steps: Whole-genome DNA was extracted from the tissue of the citrus variety to be tested. The whole-genome DNA of the sample to be tested was amplified by PCR using the primers described in claim 3. The fluorescence signal of the PCR amplification product was read to obtain the typing result of the sample to be tested.

Images