Gene detection method based on CRISPR and HCR coupling technology

Abstract

The invention discloses a detection reagent and a detection method based on the detection reagent, the detection reagent comprises an HCR sequence and a CRISPR RNP compound, the CRISPR RNP compound comprises Cas9 nickase and sgRNA, the sgRNA is specific sgRNA aiming at a target sequence, and the CRISPR RNP compound can be specifically combined with the target sequence; and the hairpin recognition probe is a stem-loop hairpin probe, the hairpin recognition probe can be combined with a single chain generated by cutting the target sequence by the Cas9 nickase and opened, and the opened hairpin recognition probe is used as an initiation chain to initiate an HCR reaction of the HCR sequence, so that the target sequence is obtained. The detection method based on the detection reagent can realize novel nucleic acid detection which is simple, convenient, efficient, high in sensitivity and even capable of realizing single base difference distinguishing.

Description

Technical Field

[0001] The present invention relates to the field of nucleic acid detection technology, and in particular to a gene detection method based on CRISPR and HCR combined technology. Background Art

[0002] Currently, the research on single-base mutation detection methods is very active, and these methods are of great significance in the fields of cancer diagnosis, genetic disease screening and personalized treatment. However, existing methods have problems such as low sensitivity, complex operation and high sample purity requirements, which limit their widespread application in clinical practice.

[0003] The CRISPR system has unique advantages in nucleic acid detection. First, accurate identification of different target sequences can be achieved by designing sgRNA, which is flexible and targeted. Secondly, compared with digital PCR or sequencing methods, the cost of the CRISPR system is lower. In addition, the CRISPR system can efficiently identify target sequences in a short time, and can play different functions by selecting different Cas effector proteins, which has strong designability. However, relying solely on the CRISPR system may be affected by its own off-target effects, thereby reducing the detection accuracy.

[0004] Therefore, it is of great significance to develop a new nucleic acid detection method that is simple, efficient, highly sensitive and can even distinguish single-base differences. Summary of the invention

[0005] The present invention aims to solve at least one of the above-mentioned technical problems existing in the prior art. To this end, the purpose of the present invention is to provide a gene detection method based on CRISPR and HCR combined technology, which can achieve single base difference differentiation.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] The first aspect of the present invention provides a detection reagent, comprising:

[0008] HCR sequence, including DNA H1 monomer sequence and DNA H2 monomer sequence;

[0009] A CRISPR ribonucleoprotein (RNP) complex, comprising a Cas9 nickase and sgRNA, wherein the sgRNA is a specific sgRNA for a target sequence, and the CRISPR RNP complex can specifically bind to the target sequence;

[0010] A hairpin recognition probe, wherein the hairpin recognition probe is a stem-loop hairpin probe, and the hairpin recognition probe can bind to the single strand produced by the Cas9 nickase cutting the target sequence and be opened, and the opened hairpin recognition probe serves as a triggering strand to trigger the HCR sequence to undergo an HCR reaction.

[0011] In the present application, Cas9 nickase refers to Cas9 in which one of the two nuclease domains is inactivated, and this enzyme can only cut one strand of the target DNA. Cas9 nickase is a Cas9 containing one or more mutations in the RuvC-like domain or the HNH-like domain relative to the wild-type Cas9 sequence or relative to the equivalent amino acid position in other Cas9 variants or Cas9 equivalents. For example, Cas9 nickase is a Cas9 containing aspartate to alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 relative to the typical Cas9 sequence or relative to the equivalent amino acid position in other Cas9 variants or Cas9 equivalents. Or Cas9 nickase is a Cas9 containing H840A, N854A and / or N863A mutations relative to the typical Cas9 sequence or relative to the equivalent amino acid position in other Cas9 variants or Cas9 equivalents.

[0012] In one or more embodiments, the DNA H1 monomer sequence is:

[0013] TTTTAGGCTAGACTACAACTCAGATCCAGAGTTGTAGTCTAGCT;

[0014] The DNA H2 monomer sequence is:

[0015] GAGTTGTAGTCTAGCTCTAAAAAGCTAGACTACAACTCTGGATCT;

[0016] The sgRNA sequence is:

[0017] UCUAGCUCUAAAACGUAGUUGGAGCUGGUGGGUUUUAGAGCUAGACUACAACU;

[0018] The hairpin recognition probe sequence is:

[0019] AGTTGTAGTCTAGCTCTAAAACCCACCAGCTCCAACTACGTTTTAGAGCTAGA;

[0020] AGTTGTAGTCTAGCTCTAAAACCCATCAGCTCCAACTACGTTTTAGAGCTAGA; or

[0021] AGTTTGTAGTCTAGCTCTAAAACCCACAAGCTCCAACTACGTTTTAGAGCTAGA.

[0022] In one or more embodiments, the DNA H1 monomer sequence is:

[0023] TTTTAGGCTAGACTACAACTCAGATCCAGAGTTGTAGTCTAGCT;

[0024] The DNAH2 monomer sequence is:

[0025] GAGTTGTAGTCTAGCTCTAAAAAGCTAGACTACAACTCTGGATCT;

[0026] The sgRNA sequence is:

[0027] UCUAGCUCUAAAACGUAGUUGGAGCUGGUGGGUUUUAGAGCUAGACUACAACU;

[0028] The hairpin recognition probe sequence is:

[0029] AGTTGTAGTCTAGCTCTAAAACCCACCAGCTCCAACTACGTTTT AGAGC TAGA;

[0030] In one or more embodiments, the DNA H1 monomer sequence is:

[0031] TTTTAGGCTAGACTACAACTCAGATCCAGAGTTGTAGTCTAGCT;

[0032] The DNAH2 monomer sequence is:

[0033] GAGTTGTAGTCTAGCTCTAAAAAGCTAGACTACAACTCTGGATCT;

[0034] The sgRNA sequence is:

[0035] UCUAGCUCUAAAACGUAGUUGGAGCUGGUGGGUUUUAGAGCUAGACUACAACU;

[0036] The hairpin recognition probe sequence is:

[0037] AGTTTGTAGTCTAGCTCTAAAACCCATCAGCTCCAACTACGTTTTAGAGCTAGA.

[0038] In one or more embodiments, the DNAH1 monomer sequence is:

[0039] TTTTAGGCTAGACTACAACTCAGATCCAGAGTTGTAGTCTAGCT;

[0040] The DNAH2 monomer sequence is:

[0041] GAGTTGTAGTCTAGCTCTAAAAAGCTAGACTACAACTCTGGATCT;

[0042] The sgRNA sequence is:

[0043] UCUAGCUCUAAAACGUAGUUGGAGCUGGUGGGUUUUAGAGCUAGACUACAACU;

[0044] The hairpin recognition probe sequence is:

[0045] AGTTTGTAGTCTAGCTCTAAAACCCACAAGCTCCAACTACGTTTTAGAGCTAGA.

[0046] The second aspect of the present invention provides a fluorescent biosensor, comprising the detection reagent provided in the first aspect and a fluorescent dye.

[0047] In one or more embodiments, the fluorescent dye includes any one of SYBR GREEN Ⅰ fluorescent dye, EveGreen, and SYTO 9.

[0048] The third aspect of the present invention provides a gene detection method based on the CRISPR and HCR combined technology, using the detection reagent provided in the first aspect, comprising:

[0049] The CRISPR RNP complex is mixed with the test sample and incubated to form a CRISPR complex;

[0050] adding a hairpin recognition probe to the CRISPR complex to obtain a mixture of the CRISPR complex and the hairpin recognition probe, and incubating;

[0051] Add HCR sequence and perform HCR reaction;

[0052] Add fluorescent dye and incubate;

[0053] Detect the fluorescent signal.

[0054] In one or more embodiments, the concentration of the CRISPR RNP complex is 80-120 nM, and the concentration of the test sample is 8-12 nM; preferably, the concentration of the CRISPR RNP complex is 100 nM, and the concentration of the test sample is 10 nM.

[0055] In one or more embodiments, the concentration of the hairpin recognition probe is 80-120 nM, and the molar ratio of the CRISPR complex to the hairpin recognition probe in the mixture is 1:(1-1.5); preferably, the concentration of the hairpin recognition probe is 100 nM, and the molar ratio of the CRISPR complex to the hairpin recognition probe in the mixture is 1:1.

[0056] In one or more embodiments, the concentration of the HCR sequence is 80-120 nM; preferably, the concentration of the HCR sequence is 100 nM.

[0057] In one or more embodiments, the HCR reaction is carried out at 35-40°C, preferably at 37°C.

[0058] In one or more embodiments, the HCR reaction time is 2-4 hours.

[0059] The beneficial effects of the present invention are:

[0060] The detection reagent provided in the present invention uses the CRISPR system to directly identify the original sequence without the need for pre-amplification of the target. Secondly, the off-target effect of the CRISPR system is overcome by hairpin recognition probes, which enables accurate recognition of single-base differences and broadens the scope of application of the CRISPR system. In addition, the HCR isothermal amplification technology is combined to achieve high sensitivity and high specificity detection of low-abundance samples in a constant temperature and stable environment. Finally, this solution can also directly detect targets in serum samples, so it has broad clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 Schematic diagram of the principle of CRISPR and HCR combined technology.

[0062] Figure 2 sgRNA synthesis method, (A) sgRNA synthesis steps; (B) synthesis of template DNA; (C) transcription and synthesis of sgRNA.

[0063] Figure 3 Optimization of different concentrations of monomers (DNA H1 and DNAH2).

[0064] Figure 4 Agarose gel electrophoresis showed the optimal reaction temperature.

[0065] Figure 5 Agarose gel electrophoresis diagram characterizing the detection of target sequences using CRISPR combined with HCR technology.

[0066] Figure 6 Characterization of single-base difference recognition results.

[0067] Figure 7 (A) Detect the fluorescence intensity of single-base difference sequence groups at different sites; (B) Collect the fluorescence value at the maximum wavelength of 525nm.

[0068] Figure 8 (A) Fluorescence response diagram of the experimental scheme under different target DNA concentrations; (B) Logarithmic dependence of fluorescence intensity (wavelength 525nm) on target DNA concentration.

[0069] Fig. 9 The fluorescence intensity was measured over time at different reaction times; the error bars represent the standard deviation of three measurements.

[0070] Fig.10 Fluorescence values ​​at 525 nm in different proportions of KRAS G12D mutant sequence in wild-type sequence, n=3 replicates, two-tailed t-test; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; error bars represent the standard deviation of three measurements.

[0071] Fig.11 Discrimination of single-base difference sequences in a physiological serum environment, where (A) KRAS G12D target sequence was detected (B) KRAS G12C target sequence was detected; n=3 replicates, two-tailed t-test; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; error bars represent the standard deviation of three measurements. DETAILED DESCRIPTION

[0072] The present invention provides a gene detection method based on CRISPR and HCR combined technology, which uses the CRISPR system to directly identify the original sequence without pre-amplification of the target. Secondly, the off-target effect of the CRISPR system is overcome by hairpin recognition probes, which achieves accurate recognition of single-base differences and broadens the application range of the CRISPR system. In addition, combined with HCR isothermal amplification technology, high sensitivity and high specificity detection of low-abundance samples is achieved in a constant temperature and stable environment. The schematic diagram of the CRISPR and HCR combined technology is shown in the figure. Figure 1 shown, including:

[0073] HCR reaction design and characterization: Design an HCR sequence that can produce efficient reactions. An efficient HCR reaction can be achieved under a low ratio of initiating chains. The DNAH1 monomer sequence and the DNAH2 monomer sequence are designed as stem-loop hairpin structures with sticky ends, and the initiating chain is designed to open the hairpin structure to allow the HCR reaction to occur.

[0074] Constructing a CRISPR reaction system: Design specific sgRNA for the target sequence, and use Cas9 Nickase as the Cas9 effector protein. The sgRNA and Cas9 Nickase must first be assembled to form an sgRNA-Cas9Nickase complex, which then specifically binds to the target sequence.

[0075] CRISPR combined with hairpin recognition probe: The hairpin recognition probe is designed as a hairpin probe with a loop stem structure, which binds to the single strand opened by Cas9Nickase. After binding, the hairpin recognition probe is opened to trigger the subsequent HCR reaction.

[0076] HCR amplification signal and signal detection: The opened hairpin recognition probe acts as a trigger chain to react with HCR reaction monomers H1 and H2 to produce a long DNA double-stranded product. The double-stranded DNA is stained with the nucleic acid dye SYBR Green I by fluorescence staining, and the amplification result is converted into a detectable fluorescent signal, and the fluorescence emission spectrum of the reaction product is measured using a fluorescence spectrophotometer (such as F-7100 fluorescence spectrophotometer).

[0077] The present invention is further described in detail below by specific examples. Unless otherwise specified, the raw materials, reagents or devices used in the examples and comparative examples can be obtained from conventional commercial sources or can be obtained by prior art methods. Unless otherwise specified, the experiments or test methods are conventional methods in the art.

[0078] The primer sequences used in the examples of the present invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Cas9 Nickase was purchased from Suzhou Nearshore Protein Technology Co., Ltd.

[0079] The Cas9 Nickase used in the embodiment of the present invention is Cas9 H840A. The Cas9 enzyme contains two nuclease domains that can cut DNA sequences, a RuvC domain that cuts non-target chains and an HNH domain that cuts target chains. The H840A substitution is introduced into Cas9, that is, the histidine residue at position 840 is replaced by alanine, the HNH domain is inactivated, and only the RuvC domain functions. Cas9 will only be able to act as a nickase, catalyzing the production of single-stranded nicks on DNA, and can only cut one strand of DNA, thereby producing single-stranded nicks instead of double-strand breaks, so it is called a nickase.

[0080] Example 1 Construction of a system combining CRISPR and HCR technology

[0081] 1. Synthesize template DNA

[0082] First, Lambda DNA (For information on Lambda DNA, see https: / / www.neb.com / - / media / nebus / page-images / tools-and-resources / interactive-tools / dna-sequenc es-and-maps / lambda_map.pdf?rev=5f445675138843789daaefb72e7dc70c&hash=BC4719B5B8A2F0EB5E3372AA40E20C13) was selected as the target cleavage primer, and the upper and lower primers (Casn-Lambda-sg-F (SEQ ID NO.1), Casn-Lambda-sg-R (SEQ ID NO.2) of the synthetic template DNA were designed according to the recognition site. The reaction system contained 10-100 ng DNA template chain, 10 μM upstream and downstream primer chains, 10 U Taq DNA polymerase, 1× PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTP and deionized water, total volume 50μL. The reaction was carried out on a PCR instrument, and the reaction program was: 95℃5min, then 95℃30s, 56℃30s, 72℃30s, after 40 cycles, 72℃10min, and stored at 4℃. The purification kit was used for centrifugal purification. The electrophoresis results are shown in Figure 2 As shown in (A).

[0083] 2. CRISRP combined with HCR technology to detect target sequences

[0084] 1. HCR reaction system optimization

[0085] (1) Exploring the optimal reaction concentration for HCR isothermal amplification of H1 and H2 monomers

[0086] The concentration of initiator chain I (SEQ ID NO.3) was set to 0.1 nM, corresponding to the low concentration sample to be detected. The concentration gradient of HCR reaction monomer H1 (SEQ ID NO.4) and HCR reaction monomer H2 (SEQ ID NO.5) was set from high to low as 1 M, 5 nM, 10 nM, 50 nM, 100 nM, 500 nM, the total reaction volume was 20 μL, and incubated at 37°C for 2 h.

[0087] The fluorescence emission spectrum of the HCR product was measured using a F-7100 fluorescence spectrophotometer. The fluorescence spectrum in the emission range of 510 nm to 600 nm was collected and analyzed. The results are shown in Figure 3 As shown, the fluorescence intensity increases with the increase of the reaction monomer concentration, but as the concentration continues to increase, the signal level tends to the saturation level. Therefore, 100nM is selected as the optimal reaction concentration.

[0088] (2) Exploring the optimal reaction temperature

[0089] In order to improve the detection effect, the experimental temperature needs to be optimized. Experimental groups were set up to compare the differences between the two temperatures (25°C and 37°C). Figure 4 As shown, when the detection system recognizes the target DNA, it will generate a strong fluorescence signal, and in different temperature groups, the temperature of 37°C has a higher fluorescence intensity than the temperature of 25°C, proving that 37°C is a better reaction temperature than 25°C.

[0090] 2. CRISRP combined with HCR technology to detect target sequences

[0091] (1) Synthetic target sequence KRAS G12D

[0092] The target sequence KRAS G12D was obtained by designing upstream and downstream primers KRASG12D-F (SEQ ID NO.6) and KRASG12D-R (SEQ ID NO.7) and amplifying by PCR using Lambda DNA as a template.

[0093] The reaction system for synthesizing the target sequence includes 10-100ng DNA template chain, 10μM primer chain, 10U Taq DNA polymerase, 1×PCR buffer, 1.5mM MgCl2, 0.2mM dNTP and deionized water, with a total volume of 50μL. The reaction temperature is 95℃ for 5min, and then cooled to room temperature at a rate of -1℃ / min. The synthesized target sequence is diluted to the corresponding concentration according to the experimental needs.

[0094] (2) Transcriptional synthesis of sgRNA targeting KRAS G12D

[0095] The synthesis method of sgRNA is as follows Figure 2 As shown, Figure 2 In A, firstly, two upstream and downstream primers Casn-KRASG12D-sg-F (SEQ ID NO.8, Casn-KRASG12D-sg-R (SEQ ID NO.9) were designed, and PCR amplification was performed with the two primers as templates to generate a double-stranded DNA template (such as Figure 2 B). The double-stranded DNA template is transcribed into KRASG12D-sgRNA (SEQ ID NO.10) under the action of T7 RNA polymerase. The reaction system contains 500ng of double-stranded DNA template, 50U T7 RNA polymerase, 1×T7 reaction buffer, and a total volume of 20μL, and is incubated at 37°C for 2h. At this time, the reaction product still contains double-stranded DNA template, and DNaseI, RNase-free is required to digest the template DNA. Add 1μL DNaseI, 3μL 10×reaction buffer and nuclease-free water to a reaction volume of 30μL and place in a PCR instrument and incubate at 37°C for 1h. There are still various enzymes in the reaction system, so the sgRNA product needs to be purified, and an RNA purification kit is used for centrifugal purification. After purification, gel electrophoresis is performed, and the results are as follows Figure 2 As shown in C.

[0096] Cas9 Nickase and KRASG12D-sgRNA, both at a final concentration of 100 nM, were mixed in a reaction buffer (10 mMTris-HCl, 50 mM NaCl, 5 mM MgCl2 and 5% glycerol, pH 7.9) with a total volume of 20 μL and incubated at 15 ° C for 15 min to form a CRISPR RNP complex. Then, 10 nM, 5 nM, 1 nM, 0.5 nM, 100 pM, 50 pM, 10 pM, 1 pM, 50 fM of the target sequence KRAS G12D with different concentration gradients were mixed with the CRISPR RNP complex and incubated at 37 ° C for 30 min. Subsequently, 100 nM of the hairpin recognition probe (Probe17-14 (SEQ ID NO.11)) was added to hybridize with the exposed non-complementary chain and incubated at 37 ° C for 60 min, thereby opening the hairpin recognition probe. Then add 100nM monomers H1 (SEQID NO.4) and H2 (SEQ ID NO.5) designed for HCR reaction, incubate at 37°C for 2h, and trigger the subsequent HCR reaction to produce long-fragment DNA double-stranded products. Finally, 20μL of each group of products was mixed with 1μL of SYBR Green I working solution, diluted to 1000μL, and incubated at 37°C for 30min. The product fluorescence emission spectrum was measured using an F-7100 fluorescence spectrophotometer, and the fluorescence spectrum in the wavelength range of 510nm to 600nm was collected and analyzed.

[0097] Table 1

[0098]

[0099]

[0100] 4) Electrophoresis detection

[0101] The reaction products were characterized under blue light using 1.5% agarose gel. The results showed that obvious fluorescent bands were detected, proving that the target sequence was detected and the signal was amplified. The results are shown in the attached figure. Figure 5 shown.

[0102] Example 2 Ability of the detection method to identify single base differences

[0103] (1) Synthesis of target sequences with single base mismatches

[0104] Using the KRAS gene G12 mutation recognition region as the target sequence, in order to improve the ability of the experimental scheme to analyze single base differences, single base differences were designed at the 19th, 15th, 7th, and 1st positions within the 20nt region identified by the KRAS wild-type target (MIS15-KRAS, MIS19-KRAS, MIS1-KRAS, and MIS7-KRAS), and a 60bp KRAS wild-type sequence DNA (KRAS-WT) without single base differences was also synthesized. The primers for synthesizing MIS15-KRAS, MIS19-KRAS, MIS1-KRAS, MIS7-KRAS, and KRAS-WT are shown in SEQ ID NO.12 to SEQ ID NO.21 in Table 2, and the PCR amplification template is Lambda DNA. The mutation at position 7 corresponds to the KRAS G12D point mutation.

[0105] The reaction system for synthesizing the target sequence includes 10-100ng DNA template chain, 10μM primer chain, 10U Taq DNA polymerase, 1×PCR buffer, 1.5mM MgCl2, 0.2mM dNTP and deionized water, with a total volume of 50μL. The reaction temperature is 95℃ for 5min, and then cooled to room temperature at a rate of -1℃ / min. The synthesized target sequence is diluted to the corresponding concentration according to the experimental needs.

[0106] (2) Transcriptional synthesis of sgRNA targeting KRAS-WT

[0107] First, two upstream and downstream primers, Casn-KRASWT-sg-F (SEQ ID NO.22) and Casn-KRASWT-sg-R (SEQ ID NO.23), were designed, and PCR amplification was performed with the two primers as templates to generate a double-stranded DNA template. The double-stranded DNA template was transcribed into KRAS-WT-sgRNA (SEQ ID NO.24) under the action of T7 RNA polymerase.

[0108] (3) CRISRP combined with HCR technology to detect sequences with single base differences

[0109] Cas9 Nickase and KRAS-WT-sgRNA, both at a final concentration of 100 nM, were mixed in a reaction buffer (10 mM Tris-HCl, 50 mM NaCl, 5 mM MgCl2, and 5% glycerol, pH 7.9) in a total volume of 20 μL and incubated at 15 °C for 15 min to form a CRISPR RNP complex.

[0110] Then, the target sequence (KRAS-WT, MIS15-KRAS, MIS19-KRAS, MIS1-KRAS or MIS7-KRAS) with different concentration gradients of 50fM to 10nM to be tested was added to the CRISPR RNP complex and incubated at 37°C for 30min. Subsequently, a 100nM hairpin recognition probe (Probe17-14-KRAS-WT (SEQ ID NO.25)) was added to hybridize with the exposed non-complementary strand and incubated at 37°C for 60min, thereby opening the hairpin recognition probe. Then, HCR reaction monomers H1 (SEQ ID NO.4) and H2 (SEQ ID NO.5) were added at a final concentration of 100nM and incubated at 37°C for 2h to trigger the subsequent HCR reaction to produce long-fragment DNA double-stranded products. Finally, 20 μL of each group of products was mixed with 1 μL of SYBR Green I working solution, diluted to 1000 μL, and incubated at 37°C for 30 min.

[0111] Table 2

[0112]

[0113]

[0114] (4) Electrophoresis detection

[0115] The reaction products were characterized using 1.5% agarose gel under UV light and blue light. Figure 6 As shown, the completely matched sequence has a stronger fluorescent band signal, which proves that the method in this example can distinguish single-base differences in the target sequence.

[0116] (5) The fluorescence emission spectrum of the reaction product was measured using a F-7100 fluorescence spectrophotometer.

[0117] The fluorescence value of the reaction product was measured using an F-7100 fluorescence spectrophotometer, using a quartz cuvette as the measuring container, with the excitation and emission slit widths set to 10 nm, the scanning speed set to 240 nm / min, the PMT Voltage set to 700 V, the excitation wavelength set to 493 nm, and the fluorescence signal from 510 nm to 600 nm was collected. The results are shown in Figure 2. Figure 7 As shown, the results show that the completely matched sequence has a stronger fluorescence value, proving that the method in this embodiment can achieve single-base difference distinction of the target sequence.

[0118] Example 3 Detection Method Sensitivity

[0119] (1) Dilute ctDNA with KRAS G12D mutation site as target sequence

[0120] In order to evaluate the sensitivity of this protocol for DNA detection, primers Lambda-230bp-F (SEQ ID NO.26) and Lambda-230bp-R (SEQ ID NO.27) were designed, and Lambda DNA was used as an amplification template to obtain a 150bp KRAS G12D gene mutation fragment as a target sequence by PCR amplification. The target sequence was gradiently diluted to 10nM, 5nM, 1nM, 0.5nM, 100pM, 50pM, 10pM, 1pM, 50fM and a control group without a target sequence using nuclease-free water.

[0121] The reaction system for synthesizing the target sequence includes 10-100ng DNA template chain, 10μM primer chain, 10U Taq DNA polymerase, 1×PCR buffer, 1.5mM MgCl2, 0.2mM dNTP and deionized water, with a total volume of 50μL. The reaction temperature is 95℃ for 5min, and then cooled to room temperature at a rate of -1℃ / min. The synthesized target sequence is diluted to the corresponding concentration according to the experimental needs.

[0122] (2) CRISRP combined with HCR technology to detect target sequences at different concentrations

[0123] Cas9 Nickase and KRASG12D-sgRNA (sequence as shown in SEQ ID NO. 10, prepared as in Example 1) with a final concentration of 100 nM were mixed in a reaction buffer (10 mM Tris-HCl, 50 mM NaCl, 5 mM MgCl2 and 5% glycerol, pH 7.9) in a total volume of 20 μL and incubated at 15 ° C for 15 min to form a CRISPR RNP complex.

[0124] Then, 10 μL of the target sequence 150 bp KRAS G12D of different concentrations was mixed with the CRISPR RNP complex and incubated at 37°C for 30 min to form a CRISPR complex. Subsequently, 100 nM of the hairpin recognition probe Probe17-14-KRASG12D (SEQ ID NO.28) was added to hybridize with the exposed non-complementary strand and incubated at 37°C for 60 min to open the hairpin recognition probe. Then, HCR reaction monomers H1 (SEQ ID NO.4) and H2 (SEQID NO.5) were added to the system at a final concentration of 100 nM and incubated at 37°C for 2 h to induce the subsequent HCR reaction to produce long-fragment DNA double-stranded products. Finally, 30 μL of each group of products was mixed with 1 μL of SYBR Green I working solution, diluted to 1000 μL, and incubated at 37°C for 30 min.

[0125] Table 3

[0126]

[0127] (4) The fluorescence emission spectrum of the reaction product was measured using a F-7100 fluorescence spectrophotometer.

[0128] The fluorescence value of the reaction product was measured using an F-7100 fluorescence spectrophotometer, using a quartz cuvette as the measuring container, with the excitation and emission slit widths set to 10 nm, the scanning speed set to 240 nm / min, the PMT Voltage set to 700 V, the excitation wavelength set to 493 nm, and the fluorescence signal from 510 nm to 600 nm was collected. The results are shown in Figure 2. Figure 8 As shown, the results prove that the method in this embodiment has a high detection sensitivity, and the detection limit can reach 1fM.

[0129] (5) HCR optimal reaction time

[0130] The target fragment 150bp KRAS G12D at a concentration of 10nM was mixed with the CRISPR RNP complex and incubated at 37°C for 30min to form a CRISPR complex. Subsequently, 100nM of the hairpin recognition probe Probe17-14-KRASG12D was added to hybridize with the exposed non-complementary strand and incubated at 37°C for 60min to open the hairpin recognition probe. HCR reaction monomers H1 and H2 were added at a final concentration of 100nM and incubated at 37°C for different lengths (0.5h, 1h, 2h, 3h, 4h, respectively) to induce subsequent HCR reactions to produce long-fragment DNA double-stranded products. Finally, 20μL of each group of products was mixed with 1μL of SYBR Green I working solution, diluted to 1000μL, and incubated at 37°C for 30min. The fluorescence value of the reaction product was measured using an F-7100 fluorescence spectrophotometer. A quartz cuvette was used as the measuring container. The slit widths of the excitation and emission were set to 10 nm, the scanning speed was set to 240 nm / min, the PMT Voltage was set to 700 V, the excitation wavelength was set to 493 nm, and the fluorescence signals from 510 nm to 600 nm were collected. The results are shown in Figure 2. Fig. 9 As shown, a reaction time that is too short will reduce the detection effect, and a reaction time that is too long will also affect the detection efficiency of the experiment. According to the method results in this embodiment, a reaction time of 2h is the preferred reaction time.

[0131] Example 4 Detection and characterization of ctDNA in low abundance environment

[0132] (1) Preparation of target sequences with different allele fractions

[0133] Preparation of KRAS wild-type fragment: Primers KRAS-WT-F (SEQ ID NO.29) and KRAS-WT-R (SEQ ID NO.30) were designed, and Lambda DNA was used as an amplification template to obtain the KRAS wild-type fragment by PCR amplification.

[0134] The reaction system for synthesizing the target sequence includes 10-100ng DNA template chain, 10μM primer chain, 10U Taq DNA polymerase, 1×PCR buffer, 1.5mM MgCl2, 0.2mM dNTP and deionized water, with a total volume of 50μL. The reaction temperature is 95℃ for 5min, and then cooled to room temperature at a rate of -1℃ / min. The synthesized target sequence is diluted to the corresponding concentration according to the experimental needs.

[0135] 100 nM of a 150 bp KRAS G12D mutant fragment (preparation method see Example 3) and a KRAS wild-type fragment were mixed in different ratios (0%, 0.001%, 0.01%, 0.05%, 0.1%, 0.5%, 1%, 10%) to obtain target sequences with different allele fractions.

[0136] (2) CRISRP combined with HCR technology to detect target sequences with different allele fractions

[0137] Using CRISRP combined with HCR technology, Cas9 Nickase and KRASG12D-sgRNA (sequence as shown in SEQ ID NO.10, preparation method is the same as Example 1) with a final concentration of 100 nM were mixed in a reaction buffer (10 mM Tris-HCl, 50 mM NaCl, 5 mM MgCl2 and 5% glycerol, pH 7.9) for target sequences with different allele scores, with a total volume of 20 μL, and incubated at 15 ° C for 15 min to form a CRISPR RNP complex.

[0138] Then, target fragments with different allele scores were added to the CRISPR RNP complex reaction system and incubated at 37°C for 30 minutes to form a CRISPR complex. Subsequently, a hairpin recognition probe Probe17-14-KRASG12D (SEQ ID NO.28) with a final concentration of 100nM was added to hybridize with the exposed non-complementary strand and incubated at 37°C for 60 minutes to open the hairpin recognition probe. HCR reaction monomers H1 (SEQ ID NO.4) and H2 (SEQID NO.5) with a final concentration of 100nM were added to the reaction system and incubated at 37°C for 2 hours to trigger the subsequent HCR reaction to produce long-fragment DNA double-stranded products. Finally, 20μL of each group of products was mixed with 1μL of SYBR Green I working solution, diluted to 1000μL, and incubated at 37°C for 30 minutes.

[0139] Table 4

[0140]

[0141] (3) The fluorescence emission spectrum of the reaction product was measured using a F-7100 fluorescence spectrophotometer.

[0142] The fluorescence value of the reaction product was measured using an F-7100 fluorescence spectrophotometer, using a quartz cuvette as the measuring container, with the excitation and emission slit widths set to 10 nm, the scanning speed set to 240 nm / min, the PMT Voltage set to 700 V, the excitation wavelength set to 493 nm, and the fluorescence signal from 510 nm to 600 nm was collected. The results are shown in Figure 2. Fig.10 As shown, it is proved that the method in this example can identify target sequences with an allele fraction as low as 0.1%, and the designed experimental scheme can effectively detect single-base differences with low abundance and low allele fraction.

[0143] Example 5 Detection of ctDNA in serum

[0144] (1) Preparation of serum samples

[0145] Preparation of KRAS G12C fragment: Primers KRASG12C-F (SEQ ID NO.31) and KRASG12C-R (SEQ ID NO.32) were designed, and Lambda DNA was used as an amplification template to obtain the KRAS G12C gene mutation fragment by PCR amplification.

[0146] The reaction system for synthesizing the target sequence includes 10-100ng DNA template chain, 10μM primer chain, 10U Taq DNA polymerase, 1×PCR buffer, 1.5mM MgCl2, 0.2mM dNTP and deionized water, with a total volume of 50μL. The reaction temperature is 95℃ for 5min, and then cooled to room temperature at a rate of -1℃ / min. The synthesized target sequence is diluted to the corresponding concentration according to the experimental needs.

[0147] In order to test the specificity of the protocol in distinguishing single-base differences in serum samples, serum samples were first prepared, and FBS was diluted with HEPES buffer to obtain 50% serum concentration, and KRAS WT (preparation method see Example 2), KRAS G12D (sequence length is 150bp, preparation method see Example 3), KRAS G12C sequences were added respectively, so that the concentration of all sequences was 10nM. Three groups of simulated clinical samples containing 10nM KRAS WT, KRAS G12D, and KRAS G12C sequences with 50% serum concentration were obtained. And a group of blank controls with only 50% serum concentration.

[0148] (2) Transcriptional synthesis of sgRNA targeting Casn-KRASG12C

[0149] Two upstream and downstream primers, Casn-KRASG12C-sg-F (SEQ ID NO.33) and Casn-KRASG12C-sg-R (SEQ ID NO.34), were designed, and PCR amplification was performed with the two primers as templates to generate a double-stranded DNA template. The double-stranded DNA template was transcribed into KRASG12C-sgRNA (SEQ ID NO.35) under the action of T7 RNA polymerase.

[0150] (3) CRISRP combined with HCR technology to detect ctDNA in serum

[0151] Two experimental groups were set up. Group A used KRASG12D-sgRNA (sequence as shown in SEQ ID NO.10, the preparation method is the same as Example 1) and hairpin recognition probe Probe17-14-KRASG12D (SEQ ID NO.28) to detect three serum samples and a blank control group. Group B used KRASG12C-sgRNA and hairpin recognition probe Probe17-14-KRASG12C (SEQ ID NO.36) to detect three serum samples and a blank control group. Each was repeated three times. The steps are as follows:

[0152] Cas9 Nickase (600 nM) and sgRNA were mixed in reaction buffer (10 mM Tris-HCl, 50 mM NaCl, 5 mM MgCl2, and 5% glycerol, pH 7.9) in a total volume of 20 μL and incubated at 15 °C for 15 min to form CRISPR RNP complexes.

[0153] Then add 20 μL of serum to the CRISPR RNP complex reaction system and incubate at 37°C for 30 minutes. Then add 100 nM of hairpin recognition probe to hybridize with the exposed non-complementary chain and incubate at 37°C for 60 minutes. Then add HCR reaction monomers H1 (SEQ ID NO.4) and H2 (SEQ ID NO.5) at a final concentration of 100 nM to the reaction system and incubate at 37°C for 2 hours. Finally, mix 20 μL of each group of products with 1 μL of SYBR Green I working solution, dilute to 1000 μL, and incubate at 37°C for 30 minutes.

[0154] Table 5

[0155]

[0156] (4) The fluorescence emission spectrum of the reaction product was measured using a F-7100 fluorescence spectrophotometer.

[0157] The fluorescence value of the reaction product was measured using an F-7100 fluorescence spectrophotometer, using a quartz cuvette as the measuring container, with the excitation and emission slit widths set to 10 nm, the scanning speed set to 240 nm / min, the PMT Voltage set to 700 V, the excitation wavelength set to 493 nm, and the fluorescence signal from 510 nm to 600 nm was collected. The results are shown in Figure 2. Fig.11 As shown, it is demonstrated that the method in this embodiment can detect ctDNA of different targets in a 50% serum environment and has the ability to recognize single-base differences.

[0158] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A detection reagent comprising: HCR sequence, including DNA H1 monomer sequence and DNA H2 monomer sequence; A CRISPR RNP complex, comprising a Cas9 nickase and sgRNA, wherein the sgRNA is a specific sgRNA for a target sequence, and the CRISPR RNP complex can specifically bind to the target sequence; A hairpin recognition probe, wherein the hairpin recognition probe is a stem-loop hairpin probe, and the hairpin recognition probe can bind to the single strand produced by the Cas9 nickase cutting the target sequence and be opened, and the opened hairpin recognition probe serves as a triggering strand to trigger the HCR sequence to undergo an HCR reaction.

2. The detection reagent according to claim 1, characterized in that The DNA H1 monomer sequence is: TTTTAGGCTAGACTACAACTCAGATCCAGAGTTGTAGTCTAGCT; The DNAH2 monomer sequence is: GAGTTGTAGTCTAGCTCTAAAAAGCTAGACTACAACTCTGGATCT; The sgRNA sequence is: UCUAGCUCUAAAACGUAGUUGGAGCUGGUGGGUUUUAGAGCUAGACUACAACU; The hairpin recognition probe sequence is: AGTTGTAGTCTAGCTCTAAAACCCACCAGCTCCAACTACGTTTTAGAGCTAGA; AGTTGTAGTCTAGCTCTAAAACCCATCAGCTCCAACTACGTTTTAGAGCTAGA; or AGTTTGTAGTCTAGCTCTAAAACCCACAAGCTCCAACTACGTTTTAGAGCTAGA.

3. The detection reagent according to claim 2, characterized in that The DNA H1 monomer sequence is: TTTTAGGCTAGACTACAACTCAGATCCAGAGTTGTAGTCTAGCT; The DNA H2 monomer sequence is: GAGTTGTAGTCTAGCTCTAAAAAGCTAGACTACAACTCTGGATCT; The sgRNA sequence is: UCUAGCUCUAAAACGUAGUUGGAGCUGGUGGGUUUUAGAGCUAGACUACAACU; The hairpin recognition probe sequence is: AGTTGTAGTCTAGCTCTAAAACCCACCAGCTCCAACTACGTTTT AGAGC TAGA.

4. The detection reagent according to claim 2, characterized in that The DNA H1 monomer sequence is: TTTTAGGCTAGACTACAACTCAGATCCAGAGTTGTAGTCTAGCT; The DNA H2 monomer sequence is: GAGTTGTAGTCTAGCTCTAAAAAGCTAGACTACAACTCTGGATCT; The sgRNA sequence is: UCUAGCUCUAAAACGUAGUUGGAGCUGGUGGGUUUUAGAGCUAGACUACAACU; The hairpin recognition probe sequence is: AGTTTGTAGTCTAGCTCTAAAACCCATCAGCTCCAACTACGTTTTAGAGCTAGA.

5. The detection reagent according to claim 2, characterized in that The DNA H1 monomer sequence is: TTTTAGGCTAGACTACAACTCAGATCCAGAGTTGTAGTCTAGCT; The DNA H2 monomer sequence is: GAGTTGTAGTCTAGCTCTAAAAAGCTAGACTACAACTCTGGATCT; The sgRNA sequence is: UCUAGCUCUAAAACGUAGUUGGAGCUGGUGGGUUUUAGAGCUAGACUACAACU; The hairpin recognition probe sequence is: AGTTTGTAGTCTAGCTCTAAAACCCACAAGCTCCAACTACGTTTTAGAGCTAGA.

6. A fluorescent biosensor comprising the detection reagent according to any one of claims 1 to 5 and a fluorescent dye.

7. The fluorescent biosensor according to claim 6, characterized in that: The fluorescent dye includes any one of SYBR GREENⅠ fluorescent dye, EveGreen and SYTO 9.

8. A gene detection method based on CRISPR and HCR combined technology, using the detection reagent described in any one of claims 1 to 5, comprising: The CRISPR RNP complex is mixed with the test sample and incubated to form a CRISPR complex; Add the hairpin recognition probe to the CRISPR complex and incubate; Add HCR sequence and perform HCR reaction; Add fluorescent dye and incubate; Detect the fluorescent signal.

9. The detection method according to claim 8, characterized in that: The HCR reaction is carried out at 35-40°C.

10. The detection method according to claim 9, characterized in that: The HCR reaction time is 2-4 hours.

Images