Application of ssc-miR-148a-5p in preparation of anti-PDCoV proliferation drugs and vaccines

Abstract

The invention discloses an application of ssc-miR-148a-5p in the preparation of a drug and a vaccine for resisting the proliferation of a PDCoV (Property of Cell Deficiency Virus). Belongs to the technical field of antiviral drugs. A simulant for increasing the expression of the ssc-miR-148a-5p and an inhibitor for reducing the expression of the ssc-miR-148a-5p are respectively transfected to porcine small intestinal epithelial cells (IPEC-J2), the cells are infected by PDCoV 24 hours after transfection, the expression quantity of the PDCoV M gene in the cells is detected by a fluorescent quantitative PCR (Polymerase Chain Reaction) technology 24 hours after virus infection, the expression quantity of the PDCoV M gene is respectively and obviously reduced and increased, and the expression quantity of the PDCoV M gene in the cells is obviously reduced and increased. The result shows that the ssc-miR-148a-5p can be used for regulating the proliferation of the PDCoV in the IPEC-J2 cell. The invention provides a new candidate miRNA for the preparation of anti-PDCoV proliferation drugs and vaccines.

Description

Technical Field

[0001] The present invention relates to the technical field of antiviral drugs, and more specifically to the application of ssc-miR-148a-5p in the preparation of anti-PDCoV proliferation drugs and vaccines. Background Art

[0002] Porcine deltacoronavirus (PDCoV) is a pathogenic enteric diarrheal pathogen in pigs that can induce watery diarrhea, vomiting, dehydration and death in pigs. Currently, there are no commercial vaccines and specific drugs to prevent and treat diarrheal diseases caused by this virus in pigs, and new antiviral strategies are urgently needed.

[0003] MicroRNA (miRNA / miR) is a member of the non-coding RNA family. It regulates the expression of functional genes at the post-transcriptional level and is widely involved in the regulation of various biological processes. Studies have found that avian miR-148a-5p (gga-miR-148a-5p) can significantly regulate the replication of avian leukosis virus subgroup J (ALV-J) and duck Tembusu virus (DTMUV), but it is unclear whether porcine miR-148a-5p can regulate the proliferation of porcine susceptible viruses.

[0004] The present invention finds that porcine miR-148a-5p (ssc-miR-148a-5p) can regulate the proliferation of PDCoV in porcine intestinal epithelial cells (Intestinal porcine epithelial cell line J2, IPEC-J2). The present invention provides a molecular target for the preparation of anti-PDCoV proliferation drugs and vaccines from a new perspective. Summary of the invention

[0005] In view of this, the present invention provides the use of ssc-miR-148a-5p in the preparation of anti-PDCoV proliferation drugs and vaccines.

[0006] The present invention transfects mimics (nucleotide sequence as shown in SEQ ID NO.1) that increase the expression of ssc-miR-148a-5p and inhibitors (nucleotide sequence as shown in SEQ ID NO.2) that reduce the expression of ssc-miR-148a-5p into porcine intestinal epithelial cells (Intestinal porcine epithelial cell line J2, IPEC-J2), and infects the cells with PDCoV-TJ1 strain 24 hours after transfection. After infection with the virus, the expression of PDCoV M gene in the cells is detected by fluorescence quantitative PCR technology, and it is found that the expression of PDCoV M gene is significantly reduced and increased, respectively, indicating that ssc-miR-148a-5p can inhibit the proliferation of PDCoV in IPEC-J2 cells. The present invention provides candidate miRNA for the preparation of anti-PDCoV proliferation drugs and vaccines.

[0007] AAAGUUCUGAGACACUCCGACU, SEQ ID NO.1;

[0008] AGTCGGAGTGTCTCAGAACTTT, SEQ ID NO. 2.

[0009] In order to achieve the above object, the present invention adopts the following technical solution:

[0010] Application of ssc-miR-148a-5p in the preparation of anti-PDCoV proliferation drugs and vaccines;

[0011] The nucleotide sequence of the ssc-miR-148a-5p is shown in SEQ ID NO.1;

[0012] AAAGUUCUGAGACACUCCGACU, SEQ ID NO.1.

[0013] The above-mentioned ssc-miR-148a-5p is used as a target in the preparation of drugs and / or vaccines for treating and / or preventing PDCoV.

[0014] Furthermore, the expression level of ssc-miR-148a-5p needs to be increased.

[0015] A drug for resisting PDCoV proliferation, comprising a substance that increases the expression of ssc-miR-148a-5p.

[0016] Furthermore, the nucleotide sequence of the substance that increases the expression of ssc-miR-148a-5p is as follows:

[0017] AAAGUUCUGAGACACUCCGACU, SEQ ID NO.1.

[0018] It can be seen from the above technical scheme that compared with the prior art, the beneficial effects achieved by the present invention are as follows: the present invention transfects mimics that increase the expression of ssc-miR-148a-5p and inhibitors that reduce the expression of ssc-miR-148a-5p into porcine intestinal epithelial cells (IPEC-J2), and uses PDCoV to infect cells 24 hours after transfection. The expression of the PDCoV M gene in the cells is detected by fluorescence quantitative PCR technology 24 hours after virus infection, and it is found that the expression of the PDCoV M gene is significantly reduced and increased, respectively, indicating that ssc-miR-148a-5p can regulate the proliferation of PDCoV in IPEC-J2 cells. The present invention provides a new candidate miRNA for the preparation of anti-PDCoV proliferation drugs and vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0020] Figure 1 The expression results of the PDCoV M gene after PDCoV infected IPEC-J2 cells in Example 1 of the present invention;

[0021] Figure 2 is the relative expression level of ssc-miR-148a-5p after PDCoV infected IPEC-J2 cells in Example 2 of the present invention, wherein *** represents P < 0.001;

[0022] Figure 3 The ssc-miR-148a-5p mimic in Example 3 of the present invention increases the expression of ssc-miR-148a-5p in IPEC-J2 cells infected with PDCoV, wherein *** represents P < 0.001;

[0023] Figure 4 In Example 3 of the present invention, increasing the expression of ssc-miR-148a-5p can inhibit the proliferation of PDCoV in IPEC-J2 cells, wherein *** represents P < 0.001;

[0024] Figure 5 The ssc-miR-148a-5p inhibitor in Example 4 of the present invention reduces the expression of ssc-miR-148a-5p in IPEC-J2 cells infected with PDCoV, wherein *** represents P < 0.001;

[0025] Figure 6 In Example 4 of the present invention, reducing the expression of ssc-miR-148a-5p can promote the proliferation of PDCoV in IPEC-J2 cells, wherein *** represents P<0.001. DETAILED DESCRIPTION

[0026] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] IPEC-J2 cells were purchased from Guangzhou Geneo Biotechnology Co., Ltd.;

[0028] Fetal bovine serum was purchased from Ekosai Biotechnology (Taicang) Co., Ltd.;

[0029] High-glucose DMEM medium was purchased from Gibco;

[0030] The PDCoV-TJ1 strain was isolated and preserved by the Animal Husbandry and Veterinary Research Institute of Tianjin Academy of Agricultural Sciences. (Zheng Li, Li Xiuli, Yan Minghua*, Ren Weike, Zhang Lei, Lu Chao, Tian Xiangxue, Han Wei. Isolation, identification and biological characteristics analysis of porcine deltacoronavirus TJ1 strain [J]. Chinese Journal of Animal Husbandry and Veterinary Medicine (Chinese Core Journal). 2018, 45(1): 219-224).

[0031] riboSCRIPT Reverse Transcription Kit (500T) was purchased from Guangzhou Ribo Biotechnology Co., Ltd.;

[0032] Bulge-LoopTM miRNA qRT-PCR Starter Kit was purchased from Guangzhou Ruibo Biotechnology Co., Ltd.;

[0033] Opti-MEM medium was purchased from Thermo Fisher Scientific;

[0034] Lipofectamine 3000 Reagent was purchased from Thermo Fisher Scientific;

[0035] PrimeScript TM RT reagentKit (Perfect Real Time) was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.;

[0036] TB Premix Ex Taq TM II (Tli RNaseH Plus) was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.;

[0037] The experimental reagents and supplies not mentioned are conventional experimental reagents and supplies purchased from commercial channels;

[0038] The experimental methods not mentioned are conventional experimental methods and will not be described in detail here.

[0039] Example 1

[0040] PDCoV significantly proliferated after infecting IPEC-J2 cells

[0041] 1. Experimental cell culture:

[0042] IPEC-J2 cells were seeded in 6-well plates and cultured in high-glucose DMEM medium containing 10% volume concentration of fetal bovine serum at 37° C. and 5% CO 2 to a cell monolayer with 80% confluence.

[0043] 2. Virus inoculation:

[0044] The PDCoV-TJ1 strain was inoculated into IPEC-J2 cells (1.6 mL per well, containing a final volume concentration of 1% pancreatic juice) at an MOI of 1.0 (virus-infected group), and a control group without virus infection was set up, and then cultured at 37°C and 5% CO2.

[0045] 3. Total RNA extraction and cDNA product synthesis:

[0046] Total RNA was extracted using TRIzol and PrimeScript TM Total RNA was reverse transcribed into cDNA using RT reagent Kit (Perfect Real Time), and 1 μg of total RNA was added to every 20 μL system; the reverse transcription program was 30°C for 10 min, 42°C for 1 h, and 99°C for 5 min.

[0047] 4. Fluorescence quantitative PCR:

[0048] The cDNA product obtained by reverse transcription was used as a template for fluorescent quantitative PCR; the PDCoV M gene primers and probes were diluted to 10 μM, respectively, and the nucleotide sequences of the PDCoV M gene upstream primer, downstream primer and probe were SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, respectively. Probe qPCR Master Mix reagent instructions configure the system and set the program (annealing temperature is set to 61°C), and use this kit to complete the fluorescent quantitative PCR experiment.

[0049] According to the standard curve equation, the Ct value obtained by the fluorescence quantitative PCR test is substituted into the fluorescence quantitative PCR linear equation: Ct value = -3.68 × lgX + 41.21, and the initial copy number of the sample can be calculated to achieve the purpose of quantification.

[0050] CGTGTGATCTATGTTATTAAAC, SEQ ID NO.3;

[0051] CAGGATATGAAGGTCAGTA, SEQ ID NO.4;

[0052] FAM-CTGCTCCAACCCTTCACCCTA-TAMRA, SEQ ID NO. 5.

[0053] The results are as follows Figure 1 As shown, Figure 1 The results showed that the expression level of PDCoV M gene increased in IPEC-J2 cells 24 h after PDCoV TJ1 infection.

[0054] Example 2

[0055] PDCoV infection of IPEC-J2 cells reduces the expression of ssc-miR-148a-5p

[0056] 1. Experimental cell culture:

[0057] IPEC-J2 cells were seeded in 6-well plates and cultured in high-glucose DMEM medium containing 10% volume concentration of fetal bovine serum at 37° C. and 5% CO 2 to a cell monolayer with 80% confluence.

[0058] 2. Virus inoculation:

[0059] The PDCoV-TJ1 strain was inoculated into IPEC-J2 cells (1.6 mL per well, containing a final volume concentration of 1% pancreatic juice) at an MOI of 1.0 (virus-infected group), and a control group without virus infection was set up, and then cultured at 37°C and 5% CO2.

[0060] 3. Total RNA extraction and miRNA RT product synthesis:

[0061] IPEC-J2 cell pellets were collected 24 h after virus inoculation, and total RNA was extracted using the TRIzol method. The total RNA was reverse transcribed into miRNA RT product using riboSCRIPT Reverse Transcription Kit (500T) (the nucleotide sequence of the ssc-miR-148a-5p stem-loop primer used in reverse transcription was SEQ ID NO. 6), and 5 μg of total RNA was added to every 10 μL system; the reverse transcription program was 42°C for 60 min and 70°C for 10 min.

[0062] GTTGGGAGGTAGGAGGTTGATATCCTCCCAACAGTCGG, SEQ ID NO. 6.

[0063] 4.ssc-miR-148a-5p fluorescence quantitative PCR:

[0064] The miRNA RT product obtained by reverse transcription was used as a template for fluorescence quantitative PCR; the primers of ssc-miR-148a-5p and the internal reference gene U6 were diluted to 200 nM, respectively, the nucleotide sequences of the upstream primer and downstream primer of ssc-miR-148a-5p were SEQ ID NO.7 and SEQ ID NO.8, respectively, and the nucleotide sequences of the upstream primer and downstream primer of the internal reference gene U6 were SEQ ID NO.9 and SEQ ID NO.10, respectively, and the Bulge-LoopTM miRNA qRT-PCR StarterKit was used, and the system was configured and the program was set according to the instructions (annealing temperature was set to 60°C); according to the Ct value of the fluorescence quantitative PCR experiment, U6 was used as the internal reference gene, and 2 -ΔΔCt The formula was used to calculate the fold change of ssc-miR-148a-5p expression between the control group and the infected group.

[0065] AGGCAAAGTTCTGAGACACT, SEQ ID NO.7;

[0066] TTGGGAGGTAGGAGGTTGAT, SEQ ID NO.8;

[0067] ATAGATCTAGGAGGACTCCAGGGAC, SEQ ID NO.9;

[0068] CTGAATTCGGGTCTTCTCAGAGG, SEQ ID NO. 10.

[0069] The results are as follows Figure 2 As shown, Figure 2The results showed that the expression level of ssc-miR-148a-5p was significantly decreased in IPEC-J2 cells 24 h after PDCoV TJ1 infection.

[0070] Example 3

[0071] Increased expression of ssc-miR-148a-5p inhibits the proliferation of PDCoV in IPEC-J2 cells

[0072] 1. Experimental cell culture:

[0073] IPEC-J2 cells were seeded in 96-well plates and cultured in high-glucose DMEM medium containing 10% volume concentration of fetal bovine serum at 37° C. and 5% CO 2 to a cell monolayer with 80% confluence.

[0074] 2. Cell transfection and virus infection experiments:

[0075] 0.75 μL of a mimetic (nucleotide sequence as shown in SEQ ID NO.1) that increases ssc-miR-148a-5p expression at a final concentration of 150 nM and a mimetic control were added to 5 μL Opti-MEM culture medium, mixed thoroughly, and allowed to stand for 10 min; 0.3 μL of Lipofectamine 3000 Reagent was added to 5 μL Opti-MEM culture medium, mixed thoroughly, and allowed to stand for 10 min; the diluted mimetic solution and mimetic control solution were mixed thoroughly with Lipofectamine 3000 Reagent added to Opti-MEM, and allowed to stand for 15 min; IPEC-J2 cells pre-seeded in a 96-well plate were rinsed with Opti-MEM culture medium, and then the mimetic / mimic control and Lipofectamine The mixture of 3000 Reagent was added to the cells in each well, 90 μL per well, and after gentle shaking, the cells were placed in a cell culture incubator at 37°C and 5% CO2 for culture. After 24 hours, the PDCoV-TJ1 strain was inoculated into IPEC-J2 cells at an MOI of 1.0 (100 μL per well, containing 1% pancreatin at a final volume concentration), and then cultured at 37°C and 5% CO2. The IPEC-J2 cell pellet was harvested 24 hours after infection.

[0076] AAAGUUCUGAGACACUCCGACU, SEQ ID NO.1.

[0077] 3. Total RNA extraction, miRNA RT product and cDNA product synthesis:

[0078] Total RNA was extracted using the TRIzol method. The total RNA was reverse transcribed into miRNA RT products using the riboSCRIPT Reverse Transcription Kit (500T). The nucleotide sequence of the ssc-miR-148a-5p stem-loop primer used in the reverse transcription was SEQ ID NO.6. 5 μg of total RNA was added to each 10 μL system. The reverse transcription procedure was 42°C for 60 min and 70°C for 10 min. PrimeScript TM Total RNA was reverse transcribed into cDNA using RT reagent Kit (Perfect Real Time), and 1 μg of total RNA was added to every 20 μL system; the reverse transcription program was 30°C for 10 min, 42°C for 1 h, and 99°C for 5 min.

[0079] 4.ssc-miR-148a-5p fluorescence quantitative PCR:

[0080] The miRNA RT product obtained by reverse transcription was used as a template for fluorescence quantitative PCR; the primers of ssc-miR-148a-5p and the internal reference gene U6 were diluted to 200 nM, respectively, the nucleotide sequences of the upstream primer and downstream primer of ssc-miR-148a-5p were SEQ ID NO.7 and SEQ ID NO.8, respectively, and the nucleotide sequences of the upstream primer and downstream primer of the internal reference gene U6 were SEQ ID NO.9 and SEQ ID NO.10, respectively, and the Bulge-LoopTM miRNA qRT-PCR StarterKit was used, and the system was configured and the program was set according to the instructions (annealing temperature was set to 60°C); according to the Ct value of the fluorescence quantitative PCR experiment, U6 was used as the internal reference gene, and 2 -ΔΔCt The formula was used to calculate the fold change of ssc-miR-148a-5p expression between the mimic group and the mimic control group.

[0081] 5. PDCoV M gene fluorescence quantitative PCR:

[0082] The cDNA product obtained by reverse transcription was used as a template for fluorescent quantitative PCR; the primers of the PDCoV M gene and the internal reference gene GAPDH were diluted to 10 μM, respectively, the nucleotide sequences of the upstream primer and downstream primer of the PDCoV M gene were SEQ ID NO.3 and SEQ ID NO.4, respectively, and the nucleotide sequences of the upstream primer and downstream primer of the internal reference gene GAPDH were SEQ ID NO.11 and SEQ ID NO.12, respectively. Premix Ex Taq TMII (Tli RNaseH Plus) manual configuration system and set the program (annealing temperature is set to 59 ° C), use the kit to complete the fluorescence quantitative PCR experiment, according to the Ct value of the fluorescence quantitative PCR experiment, with GAPDH as the internal reference gene, and 2 -ΔΔCt The formula was used to calculate the fold change in the expression of the PDCoVM gene between the mimic group and the mimic control group.

[0083] AGGAGTAAGAGCCCCTGGA, SEQ ID NO.11;

[0084] TCTGGGATGGAAACTGGAA, SEQ ID NO. 12.

[0085] The results are as follows Figure 3 and Figure 4 As shown, Figure 3 It was shown that the expression of ssc-miR-148a-5p was significantly increased in PDCoV-infected IPEC-J2 cells 24 h after transfection with mimics that increased ssc-miR-148a-5p expression. Figure 4 The results showed that in IPEC-J2 cells with increased expression of ssc-miR-148a-5p, the expression of PDCoV M gene decreased significantly, indicating that the proliferation level of PDCoV was significantly reduced. This suggests that increasing the expression of ssc-miR-148a-5p inhibits the proliferation of PDCoV in IPEC-J2 cells.

[0086] Example 4

[0087] Reduction of ssc-miR-148a-5p expression promotes PDCoV proliferation in IPEC-J2 cells

[0088] 1. Experimental cell culture:

[0089] IPEC-J2 cells were seeded in 96-well plates and cultured in high-glucose DMEM medium containing 10% volume concentration of fetal bovine serum at 37° C. and 5% CO 2 to a cell monolayer with 80% confluence.

[0090] 2. Cell transfection and virus infection experiments:

[0091] 0.75 μL of an inhibitor (nucleotide sequence as shown in SEQ ID NO.2) for reducing ssc-miR-148a-5p expression with a final concentration of 150 nM and an inhibitor control were added to 5 μL Opti-MEM medium, mixed thoroughly, and allowed to stand for 10 min; 0.3 μL of Lipofectamine 3000 Reagent was added to 5 μL Opti-MEM medium, mixed thoroughly, and allowed to stand for 10 min; the diluted inhibitor solution and inhibitor control solution were mixed thoroughly with Lipofectamine 3000 Reagent added to Opti-MEM, and allowed to stand for 15 min; IPEC-J2 cells pre-seeded in a 96-well plate were rinsed with Opti-MEM medium, and then the above inhibitor / inhibitor control and Lipofectamine The mixture of 3000 Reagent was added to the cells in each well, 90 μL per well, and after gentle shaking, the cells were placed in a cell culture incubator at 37°C and 5% CO2. After 24 hours, the PDCoV-TJ1 strain was inoculated into IPEC-J2 cells at an MOI of 1.0 (100 μL per well, containing a final volume concentration of 1% pancreatin), and then cultured at 37°C and 5% CO2. The IPEC-J2 cell pellet was harvested 24 hours after infection.

[0092] AGTCGGAGTGTCTCAGAACTTT, SEQ ID NO. 2.

[0093] 3. Total RNA extraction, miRNA RT product and cDNA product synthesis:

[0094] Total RNA was extracted using the TRIzol method. The total RNA was reverse transcribed into miRNA RT products using the riboSCRIPT Reverse Transcription Kit (500T). The nucleotide sequence of the ssc-miR-148a-5p stem-loop primer used in the reverse transcription was SEQ ID NO.6. 5 μg of total RNA was added to each 10 μL system. The reverse transcription procedure was 42°C for 60 min and 70°C for 10 min. PrimeScript TM RT reagent Kit (Perfect Real Time) was used to reverse transcribe total RNA into cDNA. 1 μg of total RNA was added to every 20 μL system. The reverse transcription procedure was 30°C for 10 min, 42°C for 1 h, and 99°C for 5 min.

[0095] 4.ssc-miR-148a-5p fluorescence quantitative PCR:

[0096] The miRNA RT product obtained by reverse transcription was used as a template for fluorescence quantitative PCR; the primers of ssc-miR-148a-5p and the internal reference gene U6 were diluted to 200 nM, respectively, the nucleotide sequences of the upstream primer and downstream primer of ssc-miR-148a-5p were SEQ ID NO.7 and SEQ ID NO.8, respectively, and the nucleotide sequences of the upstream primer and downstream primer of the internal reference gene U6 were SEQ ID NO.9 and SEQ ID NO.10, respectively, and the Bulge-LoopTM miRNA qRT-PCR StarterKit was used, and the system was configured and the program was set according to the instructions (annealing temperature was set to 60°C); according to the Ct value of the fluorescence quantitative PCR experiment, U6 was used as the internal reference gene, and 2 -ΔΔCt The formula was used to calculate the fold change of ssc-miR-148a-5p expression between the inhibitor group and the inhibitor control group.

[0097] 5. PDCoV M gene fluorescence quantitative PCR:

[0098] The cDNA product obtained by reverse transcription was used as a template for fluorescent quantitative PCR; the primers of the PDCoV M gene and the internal reference gene GAPDH were diluted to 10 μM, respectively, the nucleotide sequences of the upstream primer and downstream primer of the PDCoV M gene were SEQ ID NO.3 and SEQ ID NO.4, respectively, and the nucleotide sequences of the upstream primer and downstream primer of the internal reference gene GAPDH were SEQ ID NO.11 and SEQ ID NO.12, respectively. Premix Ex Taq TM II (Tli RNaseH Plus) manual configuration system and set the program (annealing temperature is set to 59 ° C), use the kit to complete the fluorescence quantitative PCR experiment, according to the Ct value of the fluorescence quantitative PCR experiment, with GAPDH as the internal reference gene, and 2 -ΔΔCt The formula was used to calculate the fold change in the expression of the PDCoVM gene between the inhibitor group and the inhibitor control group.

[0099] The results are as follows Figure 5 and Figure 6 As shown, Figure 5 The results showed that the expression level of ssc-miR-148a-5p was significantly reduced in PDCoV-infected IPEC-J2 cells 24 h after transfection of an inhibitor that reduces the expression of ssc-miR-148a-5p. Figure 6The results showed that in IPEC-J2 cells where ssc-miR-148a-5p expression was inhibited, the expression of PDCoV M gene increased significantly, indicating that the proliferation level of PDCoV increased significantly. This suggests that inhibiting the expression of ssc-miR-148a-5p promotes the proliferation of PDCoV in IPEC-J2 cells.

[0100] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0101] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of ssc-miR-148a-5p in the preparation of anti-PDCoV proliferation drugs and vaccines; The nucleotide sequence of the ssc-miR-148a-5p is shown in SEQ ID NO.1; AAAGUUCUGAGACACUCCGACU, SEQ ID NO.

1.

2. Use of the ssc-miR-148a-5p described in claim 1 as a target in the preparation of drugs and / or vaccines for treating and / or preventing PDCoV.

3. The use according to claim 2, characterized in that The expression level of ssc-miR-148a-5p needs to be increased.

4. A drug for resisting PDCoV proliferation, characterized in that: Including substances that increase the expression level of ssc-miR-148a-5p.

5. The drug according to claim 4, characterized in that The nucleotide sequence of the substance that increases the expression of ssc-miR-148a-5p is as follows: AAAGUUCUGAGACACUCCGACU, SEQ ID NO.1.

Images