Strain modification strategy for high-yield porphyrin compound and engineering strain

Abstract

The invention provides a strain modification strategy for high-yield porphyrin compounds and an engineering strain. The invention provides a strain modification strategy for high-yield porphyrin compounds, which is characterized in that a porphyrin compound production strain is modified through a gene recombination technology, a hemN gene is down-regulated or deleted in the porphyrin compound production strain, and preferably, an expression cassette of exogenous hemQ, hemH and hemY genes is further introduced in the porphyrin compound production strain, so that engineering bacteria capable of efficiently producing target porphyrin compounds are obtained. According to the modification strategy, the strains which do not produce the porphyrin compounds originally can efficiently produce various porphyrin compounds, support is provided for selection and modification of the strains for producing the porphyrin compounds, and meanwhile a new thought is provided for industrial production of the porphyrin compounds.

Description

Technical Field

[0001] The invention belongs to the field of bioengineering and biosynthesis, and more specifically, relates to a strain transformation strategy and an engineered strain for high-yield porphyrin compounds. Background Art

[0002] The porphyrin synthesis pathway is a conservative synthesis pathway in organisms. It is widely present in three-domain organisms, except for a few pathogens and symbionts. However, since the synthesis of porphyrin compounds is often related to two important physiological processes, photosynthesis and respiration, and is strictly regulated in the body, there is a technical bottleneck in the mass production of porphyrin compounds.

[0003] The porphyrin synthesis pathway starts with 5-aminolevulinic acid. In bacteria, 5-aminolevulinic acid can be synthesized in two ways: using glutamyl tRNA as a substrate and using glycine plus succinyl coenzyme A as a substrate. Figure 1 As shown in Figure 1, the porphyrin synthesis pathway is roughly divided into three branches: the prokeratin pathway, the protoporphyrin pathway, and the coproporphyrin pathway. The prokeratin pathway can eventually form siroheme and vitamin B12, the protoporphyrin pathway can form chlorophyll and heme, and the coproporphyrin pathway can form heme.

[0004] Red blood cells play an indispensable role in maintaining human functions. Hemoglobin in red blood cells is a protein that transports oxygen in red blood cells. It is formed by the combination of heme and globulin. Heme is also an indispensable substance for the human body. Heme has four subunits, each of which can combine with a molecule of oxygen to transport oxygen throughout the body. When the human body lacks heme, it will lead to a disease-porphyria. Porphyria is caused by various specific enzyme defects in the heme synthesis pathway, which leads to abnormal production and excretion of porphyrins.

[0005] In addition to relieving the symptoms of porphyria, porphyrin compounds and heme can also be used as human iron supplements. It can be seen that porphyrin compounds and heme are widely used in medical care, food pigments, etc., and have a wide application market.

[0006] However, in the prior art, the production of porphyrin compounds mainly comes from animal tissues and blood, which leads to problems such as limited raw material supply, complicated extraction process, high cost and low production capacity. In terms of biosynthesis, its process is not mature enough.

[0007] Therefore, the field is in urgent need of the emergence of biological methods for high-yield porphyrin compounds to change the current production status of porphyrin compounds. Summary of the invention

[0008] The purpose of the present invention is to provide a strain transformation strategy and an engineered strain for high-yield porphyrin compounds.

[0009] In the first aspect of the present invention, a method for increasing the porphyrin compound production of porphyrin compound-producing bacteria is provided, the method comprising: down-regulating (including deleting) the hemN gene of the porphyrin compound-producing bacteria to obtain a modified producing bacteria; the porphyrin compounds include (but are not limited to): ferroporphyrin III and coproporphyrin III.

[0010] In another aspect of the present invention, a method for producing a porphyrin compound is provided, the method comprising: (a) preparing a modified porphyrin compound-producing bacterium by the method described; (b) culturing the modified porphyrin compound-producing bacterium of (a) to produce a porphyrin compound; the porphyrin compound includes (but is not limited to): ferroporphyrin III and coproporphyrin III.

[0011] In one or more preferred embodiments, the method further comprises: introducing an exogenous expression cassette of hemQ, hemH and hemY genes into the modified hemN gene downregulated producing bacteria; the porphyrin compound includes (but is not limited to): heme, iron coprophyrin III, coprophyrin III. Preferably, the method comprises: (a') preparing a modified porphyrin compound producing bacteria by the method described; (b') culturing the modified porphyrin compound producing bacteria of (a') to produce a porphyrin compound; the porphyrin compound includes (but is not limited to): heme, iron coprophyrin III, coprophyrin III.

[0012] In one or more preferred embodiments, the hemN gene is downregulated by methods including (but not limited to) gene knockout / silencing and gene interference; preferably, the hemN gene is knocked out / silenced by homologous recombination or gene editing.

[0013] In one or more preferred embodiments, the gene editing comprises a CRISPR / Cas method, wherein the Cas is such as Cas9.

[0014] In one or more preferred embodiments, the hemQ, hemH or hemY gene includes (but is not limited to) a gene selected from: Bacillus subtilis 168, C. glutamicum, Mycobacterium tuberculosis, Bacillusanthracis, Staphylococcus aureus or Listeria monocytogenes.

[0015] In one or more preferred embodiments, the hemQ gene is a gene derived from Bacillus subtilis 168 or C. glutamicum; more preferably, the hemQ gene is a gene derived from Bacillus subtilis 168; thereby increasing the yield of heme in the porphyrin compound.

[0016] In one or more preferred embodiments, the hemH or hemY gene is a gene derived from Bacillus subtilis 168.

[0017] In one or more preferred embodiments, the hemQ, hemH and hemY genes are expressed in series in one expression cassette; or independent expression cassettes are established for expression; preferably, the expression cassette includes: a promoter, hemQ, hemH and / or hemY genes, and a terminator that are operably connected.

[0018] In one or more preferred embodiments, when the hemQ, hemH and hemY genes are connected in series, the ribosome binding site is used as a linker.

[0019] In one or more preferred embodiments, the porphyrin compound producing bacteria include bacteria selected from the following groups: photosynthetic bacteria, denitrifying Paracoccus, Bacillus subtilis, Agrobacterium tumefaciens, Sinorhizobium, Methanobacterium barkleyi, Escherichia coli (E. coli) or Corynebacterium glutamicum (C. glutamicum).

[0020] In one or more preferred embodiments, the photosynthetic bacteria include bacteria selected from the group consisting of Rhodobacter sphaeroides, Rhodobacter capsulatus, Rhodobacter nitrogen-fixing or Rhodobacter gelatinosa.

[0021] In one or more embodiments, when the production bacteria are cultured to produce the porphyrin compound, no additional precursor substances are added.

[0022] In one or more embodiments, when the production bacteria are cultured to produce the porphyrin compound, the nitrogen source and the carbon source are mixed carbon and nitrogen sources.

[0023] In one or more embodiments, when the production bacteria are cultured to produce the porphyrin compound, the nitrogen source added is corn steep liquor.

[0024] In another aspect of the present invention, an engineered bacterium for producing a porphyrin compound or a culture containing the engineered bacterium is provided, wherein the hemN gene in the engineered bacterium is downregulated (including deletion); preferably, the downregulation includes downregulating the hemN gene based on gene knockout / silencing or gene interference methods; more preferably, the downregulation includes knocking out / silencing the hemN gene based on homologous recombination or gene editing methods; the engineered bacterium produces porphyrin compounds including ferroporphyrin III and coproporphyrin III;

[0025] In one or more preferred embodiments, the engineered bacteria further include: expression boxes of exogenous hemQ, hemH and hemY genes; and the engineered bacteria produce porphyrin compounds including: heme, iron coproporphyrin III, and coproporphyrin III.

[0026] In another aspect of the present invention, the use of the engineered bacteria in producing porphyrin compounds is provided; the porphyrin compounds include: heme, iron coproporphyrin III, and coproporphyrin III.

[0027] In another aspect of the present invention, a kit for producing a porphyrin compound is provided, comprising the engineered bacteria.

[0028] In another aspect of the present invention, a kit for producing a porphyrin compound is provided, which includes a construct for downregulating (including deleting) the hemN gene of a porphyrin compound-producing bacterium (such as hemN gene knockout / silencing, hemN gene interference reagent, more specifically, a homologous recombination reagent or a gene editing reagent); preferably also includes an expression construct (such as an expression vector) having an expression cassette of hemQ, hemH and hemY genes.

[0029] In another aspect of the present invention, the use of the engineered bacteria in preparing a kit for producing porphyrin compounds is also provided.

[0030] In another aspect of the present invention, a construct for down-regulating (including deleting) the hemN gene of a porphyrin compound producing bacterium is provided, preferably also including the use of an expression construct (such as an expression vector) containing expression cassettes of hemQ, hemH and hemY genes in the preparation of a kit for producing porphyrin compounds.

[0031] Other aspects of the present invention will be apparent to those skilled in the art in view of the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 , porphyrin compound biosynthesis pathway.

[0033] Figure 2 , hemN gene knockout plasmid map.

[0034] Figure 3 , hemN knockout strain to verify primer design.

[0035] Figure 4 , full spectrum scan of fermentation broth supernatant.

[0036] Figure 5 , LC-MS detection of extracellular products of ΔhemN knockout strain;

[0037] (A) Chromatographic peak of fermentation broth supernatant at 390 nm;

[0038] (B) MS results corresponding to product 1;

[0039] (C) MS detection results corresponding to product 2.

[0040] Figure 6 LC-HRMS detection of extracellular products of AE and ΔhemN knockout strains.

[0041] Figure 7 , colony phenotype of ΔhemN heterologous reconstructed strain.

[0042] Figure 8 , comparison of fermentation broth colors of ΔhemN heterologous reconstructed strain.

[0043] Fig. 9 , fermentation results of ΔhemN heterologous reconstructed strain;

[0044] (A) Cell growth and extracellular porphyrin compound concentration;

[0045] (B) Intracellular porphyrin concentrations.

[0046] Fig.10 , Rhodobacter capsulatus and Rhodobacter nitrogen-fixing hemN knockout coproporphyrin III production.

[0047] Fig.11 , protoporphyrin IX and vitamin B12 production. DETAILED DESCRIPTION

[0048] After in-depth research and analysis, the inventors have provided a strategy for transforming strains with high yield of porphyrin compounds. The porphyrin compound producing bacteria are transformed by genetic recombination technology, in which the hemN gene is downregulated or deleted, and preferably, the expression cassettes of exogenous hemQ, hemH and hemY genes are further introduced into the bacteria to obtain engineered bacteria that can efficiently produce target porphyrin compounds.

[0049] The strategy described in the present invention can enable strains that originally do not produce porphyrin compounds to efficiently produce a variety of porphyrin compounds, and is universal in many strains. The transformation strategy described in the present invention provides support for the selection and transformation of porphyrin compound-producing strains, and also provides a new idea for the industrial production of porphyrin compounds.

[0050] As used herein, the "expression cassette" or "gene expression cassette" refers to a gene expression system that contains all the necessary elements required to express the target polypeptide, which generally includes the following elements: a promoter, a gene sequence encoding a polypeptide, and a terminator; in addition, it may optionally include a signal peptide coding sequence, a tag coding sequence, etc.; these elements are operably linked.

[0051] As used herein, the "expression construct" or "expression construct" refers to a recombinant DNA molecule that contains a desired nucleic acid coding sequence, which may contain one or more gene expression cassettes. The "construct" is usually contained in an expression vector.

[0052] As used herein, the term "exogenous" or "heterologous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between a protein (or nucleic acid) and a host cell from different sources. For example, a nucleic acid is exogenous to a host cell if the combination of nucleic acid and host cell does not normally occur in nature. A particular sequence is "exogenous" to a cell or organism into which it is inserted.

[0053] As used herein, the "porphyrin compound" includes ferrocoprophyrin III, coproporphyrin III, heme, etc. The heme is a downstream product of ferrocoprophyrin III or coproporphyrin III. Further, the "porphyrin compound" may also include protoporphyrin IX, hematin, vitamin B12, chlorophyll, etc. The "porphyrin compound" may also be a variation or derivative form based on the compound disclosed in the present invention, for example, the parent core structure of the compound remains unchanged, but a group (such as an aliphatic hydrocarbon group containing 1-4 carbon atoms (preferably 1-2 carbon atoms)) is substituted at individual (such as 1-3, 1-2) positions.

[0054] As used herein, the "coding gene" may be a polynucleotide comprising the protein, or may be a polynucleotide further comprising additional coding and / or non-coding sequences.

[0055] Porphyrin compounds are a class of macromolecular heterocyclic compounds formed by interconnecting the α-carbon atoms of four pyrrole subunits through a methine bridge (=CH-). Its parent compound is porphine, and porphyrins with substituents are called porphyrins. Porphyrins exist in nature in the form of coordination with metal ions, such as heme can be produced by coordination with iron. In some embodiments of the present invention, the porphyrin compounds mainly refer to endogenous porphyrin compounds in organisms, for example, porphyrin compounds involved in the heme synthesis pathway (for example, uroporphyrinogen III, coproporphyrinogen III, protoporphyrinogen IX, protoporphyrin IX, coproporphyrin III, Fe-coproporphyrin III, heme). For example, in purple non-sulfur bacteria, the porphyrin compounds include uroporphyrinogen III, coproporphyrinogen III, protoporphyrinogen IX, protoporphyrin IX, coproporphyrin III, Fe-coproporphyrin III, and heme. In some preferred embodiments, the porphyrin compounds are porphyrin compounds related to heme synthesis, including heme, coproporphyrin III, and Fe-coproporphyrin III.

[0056] In the present invention, first, by down-regulating (including deleting) the hemN gene of the porphyrin compound producing bacteria, the strain that originally does not produce porphyrin compounds can efficiently produce porphyrin compounds, including ferroporphyrin III and coproporphyrin III. The down-regulation can be knocking out the hemN gene or silencing (such as using a gene interference method).

[0057] After knowing the role of the hemN gene as a target regulatory gene, various methods well known to those skilled in the art can be used to reduce the expression of the hemN gene or make it lack expression, such as using homologous recombination technology or gene editing technology to knock out the hemN gene, or delivering an expression unit (such as an expression vector or virus, etc.) carrying an antisense hemN gene to the target site, so that the host bacteria do not express or reduce the expression of HemN protein. Or a down-regulator that down-regulates hemN gene transcription, protein expression or protein activity is transferred into the host bacteria.

[0058] As a preferred embodiment of the present invention, the hemN gene is knocked out by using a homologous recombination method. After the gene knockout target is determined in the present invention, a recombinant vector with the same fragment (homologous arm) is designed for the specific fragments at both ends of the target, and after the recombinant vector is introduced into the host cell, the exogenous recombinant vector and the same fragment in the host cell will undergo homologous recombination, thereby introducing an exogenous gene fragment or deleting part of the gene at the target to achieve gene knockout.

[0059] As another embodiment of the present invention, CRISPR / Cas (such as CRISPR / Cas9) system is used for gene editing to knock out the hemN gene. Suitable sgRNA target sites will bring higher gene editing efficiency. Before embarking on gene editing, it is critical to design and find suitable target sites. After designing specific target sites, in vitro cell activity screening is also required to obtain effective target sites for subsequent experiments. For example, the method of knocking out the hemN gene may include: integrating the coding gene of the Cas enzyme into the host genome, transferring sgRNA or a nucleic acid that can form the sgRNA into the host bacteria, or transferring sgRNA or a nucleic acid that can form the sgRNA, Cas mRNA or a nucleic acid that can form the CasmRNA into the host bacteria; obtaining a transformant strain. After determining the target site, known methods can be used to introduce sgRNA and Cas into the cell.

[0060] The present invention also relates to down-regulators of HemN protein or hemN gene (such as gene knockout reagents, and also such as antisense hemN gene, miRNA, shRNA) and uses thereof.

[0061] Any substance that can downregulate the activity of HemN protein, downregulate the stability of HemN protein, inhibit the expression of HemN protein, reduce the effective action time of HemN protein, or reduce the transcription and translation of hemN gene can be used in the present invention as an effective substance that can be used to transform host bacteria.

[0062] The modes of small molecule interference include, but are not limited to, gene silencing regulated by miRNA, cosuppression caused by sense RNA, antisense RNA inhibition, virus-mediated gene silencing (VIGS), dsRNA, small interfering RNA, hairpin RNA (hpRNA)-mediated gene silencing, etc., which can also be applied to the present invention.

[0063] Furthermore, in the present invention, the expression cassettes of exogenous hemQ, hemH and hemY genes are introduced into the production bacteria in which the modified hemN gene is downregulated; this can effectively increase the production of the target product hemoglobin.

[0064] The hemQ, hemH or hemY gene of the present invention may be naturally occurring, for example, it may be isolated or purified from an animal, plant or microorganism. In addition, the gene may also be artificially prepared, for example, the gene may be obtained according to conventional genetic engineering recombination techniques, or the gene may be obtained by artificial synthesis.

[0065] The nucleotide sequence of the hemQ, hemH or hemY gene may be the same as the specific sequence information provided in the embodiments of the present invention, or may be a degenerate variant thereof. As used herein, "degenerate variant" in the present invention refers to a nucleic acid sequence that encodes a protein with the same function but is different from the specific sequence information selected from the embodiments. The present invention includes the native sequence of the above-mentioned gene, and also includes the sequence after codon optimization. In the present invention, the natural gene sequence is currently used for recombinant expression. It can be expected that the yield can be further improved by optimizing and establishing optimized engineering bacteria using some codon optimization methods known in the art. These further optimization techniques based on the scheme of the present invention should also be included in the technical scheme of the present invention.

[0066] The gene may include: a coding sequence encoding only a mature polypeptide; a coding sequence for a mature polypeptide and various additional coding sequences; a coding sequence for a mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0067] The present invention also relates to variants of the gene, wherein the polypeptide encoded by the gene is different from the corresponding wild-type polypeptide in amino acid sequence and is a fragment, analog or derivative of the wild-type polypeptide. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not substantially change the function of the polypeptide encoded by it.

[0068] The hemQ, hemH or hemY gene of the present invention is preferably obtained from Bacillus subtilis 168, C. glutamicum or Mycobacterium tuberculosis strains. Other genes obtained from other microorganisms or artificially modified or synthesized with high homology (such as having more than 70%, such as 80%, 90%, 95%, or even 98% sequence identity) with the corresponding genes in Bacillus subtilis 168, C. glutamicum or Mycobacterium tuberculosis strains are also within the scope of the present invention. Methods and tools for comparing sequence identity are also well known in the art, such as BLAST.

[0069] The full-length sequence of each gene of the present invention or its fragments can usually be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the relevant nucleotide sequence disclosed in the present invention, especially the open reading frame sequence, and the relevant sequence can be amplified. When the sequence is long, PCR amplification can be performed twice or more, and then the fragments amplified in each time are spliced ​​together in the correct order.

[0070] The present invention also relates to a vector comprising the polynucleotide, and a host cell produced by genetic engineering using the vector.

[0071] In the present invention, the sequence of each gene can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus or other vector well known in the art. In short, any plasmid and vector can be used as long as they can replicate and be stable in the host. An important feature of an expression vector is that it usually contains a replication origin, a promoter, a marker gene and a translation control element.

[0072] The sequence of each gene can be inserted into a recombinant expression vector respectively, and multiple recombinant expression vectors can be co-transfected into a host cell; the expression cassettes of multiple genes can also be inserted into the same recombinant expression vector in a tandem manner and transferred into a host cell. The recombinant expression vector may also contain an expression control sequence operably connected to the sequence of the gene to facilitate the expression of the protein. It should be understood that after those skilled in the art understand the technical content of the present invention, they can conveniently construct a recombinant expression vector. The obtained recombinant expression vector is also included in the present invention.

[0073] In the expression regulatory sequence or expression cassette, an inducible or constitutive promoter can be used according to different needs. The inducible promoter can achieve more controllable protein expression and compound production, which is conducive to industrial application.

[0074] The establishment of expression vector (expression construct) can adopt the technology familiar to those skilled in the art. After knowing the gene of required selection, those skilled in the art can establish expression construct. Gene sequence can be inserted into different expression constructs (such as expression vectors), and can also be inserted into the same expression construct, as long as the polypeptide encoded by it can be effectively expressed and active after being transferred into cells. As a preferred embodiment of the present invention, the expression vector is pBBR1MCSK.

[0075] The host bacteria in which the expression or activity of hemN is downregulated after the above-mentioned manipulation of the host bacteria are also included in the present invention. The starting strain based on the transformation of the present invention may include a strain selected from the following: photosynthetic bacteria, Paracoccus denitrificans, Bacillus subtilis, Agrobacterium tumefaciens, Rhizobium mesoamericanum, Methanosarcina barkeri str. Fusaro, Escherichia coli or Corynebacterium glutamicum.

[0076] In a preferred embodiment, the photosynthetic bacteria are selected from purple non-sulfur photosynthetic bacteria. The purple non-sulfur bacteria can be selected from the genus Rhodobacter and the genus Rhodospirillum.

[0077] In a more preferred embodiment, the photosynthetic bacteria include bacteria selected from the group consisting of Rhodobacter sphaeroides, Rhodobacter capsulatus, Rhodobacter azotoformans, or Rubrivivax gelatinosus. Since hemN has homologous genes in fungi such as the above-mentioned strains, it can be expected that the regulatory factor in these bacteria should have the same or similar functions. Photosynthetic bacteria, because they can obtain energy to maintain growth through photosynthesis, chemoheterotrophy, and autotrophy, need to synthesize a large amount of photosynthetic pigments such as bacterial chlorophyll and carotenoids for electron transfer during photosynthesis. In the present invention, porphyrin compounds are produced by metabolic engineering.

[0078] In other embodiments, the host bacteria is Escherichia coli (E. coli), yeast or Corynebacterium glutamicum (C. glutamicum), and the host bacteria can produce porphyrin compounds through metabolic engineering and / or with the help of naturally occurring synthetic pathways therein, and at the same time, the hemN gene is down-regulated in the host bacteria; or exogenous hemQ, hemH and hemY genes are introduced. E. coli is used as a model organism, which grows faster and has simple genetic manipulation methods. C. glutamicum is a natural production strain of glutamic acid, a strain for industrial production of various amino acids and food additives, and can be used for the production of porphyrin compounds through metabolic engineering.

[0079] The starting strain on which the transformation of the present invention is based can be a wild-type strain, a genetically engineered strain and / or a chemically mutated strain.

[0080] The present invention also provides a kit for biosynthesis of porphyrin compounds, which includes: the engineered bacteria modified in the present invention. Alternatively, it includes a construct for downregulating (including deleting) the hemN gene of the porphyrin compound producing bacteria (such as hemN gene knockout / silencing, hemN gene interference reagent, more specifically, homologous recombination reagent or gene editing reagent); preferably also includes an expression construct (such as an expression vector) with an expression cassette of hemQ, hemH and hemY genes.

[0081] Other reagents commonly used for gene regulation or transgenic operation may also be included in the kit to facilitate the use of those skilled in the art. In addition, the kit may also include instructions for use to guide those skilled in the art.

[0082] The present invention solves the problems existing in the traditional biological and chemical synthesis methods to a large extent, and provides a new idea for the industrial production of porphyrin compounds. In particular, the present invention realizes the successful expression of a variety of porphyrin compounds in engineered bacteria, which is closer to the natural processing mode in its synthesis pathway, ensuring the efficient production of porphyrin compounds.

[0083] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning Experiment Guide, 3rd Edition, Science Press, or according to the conditions recommended by the manufacturer.

[0084] Example 1: Construction and screening of hemN gene knockout strains

[0085] Using Rhodobacter sphaeroides (ATH2.4.1) as the starting strain, a hemN gene knockout strain was established by homologous recombination. The left and right homologous arms of hemN (hemN-left, hemN-right) are fragments extending 500bp outward from the hemN gene. Using the Rhodobacter sphaeroides genome as a template, GXL polymerase was used to amplify the left and right homologous arms of hemN, and the amplification primers were introduced at both ends of the left and right homologous arms, respectively, with 20bp overlapping with the adjacent fragments; the resistance screening marker was AmpR, and AmpR and lox sites were amplified with GXL polymerase, and 20bp overlapping with the adjacent fragments were introduced with amplification primers. The fragment was prepared, and the sequence of the fragment is as follows:

[0086] hemN-left (SEQ ID NO:6):

[0087] ATCGGAGCTGCGAACGATCTGCGCGAGATGATCGCGGCCTTCGACTGCGGCGCGCGGAGCTACCTGCCCTCGTCGGTGGGGATCGACGATATCGTCGAGGCGAGCCGCCTTGCGACCTTCGACGGGATCTTCCTGCCGACCGCCAGTCTCACGGCGCTGCGCGGCGCCCTGCCCGATCGGGCAGAGCCGCAGATCGCCGTGGACGAGCATCTGACCGAGCGCCAGCGGGCCGTCTGCGACGCGCTCCGCCGGGGCAAGTCCAACAAGATCATCGCCGGAGAGCTCAATCTCTGCGAAAGCACGGTGAAGGTCCATATCCGCAACATCATGAAGAAGCTCGGGGCGAAGAACCGCACCGAGGCTGCCTTCAAGCTGAATTCCAGCATGTTCGCGGGAGAAGGTCGCCTCTCCTGAGCCGGAGCGGCGGATGCCCCGGCCCCCTCGGGGGCCGGGGCATTGCCTTTCACGAGGCCTGCGAGTAGCGGGCTTCCGGCGTCTCGTAGGC

[0088] hemN-Right(SEQ ID NO:7):

[0089] AGGAGGGCGATGTTTGTCATGCTGAACCCAATAACGGTTTCACGAGACGTTAGACTTTGCGCAGGATCAAACGCCCCGGACAGGGTGTCGCAGGCTAGAGCGGCAGCGGCGAGACGCCCAGCAGGATCGGATGCAGCGTCAGCGCCGCGGCCCAGAGCGCCACGACCGCCAGAAGCCGCGGGAAGAGATGGTCCTCGTTCTGCTTCAGCCAGTGCGCATCGACCAGCGGGCGCAG CGAGAAGAGCGCGGTGGCCCCGAAGGCCGCGAGCGCCTCGACCGGCGTCAGGGCGGCGGCGGGCCCGGGCGTCGAACATCGGGATGGCCGCCAGCGAGAGGCCGAAGAAGGTGCCGAACAGGATGACATGCGCCAGATCGCCGTTCGGAAAAAGATGGGCCGCCGACCAGAGCATCAAGGCGATCAGCAGCGGGTGGCGCGTGATGGCCGCAAAGCCCGGCCGCTCGGGATCGAAA

[0090] The commercial vector pk18mobsacB was linearized using restriction enzymes BamHI and EcoRI. The prepared fragments were assembled by nova Rec plus one-step recombinase to obtain pk18mobsacB-hemN (abbreviated as pk18-hemN). The plasmid schematic is shown in Figure 2 shown.

[0091] The obtained pk18mobsacB-hemN was transferred into DH10b competent cells, and transformants were picked after overnight culture. The transformants were verified by bacterial liquid PCR and sent for sequencing after plasmid size comparison.

[0092] The knockout plasmid pk18mobsacB-hemN that was verified and sequenced correctly was introduced into Rhodobacter sphaeroides by conjugative transfer, and multiple rounds of screening were performed on sucrose culture plates. The strain with successful hemN knockout was obtained by colony PCR verification.

[0093] Double-crossover PCR verification of hemN knockout strains Figure 3As shown, PCR verification was performed using two pairs of verification primers: PCR verification was performed using two pairs of verification primers: Primer pair 1 was designed on the AmpR resistance gene to be exchanged, and the second pair of primers was designed on the kanaR resistance gene of the pk18mobsacB plasmid backbone. When only a single exchange occurred, both genes could be amplified, and when only a double exchange occurred, only the AmpR resistance gene could be amplified. When the double exchange reverted to the wild type, neither resistance gene could be amplified.

[0094] The primer pair sequences are shown in Table 1.

[0095] Table 1

[0096]

[0097] Finally, multiple double-exchange strains were obtained after screening and PCR verification, including strains named ΔhemN-1, ΔhemN-2, and ΔhemN-3. The three strains were derived from different monoclonal clones and the double exchange was verified. Fermentation tests were performed and the porphyrin compound production of the three strains was similar. ΔhemN-3 was selected for subsequent analysis.

[0098] Example 2. Shake flask fermentation results of hemN knockout strain (ΔhemN) and product analysis and identification

[0099] 1. Strain fermentation and product color analysis

[0100] The ΔhemN strain of Rhodobacter sphaeroides was subcultured for 2 generations to stabilize its properties. After knocking out the hemN gene, the colony color changed from the original dark green to a lighter dark green, and dark red secretions appeared in the culture medium. The colonies were picked for shake flask fermentation.

[0101] Shake flask fermentation process: 4% glucose, 0.4% corn steep liquor powder, 0.3% sodium glutamate, 0.3% (NH4)2SO4, 0.28% NaCl, 0.3% KH2PO4 and 0.63% MgSO4, after adjusting pH to 6.5-6.9, add 0.2% CaCO3. During fermentation, add 1mg / L thiamine hydrochloride, 1mg / L nicotinic acid and 15μg / L biotin, and culture at 32℃, 220rpm for 48h.

[0102] The results are as follows Figure 4 As shown in Table 2, after shake flask fermentation for 48h, the color of the fermentation broth of the knockout strain ΔhemN changed significantly. The color of the fermentation broth of the control strain WT was dark green, while the color of the fermentation broth of the ΔhemN strain turned dark red. After centrifugation of the fermentation broth, the WT supernatant was light yellow, and the dark green was the color of the bacteria itself; while the supernatant of the ΔhemN strain was still dark red, indicating that after the hemN gene was knocked out, new compounds were produced and secreted outside the cell.

[0103] Table 2

[0104]

[0105] At the same time, the phenomenon presented in the fermentation broth of shake flask culture was consistent with the secretion of dark red substances during ΔhemN plate culture.

[0106] 2. LC-MS analysis

[0107] The supernatant of the fermentation broth of R. sphaeroides WT and ΔhemN strains was filtered through a 0.22 μm microporous filter membrane and then subjected to LC-MS analysis.

[0108] like Figure 5 As shown in A, the knockout strain ΔhemN has two more absorption peaks than the control strain, and the ultraviolet absorption peak shapes of these two peaks are consistent, indicating that the two substances are of the same type.

[0109] like Figure 5 As shown in BC, the positive and negative source ion peaks of the two substances were extracted. The positive and negative source ion peaks of substance 1 were 706.6 and 708.1, respectively, and the positive and negative source ion peaks of substance 2 were 653.1 and 655.3, respectively. Therefore, the molecular weights of substance 1 and substance 2 were 708 and 654, respectively, which were consistent with the molecular weights of ferroporphyrin III and coproporphyrin III.

[0110] 3. LC-HRMS detection

[0111] In order to further confirm the above two compounds, LC-HRMS was performed on the supernatant of the fermentation broth of R. sphaeroides ΔhemN.

[0112] The results are as follows Figure 6 As shown in Figure 1, there are two obvious absorption peaks at 370nm, and the ion chromatograms with molecular weights between 654.5-655.5 and 707.5-708.5 are extracted. The extracted ion chromatograms are compared using QE software. The absorption intensity of peak 1 reaches 2.99E8, the molecular weight is 708.71133, and the chemical structure is compared to C 36 H 36 O8N4Fe, which is consistent with the molecular formula of ferrocoprophyrin III. The absorption intensity of peak 2 is 2.37E9, the molecular weight is 655.26074, and the chemical structure comparison is C 36 H 39 O8N4, which is consistent with the molecular formula of coproporphyrin III.

[0113] After the above LC-HRMS analysis, after knocking out the hemN gene, a large amount of dark red substances secreted in the supernatant of the fermentation broth of the strain were coproporphyrin III and ferroporphyrin III.

[0114] Therefore, the WT strain does not produce visible coproporphyrin III and ferrocoproporphyrin III; while the strain after knocking out the hemN gene secretes more than 1000 mg / L of coproporphyrin III in the supernatant, and the accumulation of ferrocoproporphyrin III can reach 10 mg / L.

[0115] The inventors also detected the presence of protoporphyrin IX and vitamin B12 as porphyrin compounds in the fermentation broth supernatant. Fig.11 The WT strain produced very low amounts of protoporphyrin IX and vitamin B12, while the strain after knocking out the hemN gene also had a very significant increase in the production of protoporphyrin IX and vitamin B12.

[0116] 4. Establishment and production of hemN gene knockout strains of Rhodobacter capsulatus and Rhodobacter azotobacter

[0117] Using Rhodobacter capsulatum (SB1003) as the starting strain, the same method as in Example 1 was used to establish a Rhodobacter capsulatum strain with hemN gene knockout by homologous recombination.

[0118] Using Rhodobacter azotobacter (SY5) as the starting strain, the same method as in Example 1 was used to establish a Rhodobacter azotobacter strain with hemN gene knockout by homologous recombination.

[0119] The extracellular secretion of coproporphyrin III of the transformed strain and the wild-type strain is as follows Fig.10 As shown, Rhodobacter capsulatus and Rhodobacter nitrogen-fixing were able to produce high coproporphyrin III production after hemN knockout.

[0120] Example 3: Heterologous reconstruction of the heme pathway in ΔhemN strain

[0121] In the ΔhemN strain, hemQ from different sources were co-expressed with hemH or expressed in tandem with hemY and hemH. HemQ was derived from Bacillus subtilis 168, C. glutamicum, and Mycobacterium tuberculosis (respectively abbreviated as BsQ, CgQ, and MtQ), and hemY and hemH were derived from B. subtilis 168, and could also be derived from C. glutamicum and Mycobacterium tuberculosis.

[0122] The hemQ (BsQ) sequence used for the construction is (SEQ ID NO: 1):

[0123] ATGAGCGAGCAGCAGATGACGAACGAGGCGGCCAAGACCCTGGACGGCTGGTATGCCCTGCACGACTTCCGCACGATGGACTGGGCGTCGTGGAAGCTGCTCTCGTCGGACGAGCGCCAGTCGATCATCCACGAGTTCACCGGCCTGCTCGAGAAGTGGGGCGTGGCCCAGAAGGAGGGCAAGGGCTCGCAGACGCTGTACTCGATCGTGGGCCAGAAGGCGGACTTCATGCTGATGATCCTCCGCCCGACCATGGAGGAGCTGAACCAGATCGAGCTGGAGTTCAACAAGTCGCGCCTCGCCGAGTTCACGATCCCCGCGTACTCGTATGTGTCGGTGGTGGAGCTGTCGAACTACCTCGCCTCGGGCGACGGCGACCCGTATGAGAACCCCCACGTGCGTGCCCGCCTGTACCCGGAGCTGCCCGAGTCGAAGTACGTGTGCTTCTATCCGATGGACAAGCGCCGCTCGGGCAACGACAACTGGTATATGCTGTCGATGGAGGAGCGCCGCAACCTGATGCGCTCGCATGGCCTCATCGGCCGCTCGTACGCCGGCAAGGTGAAGCAGATCATCACCGGCTCGGTGGGCTTCGACGACTATGAGTGGGGCGTGACGCTCTTCTCGGACGACGTGCTGCAGTTCAAGAAGCTCGTGTACGAGATGCGCTTCGACGAGGTGTCGGCGCGCTATGGCGAGTTCGGCTCGTTCTTCGTCGGCAACCACCTGAGCCTGGACACCCTCCCGCAGTTCCTCTACGTCTGA

[0124] The hemQ (CgQ) sequence for construction is (SEQ ID NO:2):

[0125] ATGAGCGAACTCGACATCAAGCAGCTGAACAAACTGCAGCGCTATAGCCAGTGGGCGGTGTTCCGCGCGATCCCGGGCGCGCTGGACGACGATCGCCGCGAGGTGACCGAGCAGGCGGCCAAGTTCTTCGCCGACCTCGAGGCCGAGGGCAAGGTCACCGTGCGCGGCATCTACAACGCCTCGGGGCTCCGGGCGGATGCTGATTACATGATCTGGTGGCACGCCGAGGAATTCGAGGATATCCAGAAGGCCTTTGCCGACTTCCGGCGCACCACGATCCTCGGACAGGTCTCGGAGGTCTTCTGGATCGGCAATGCCCTCCACCGGCCGTCCGAGTTCAACAAGGCGCATCTTCCCAGCTTCATTATGGGCGAGGAGGCGAAGGACTGGATCACCGTCTATCCCTTCGTGCGTTCCTACGACTGGTATATCATGGAGCCGCTGAAGCGCTCGCGGATCCTGAGGGAGCACGGGCAGGCCGCGGTCGAGTTCCCCGACGTGCGCGCCAACACGGTGCCGGCCTTCGCGCTCGGCGACTATGAATGGGTTCTCGCCTTCGAGGCAGACGAGTTGCATCGCATCGTGGATCTGATGCACAAGATGCGCTACACGGAGGCGCGGCTCCATGTGCGGGAAGAGCTGCCGTTCATCTCGGGCCAACGGGTCGACATCGCGGACCTGATCAAGGTGCTGCCCTAA

[0126] The hemQ (MtQ) sequence for construction is (SEQ ID NO:3):

[0127] ATGGCCCGGCTGGACTACGACGCGCTGAACGCGACGCTGCGCTACCTCATGTTCTCCGTCTTCTCGGTCTCGCCGGGCGCGCTCGGCGATCAGCGCGACGCGATCATCGACGACGCCTCGACCTTCTTCAAGCAGCAGGAGGAGCGCGGAGTCGTGGTGCGCGGGCTCTACGATGTGGCGGGGTTGCGTGCCGATGCGGATTTCATGGTGTGGACGCATGCGGAACGGGTCGAGGCGCTGCAGGCCACCTATGCCGACTTCCGGCGCACCACCACGCTCGGGCGCGCCTGCACCCCGGTCTGGTCGGGCGTGGGCCTGCACCGCCCTGCTGAGTTCAACAAGAGCCATATCCCGGCCTTCCTCGCGGGCGAGGAGCCCGGTGCCTATATCTGCGTCTATCCCTTCGTCCGCAGCTACGAGTGGTATCTCCTGCCCGACGAGGAACGCAGGCGGATGCTGGCCGAGCACGGCATGGCGGCCCGCGGCTACAAGGACGTGCGGGCCAATACGGTGCCCGCGTTTGCCCTTGGCGACTATGAATGGATCCTCGCCTTCGAGGCCCCCGAGCTCGACCGGATCGTGGATCTGATGCGCGAGCTGCGGGCGACCGACGCACGACGCCACACGCGCGCGGAGACGCCGTTCTTCACCGGCCCGCGGGTGCCGGTGGAGCAGCTCGTGCATTCCCTGCCGCTCGAGTGA

[0128] The hemH sequence for construction is (SEQ ID NO:4):

[0129] GAGCTCGTGTCGCGCAAGAAGATGGGCCTGCTCGTGATGGCCTACGGCACCCCGTATAAGGAGGAGGACATCGAGCGCTACTATACGCACATCCGCCGCGGCCGCAAGCCGGAGCCCGAGATGCTGCAGGACCTCAAGGACCGCTACGAGGCCATCGGCGGCATCTCGCCCCTGGCCCAGATCACCGAGCAGCAGGCGCACAACCTGGAGCAGCATCTCAACGAGATCCAGGACGAGATCACGTTCAAGGCGTATATCGGCCTGAAGCACATCGAGCCGTTCATCGAGGACGCCGTGGCGGAGATGCATAAGGACGGCATCACCGAGGCCGTGTCGATCGTGCTCGCGCCCCATTTCTCGACGTTCTCGGTGCAGTCGTACAACAAGCGCGCCAAGGAGGAGGCGGAGAAGCTGGGCGGCCTCACCATCACGTCGGTGGAGTCGTGGTACGACGAGCCGAAGTTCGTGACCTATTGGGTGGACCGCGTGAAGGAGACGTATGCGTCGATGCCGGAGGACGAGCGCGAGAACGCCATGCTGATCGTGTCGGCGCACTCGCTCCCCGAGAAGATCAAGGAGTTCGGCGACCCGTACCCCGACCAGCTGCATGAGTCGGCCAAGCTCATCGCCGAGGGCGCGGGCGTGTCGGAGTATGCGGTGGGCTGGCAGTCGGAGGGCAACACCCCGGACCCCTGGCTGGGCCCGGACGTGCAGGACCTGACGCGCGACCTCTTCGAGCAGAAGGGCTACCAGGCCTTCGTGTATGTGCCCGTGGGCTTCGTGGCGGACCACCTGGAGGTGCTCTACGACAACGACTATGAGTGCAAGGTGGTGACCGACGACATCGGCGCCTCGTACTATCGCCCGGAGATGCCCAACGCGAAGCCGGAGTTCATCGACGCCCTCGCGACGGTGGTGCTGAAGAAGCTCGGCCGCTGAGGATCC

[0130] The hemY sequence for construction is (SEQ ID NO:5):

[0131]

[0132] The plasmid was constructed using pBBR1MCSK-new (based on the commercial tool plasmid pBBR1MCS-5, with a tac promoter added in front of MCS, the sequence of the tac promoter is TTGACAATTAATCAT CGGCTCGTATAATG) as the vector, driven by the P7571 promoter (an endogenous promoter of Rhodobacter sphaeroides, see the literature Synth Syst Biotechnol. 2021; 6(4): 335-342), and adjacent genes were connected by the ribosome binding site (RBS) introduced during amplification.

[0133] The coding sequence of RBS is: GACACCGGAGGACCCCTTAA (SEQ ID NO: 12).

[0134] The plasmids verified by PCR and sequencing were electroporated into ΔhemN, and the electroporated transformants were selected after 4-5 days of verification and subcultured for two generations.

[0135] The strains obtained are as follows:

[0136] ΔhemN-BsHQ: a tandem hemH-hemQ (BsQ) was introduced;

[0137] ΔhemN-HCgQ: introduced tandem hemH-hemQ (CgQ);

[0138] ΔhemN-HMtQ: a tandem hemH-hemQ (MtQ) was introduced;

[0139] ΔhemN-BsYHQ: a tandem hemY-hemH-hemQ (BsQ) was introduced;

[0140] ΔhemN-YHCgQ: introduced tandem hemY-hemH-hemQ (CgQ);

[0141] ΔhemN-YHMtQ: A tandem hemY-hemH-hemQ(MtQ) was introduced.

[0142] Plate medium: 0.3% glucose, 0.8% yeast extract, 0.2% NaCl, 0.13% KH2PO4, 0.0125% MgSO4 and 1.5% agar, and add 15mg / L biotin, 1mg / L thiamine hydrochloride and 1mg / L nicotinic acid, culture for 6-7 days, the picture shows the strain photographed on the 7th day. The colony phenotype of the heterologous reconstructed strain of ΔhemN is as follows Figure 7As shown in the figure, no matter which strain hemQ comes from, when hemQ and hemH are co-expressed, the colony phenotype is dark green. When hemH, hemH and hemQ are expressed in tandem, the colony phenotype turns pink.

[0143] In order to verify whether the heterologous reconstruction of ΔhemN can increase the heme production, a single clone from the above plate was picked for shake flask fermentation (the fermentation method was the same as in Example 2). The color change of the fermentation broth of the ΔhemN heterologous reconstruction strain in shake flask fermentation was as follows: Figure 8 As shown (shake flask fermentation for 48 hours, measured after the end of fermentation), compared with the control group ΔhemN and ΔhemN::pBBR, the strains co-expressing hemQ and hemH had little change in the color of the fermentation supernatant and the color of the bacteria, while the supernatant color of the strains expressing the three genes hemY, hemH and HemQ in tandem became lighter, especially the supernatant color of the strains ΔhemN-BsYHQ and ΔhemN-YHCgQ obviously turned light yellow, while the color of their bacteria was pink.

[0144] After pre-treatment of the fermentation broth and bacterial cells of the reconstructed strain, porphyrin compounds were quantified using HPLC.

[0145] like Fig. 9 A, The results of shake flask fermentation at 48h showed that all strains could achieve effective growth. Compared with ΔhemN, the strains with high expression of hemH and hemQ at the same time had no significant changes in the content of extracellular coproporphyrin III (CP III) and iron coproporphyrin III (Fe-CP III), while the strains expressing hemY, hemH and hemQ in series at the same time had a decrease in coproporphyrin III and a significant increase in iron coproporphyrin III, among which the extracellular iron coproporphyrin III content of ΔhemN-BsYHQ could reach 19mg / L.

[0146] Fig. 9 B, shake flask fermentation to 48h, determine the concentration of intracellular porphyrin compounds. The results showed that the intracellular porphyrin compound content of strains with high expression of both hemH and hemQ did not change much; while the intracellular ferrocoprophyrin III content of ΔhemN-BsYHQ and ΔhemN-YHCgQ was greatly increased, and the heme concentration increased to 4.5mg / L and 3mg / L, respectively, which was 9 times and 6 times higher than that of ΔhemN. The intracellular coproporphyrin III concentration of ΔhemN-YHMtQ was relatively high, and the ferrocoprophyrin III produced was less than that of the first two, and its intracellular heme content was 2 times higher than that of ΔhemN.

[0147] From the above results, it can be concluded that only when hemH, hemH and hemQ are expressed in tandem in ΔhemN can the accumulated coproporphyrin be more efficiently utilized to generate the final product heme.

[0148] This strategy of knocking out the hemN gene in the strain and introducing genes in the heterologous porphyrin synthesis pathway can achieve the goal of efficiently producing corresponding porphyrin compounds, including but not limited to heme, ferroporphyrin III, protoporphyrin IX, hemoglobin, vitamin B12, and chlorophyll.

[0149] Summarize

[0150] The present invention first knocks out the hemN gene. The phenotype of the hemN knockout colony is quite different from that of the wild type. The fermentation supernatant is subjected to full spectrum scanning, LC-MS analysis and LC-HRMS analysis, and it can be detected that the products are mainly coproporphyrin III and ferroporphyrin III, and the coproporphyrin III secreted extracellularly by the ΔhemN strain in shake flask fermentation can reach 1.2 g / L, which is the highest level known so far.

[0151] Heterologous reconstruction of the downstream pathway of coproporphyrin III using hemQ, hemY and hemH from different sources for ΔhemN can increase the yield of heme, the downstream product of coproporphyrin III, to 4.5 mg / L. This modification strategy can be applied to other porphyrin compounds in the high-yield porphyrin metabolic pathway.

[0152] This strategy of the present invention points out a new direction for the biosynthesis of porphyrin compounds.

[0153] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims. At the same time, all the documents mentioned in the present invention are cited as references in the present invention, just as each document is cited as reference separately.

Claims

1. A method for increasing the yield of a porphyrin compound produced by a porphyrin compound producing bacterium, characterized in that: The method comprises: down-regulating the hemN gene of porphyrin compound production bacteria to obtain modified production bacteria; the porphyrin compound comprises: ferroporphyrin III and coproporphyrin III.

2. The method according to claim 1, characterized in that Also includes: Introducing the expression cassettes of exogenous hemQ, hemH and hemY genes into the production bacteria in which the hemN gene is downregulated; The porphyrin compounds include: heme, ferroporphyrin III, and coproporphyrin III.

3. A method for producing a porphyrin compound, characterized in that: The method comprises: (a) preparing a modified porphyrin compound-producing bacterium by the method of claim 1; (b) culturing the modified porphyrin compound-producing bacterium of (a) to produce a porphyrin compound; the porphyrin compound comprises: ferroporphyrin III, coproporphyrin III; or The method comprises: (a') preparing a modified porphyrin compound producing bacterium by the method described in claim 2; (b') culturing the modified porphyrin compound producing bacterium of (a') to produce porphyrin compounds; the porphyrin compounds comprise: heme, iron coproporphyrin III, and coproporphyrin III.

4. The method according to any one of claims 1 to 3, characterized in that: The hemN gene is downregulated by methods including gene knockout / silencing and gene interference; preferably, the hemN gene is knocked out / silenced by homologous recombination or gene editing.

5. The method according to any one of claims 2-3, characterized in that: The hemQ, hemH or hemY gene includes genes derived from Bacillus subtilis 168, C. glutamicum, Mycobacterium tuberculosis, Bacillusanthracis, Staphylococcus aureus or Listeria monocytogenes; Preferably, the hemQ gene is a gene derived from Bacillus subtilis 168 or C. glutamicum; more preferably, the hemQ gene is a gene derived from Bacillus subtilis 168; thereby increasing the yield of heme in the porphyrin compound; Preferably, the hemH or hemY gene is a gene derived from Bacillus subtilis 168.

6. The method according to claim 2 or 3, characterized in that: The hemQ, hemH and hemY genes are expressed in series in one expression cassette; or they are expressed in separate expression cassettes; preferably, the expression cassette includes: a promoter, hemQ, hemH and / or hemY genes, and a terminator in operable connection.

7. The method according to any one of claims 1 to 3, characterized in that: The porphyrin compound producing bacteria include bacteria selected from the following group: photosynthetic bacteria, denitrifying Paracoccus, Bacillus subtilis, Agrobacterium tumefaciens, Sinorhizobium, Methanobacterium barkleyi, Escherichia coli or Corynebacterium glutamicum; preferably, the photosynthetic bacteria include bacteria selected from the following group: spherical red bacteria, capsule red bacteria, nitrogen-fixing red bacteria or gelatinous red longevity bacteria.

8. An engineered bacterium for producing a porphyrin compound or a culture containing the engineered bacterium, wherein the hemN gene in the engineered bacterium is down-regulated; preferably, the down-regulation includes down-regulating the hemN gene based on gene knockout / silencing or gene interference methods; more preferably, the down-regulation includes knocking out / silencing the hemN gene based on homologous recombination or gene editing methods; The engineered bacteria produce porphyrin compounds including ferroporphyrin III and coproporphyrin III; Preferably, the engineered bacteria further comprises: an expression box of exogenous hemQ, hemH and hemY genes; and the engineered bacteria produces porphyrin compounds including: heme, iron coproporphyrin III, and coproporphyrin III.

9. Use of the engineered bacteria according to claim 8 in producing a porphyrin compound; the porphyrin compound comprises: Heme, iron, coproporphyrin III, coproporphyrin III.

10. A kit for producing a porphyrin compound, characterized in that: Which comprises the engineered bacteria as described in claim 8; or The invention includes a construct for down-regulating the hemN gene of a porphyrin compound-producing bacterium; preferably, the construct also includes an expression construct having an expression cassette of hemQ, hemH and hemY genes.

Images