Hepatitis B related hepatocellular carcinoma long-chain non-coding RNA molecular marker NDUFV2-AS1 and application thereof

Abstract

The invention discloses a hepatitis B related hepatocellular carcinoma long-chain non-coding RNA molecular marker NDUFV2-AS1 and application thereof, relates to the technical field of tumor molecular biology, and has the technical key points that the objective existence of a new long-chain non-coding RNA NDUFV2-AS1 gene in hepatocellular carcinoma tissues is provided and confirmed for the first time; the LncRNA NDUFV2-AS1 marker is applied to early screening of the liver cancer, and the kit is applied to early screening of the liver cancer. The LncRNA NDUFV2-AS1 marker and the kit for early screening of liver cancer provided by the invention can provide a more reliable judgment basis for early screening of liver cancer, and can perform comprehensive evaluation with other tumor early screening markers through objective indexes of the expression level of the LncRNA NDUFV2-AS1 molecular marker, so that the diagnosis accuracy can be improved, the diagnosis process can be simplified, and the diagnosis efficiency can be improved. The important effect is achieved in liver cancer diagnosis and treatment.

Description

Technical Field

[0001] The present invention relates to the technical field of tumor molecular biology, and in particular to a hepatitis B-related hepatocellular carcinoma long-chain non-coding RNA molecular marker NDUFV2-AS1 and an application thereof. Background Art

[0002] Hepatocellular carcinoma is one of the most common malignant tumors in the world that seriously threatens human health. The latest report released by the International Union Against Cancer shows that HCC is the fifth most common malignant tumor in men (about 52,300 new cases each year, accounting for about 7.9% of all male malignant tumor patients), and the seventh most common malignant tumor in women (about 226,000 new cases each year, accounting for about 6.5% of all female malignant tumor patients). The current global incidence of HCC is still increasing year by year, with nearly one million new HCC patients each year, of which 85% are from developing countries. my country has long been the region with the highest incidence and number of patients with primary liver cancer in the world. According to statistics, the number of HCC patients in my country accounts for about 55% of the global incidence, and about 330,000 people die from HCC each year, accounting for 45% of the global deaths from the disease. Early HCC-related research focused mainly on protein-coding genes. However, less than 2% of genomic DNA encodes proteins, while the remaining 98% of non-coding sequences and their RNA transcripts (ncRNAs) have been considered noise in the past and their functions have not been identified. In recent years, increasing evidence has shown that these evolutionarily conserved RNA transcripts, such as microRNA (miRNA), circular RNA (circRNA), piwi-interactions RNA (piRNA), and especially long noncoding RNA (lncRNA), also play important roles in a variety of physiological and pathological processes.

[0003] LncRNA is a type of RNA molecule with a transcript length of more than 200 nucleotides and does not encode proteins. It has good tissue specificity and spatiotemporal specificity. The expression of LncRNA varies between different tissues, and the expression of LncRNA in the same tissue or organ at different growth stages will also change. LncRNA can regulate gene expression at multiple levels, such as interacting with proteins, forming endogenous siRNA, regulating mRNA shearing, chromatin remodeling and histone remodeling, and transcriptional regulation. Studies have shown that LncRNA is closely related to the occurrence, development and prognosis of various tumors. The change in its expression and its mutation can not only promote the occurrence and metastasis of tumors, but also have the function of inhibiting and promoting tumor occurrence, including hepatocellular carcinoma (HCC). Since LncRNAH19 was discovered in fetal liver tissue in 1990, more than 50,000 genes have been found to transcribe LncRNA, and its number is still growing rapidly. However, to date, the role of most LncRNAs in liver diseases is still unclear, and only a small part of them has been widely studied.

[0004] In my country, more than 85% of HCCs are associated with HBV infection. Persistent HBV infection and chronic inflammatory infection caused by high viral replication are important factors in the occurrence of HBV-related HCC. The occurrence and progression mechanism of HBV-related HCC is very complex, which is regulated by the complex signal network system in the host body and is also affected by HBV-related factors such as HBV replication level and HBVX protein (HBx).

[0005] Studies have found that LncRNAs can regulate HBV replication and HCC occurrence by regulating host and / or viral gene expression.

[0006] 1) LncRNA can hijack host cells to promote their replication or production by regulating the transcriptional mechanism. For example, HBx can act as a transcriptional coactivator and participate in regulating transcriptional activator-dependent gene transcription (including NSFC2022LncRNA). Studies have found that HBx can upregulate the expression of oncogenic LncRNA HUR1 and prevent p53 from promoting liver cancer growth by binding to LncRNA HUR1. In addition, HBx can also promote HCC metastasis by downregulating the expression of tumor suppressor LncRNA Dreh to re-express vimentin;

[0007] 2) LncRNA plays a key role in immune surveillance of viral infection. Viruses can regulate antiviral responses through lncRNAs encoded by the host or their own genome. For example, HCV infection can upregulate the levels of a series of lncRNAs, such as IFI6, CMPK2, and EGOT, which can inhibit the expression of interferon-stimulated genes (ISGs), leading to immunosuppression and chronic inflammation;

[0008] 3) LncRNA can also be generated from a complete genome to regulate HBV replication and related HCC progression in the form of chimeras. Lau et al. reported a virus-human gene fusion to produce a chimeric LncRNA HBx-LINE1, which promoted HCC by activating Wnt signaling. Ren F et al. found that LncRNA HOTAIR was significantly upregulated in HBV-infected cells and PBMCs of patients with chronic hepatitis B (CHB). The high expression level of HOTAIR was not only associated with high levels of ALT / AST in CHB patients, but also positively correlated with HBsAg and HBV DNA levels; functional analysis showed that HOTAIR could regulate the level of HBV covalently closed circular DNA (cccDNA) binding to SP1, thereby increasing the activity of the HBV promoter and promoting HBV transcription and replication;

[0009] 4) The LncRNAs-miRNA-mRNAceRNA network constructed by HBV replication-specific LncRNAs is a new hotspot in the current research on the occurrence and progression of HBV-related diseases. Feng J et al. found that LncRNA PCNAP1 can not only enhance HBV replication by regulating miR-154 / PCNA / HBV cccDNA signals in vitro and in vivo, but also promote HCC growth through PCNAP1 / PCNA signals.

[0010] In summary, LncRNAs play an important role in the occurrence and progression of HBV-related diseases. Some of their regulatory mechanisms may be related to the specific LncRNAs-miRNA-mRNA ceRNA regulatory network they construct. However, the mechanism of how HBV-specific LncRNAs affect downstream signaling pathways through their ceRNA network to participate in regulating HBV replication and promote HCC occurrence is still unknown.

[0011] Therefore, the present invention aims to provide a hepatitis B-related hepatocellular carcinoma long non-coding RNA molecular marker NDUFV2-AS1 and its application to solve the above problems. Summary of the invention

[0012] The purpose of the present invention is to solve the above problems and provide a hepatitis B-related hepatocellular carcinoma long non-coding RNA molecular marker NDUFV2-AS1 and its application.

[0013] In order to achieve the above object, the technical solution of the present invention is as follows:

[0014] The present invention provides a long non-coding RNA molecular marker NDUFV2-AS1 for hepatitis B-related hepatocellular carcinoma, and the nucleotide sequence of the molecular marker NDUFV2-AS1 is shown in SEQ ID NO. 1. NDUFV2-AS is the full name of NDUFV2 antisense RNA1, which is a long non-coding RNA gene located on the opposite side chain of the protein-coding gene NDUFV2 genome span, and is the RNA number of the relevant database.

[0015] SEQ ID NO.1:

[0016] The nucleotide sequence is as follows:

[0017] NR_110771.1:

[0018] >NR_110771.1Homo sapiens NDUFV2 antisense RNA 1(NDUFV2-AS1),transcript variant 1,long non-coding RNA

[0019] GGGCGGCGTGACCGCCCCGCCCCCCGGCGCCCGCCCCTCCTGCTGCTCAGCCAGGCTCCGCGAGCCGCAGGGCGGGGAAGCGGGACGTACCAAGCGGCAGGCGGCGGAGGGGTGCGGGCCGGAACTCCGCCCTTCGTGCTGGTCGGTCTCCACGCCCCACTCGGACTAGTGTCACCGCCTCCCCGCCGCAGACACTATCCGACAAAGGAGGGGGAATCAAAGGCTGGGCGAAGAGGCAGGGCAGGCGCCGGTGACGCTGCTGGGCAAGCGGGCTCTGCAGTAGCATTTGTGGCGACCGTGGCAGTGGCTGTGACTGGAAGCTTCTGGAAATGGCGGCGATGAGGACCCCCACATAGGGATGGCCATAGCAGCCACAAAAGGAAGCAAACAAGAACAAGTCCTGATGGAGCAATTTATGAAGACAGGCAGCATAGAGGGAGAAGAACCTGTCTGTCAACCCCACACACGCTTTCCCAGACGTCTCCTGAAAGCTGAGCATTTGTTATCTTAAAGCCTCTTACCAGTTTGGATAGATATGGATCTTCCAAAATTAATGAGCTCCTTAATATCGACACTGTTTATCAACATAAAGGATCAATTTAGGAAGATTATAAAAACTGAAGTTTCCGGAACAATAAATGGGAGAATTAATCTTCTGAATCAAGGACGTATCCCTGAATCTGGGGAGCTCTCTATCAAAATATACATGCTGGAACCCTACCAAAGGAATAATAAATCTGGAATGAGGCTCTGACTGTCTAATTAGGAAAAGACTCCTTCCTGGAATTCTGCACATCTCCCTACACCTTAGTGACGGTTAAATAAATAATTATTAAGCTTCTGGA

[0020] The present invention also provides an application of a long non-coding RNA molecular marker NDUFV2-AS1 related to hepatitis B-associated hepatocellular carcinoma in the detection of liver cancer tissues.

[0021] The present invention also provides a use of a specific primer for amplifying the nucleotide sequence of NDUFV2-AS1, a long non-coding RNA molecular marker for hepatitis B-related hepatocellular carcinoma, in the preparation of a kit for early screening of liver cancer.

[0022] Furthermore, the amplification product of the nucleotide sequence of the molecular marker NDUFV2-AS1 is a single band, and there is no non-specific amplification, and the nucleotide sequence of the specific primer is:

[0023] Upstream primer: 5′-TGCTGGAACCCTACCAAAGG-3′;

[0024] Downstream primer: 5′-ACCGTCACTAAGGTGTAGGG-3′.

[0025] Furthermore, the kit uses a two-step real-time fluorescence quantitative PCR method to detect NDUFV2-AS1 in liver cancer tissue.

[0026] Furthermore, the kit includes reverse transcriptase, buffer, water, amplification primers, DNA polymerase, and dNTPs.

[0027] Compared with the prior art, this solution has the following beneficial effects:

[0028] 1. The solution of the present invention provides and confirms for the first time the objective existence of a new long non-coding RNA NDUFV2-AS1 gene in liver cancer tissue;

[0029] 2. The NDUFV2-AS1 marker and kit for early screening of liver cancer provided in the scheme of the present invention can provide a more reliable basis for judgment for early screening of liver cancer, and can comprehensively evaluate other tumor early screening markers through the objective index of the expression level of the NDUFV2-AS1 molecular marker, thereby improving the diagnostic accuracy, simplifying the diagnostic process, and playing a significant role in the diagnosis and treatment of liver cancer. DETAILED DESCRIPTION

[0030] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in the field without creative work should fall within the scope of protection of the present invention.

[0031] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0032] Example:

[0033] The scheme provided by the embodiment of the present invention is as described in the above invention content: a long non-coding RNA molecular marker LncRNA-NDUFV2-AS1 for hepatitis B-related hepatocellular carcinoma is provided, NDUFV2-AS1 (the RNA number of the relevant database) is the full name of NDUFV2 antisense RNA1, which is a long non-coding RNA gene located on the opposite side chain of the genome span of the protein-coding gene NDUFV2. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1 in the invention content.

[0034] In this embodiment, the above-mentioned hepatitis B-related hepatocellular carcinoma long non-coding RNA molecular marker LncRNA NDUFV2-AS1 can be applied to the detection in liver cancer tissue.

[0035] In this example, specific primers for amplifying the NDUFV2-AS1 nucleotide sequence are used to prepare a kit for early screening of liver cancer.

[0036] In this example, the amplification product of the NDUFV2-AS1 nucleotide sequence is a single band, and there is no non-specific amplification, and the primer nucleotide sequence is:

[0037] Upstream primer: 5′-TGCTGGAACCCTACCAAAGG-3′;

[0038] Downstream primer: 5′-ACCGTCACTAAGGTGTAGGG-3′.

[0039] In this embodiment, the kit uses a two-step real-time fluorescence quantitative PCR method to detect NDUFV2-AS1 in liver cancer tissues, and the kit is mainly composed of reverse transcriptase, buffer, water, amplification primers, DNA polymerase, dNTP, etc. The properties of the above reagents are well known, and the preparation method thereof is prepared by a method well known to those skilled in the art.

[0040] The present invention found that NDUFV2-AS1 was significantly upregulated in liver cancer tissues relative to adjacent tissues of liver cancer patients. It is located in the human chromosome 18p11.22 region, has a total length of 845 bp, and contains 4 exons. Analysis using an open reading frame finder showed that the gene sequence had 6 open reading frames, which could only encode short peptides of 26 to 250 amino acids in length, respectively. Therefore, it conforms to the molecular characteristics of LncRNA and does not have the ability to encode proteins, but it may play a role as a carcinogenic factor in the occurrence and development of liver cancer. In the early stage, we obtained the public RNA sequencing data of 374 HCC tissues and 50 normal tissues from the public database The Cancer Genome Atlas (TCGA) database (https: / / cancergenome.nih.gov / ) for verification. The RNA expression data was expressed as transcripts per million (TPM) and converted to a logarithm with a base of 2 for normalization. The results showed that NDUFV2-AS1 was highly expressed in HCC tissues in both unpaired and paired samples (P<0.001). In addition, using bioinformatics analysis technology, the expression of NDUFV2-AS1 in 374 HCC tissues and 50 normal tissues was used for receiver operating characteristic (ROC) curve analysis of its diagnostic efficacy. The ROC curve showed that NDUFV2-AS1 has the ability to distinguish normal tissues from HCC tissues (AUC=0.890, 95%CI[0.849-0.931]). Therefore, the applicant of the present invention proposed a scientific hypothesis based on literature and research work that NDUFV2-AS1 can be used as an early biological marker for predicting liver cancer, and it has been confirmed by experiments.

[0041] The following is the experimental method of the experimental example of the present invention:

[0042] 1. Synthesize primers for NDUFV2-AS1 gene amplification. The primer sequences and related information are shown in Table 1, including primer sequences, GC content, TM value and other related information.

[0043] Table 1 Primer sequences for real-time fluorescence quantitative PCR

[0044]

[0045] 2. Preparation of total RNA from samples

[0046] (1) The total RNA from liver cancer tissue was extracted by Trizol method. 0.2 g of tissue was taken and ground under liquid nitrogen until powder. 1 ml of Trizol was added to the liquid nitrogen and the grinding was continued. After the Trizol was ground into dry powder, it was allowed to stand at room temperature. After the dry powder turned into liquid, all the liquid was collected.

[0047] (2) After the sample liquid was lysed at room temperature for 5 minutes, 0.2 ml of chloroform was added to every 1 ml of Trizol grind homogenate, the tube cap was tightly closed, and vortexed for 15 seconds. After standing for stratification, the mixture was centrifuged at 12000 rpm for 15 minutes at 4°C. After centrifugation, the mixed liquid was separated into a lower phenol chloroform phase, a middle protein layer, and an upper colorless aqueous phase. All RNA was distributed in the aqueous phase.

[0048] (3) Transfer the aqueous phase to a new centrifuge tube, add 0.5 ml of isopropanol to 1 ml of Trizol homogenate, mix manually, let stand at -20°C for 30 min, and centrifuge at 12,000 rpm for 15 min at 4°C to obtain a precipitate. All RNA is present in the precipitate.

[0049] (4) Remove the supernatant, add 1 ml of 75% ethanol to wash the RNA precipitate, and centrifuge at 7500 rpm for 5 minutes at 4°C.

[0050] (5) Remove the ethanol solution and dry at room temperature for 5-10 minutes until the ethanol evaporates (do not allow the RNA to dry completely, as this will reduce its solubility). Add RNase-free deionized water to the centrifuge tube and incubate at 60°C for 5 minutes to obtain total RNA.

[0051] (6) The concentration and purity of the extracted total RNA were measured using NanoDrop ND-2000 to ensure that the concentration and purity of the total RNA could meet the requirements of subsequent experiments. The total RNA solution was stored in a -80°C refrigerator.

[0052] 3. Synthesis of the first-strand cDNA sequence (the first step of the two-step method)

[0053] Take a PCR tube and prepare the reverse transcription system. The reverse transcription system is: 1 μl total RNA (about 500 ng), 1 μl random primers (Thermo), 10 μl ddH2O (Tiangen Biotechnology Co., Ltd.), 2 μl dNTP mixture (dATP, dGTP, dCTP and dTTP, Invitrogen), 4 μl reverse transcription buffer (Thermo), 1 μl RNase inhibitor (Thermo), 1 μl reverse transcriptase (Thermo), and the total volume is 20 μl. The reaction conditions are: 25℃5min; 42℃60min, 70℃5min. Reverse transcription is performed using an ABI PCR amplifier. cDNA is stored at -80℃ for later use.

[0054] 4. LncRNA NDUFV2-AS1 gene cDNA amplification verification

[0055] Take 2μl of the cDNA reverse transcribed in step 3 and configure the system for PCR amplification. The PCR amplification system is: 2μl cDNA, 0.5μl upstream specific primer, 0.5μl downstream specific primer, 7μl ddH2O (Tiangen Biotechnology Co., Ltd.), 10μl PCR amplification Mix (TAKARA), and a total volume of 20μl. The reaction conditions are 94℃5min; 35 cycles of 94℃30s, TM℃20s, and 72℃20s; 72℃5min. Take 2μl of the reaction product and verify whether the PCR product is a single specific amplification band under the conditions of 1.5g agarose / 100ml 1×TAE buffer, 120V voltage, and 25min.

[0056] 5. LncRNA NDUFV2-AS1 gene detection kit (two-step method, step 2)

[0057] The cDNA samples obtained by reverse transcription were used for detection. The reaction system was: 2μl cDNA, 0.8μl upstream specific primer, 0.8μl downstream specific primer, 6.4μl ddH2O (Tiangen Biotechnology Co., Ltd.), 10μl fluorescence quantitative PCR amplification Mix (SYBGREEN dye), and a total volume of 20μl. Real-time PCR reaction conditions: 95℃ pre-denaturation for 5min; then 98℃10s, 62℃30s for 40 cycles. The amplification reaction was performed on a real-time fluorescence quantitative PCR instrument LightCyler480. While amplifying the target gene, β-actin was amplified as an internal reference, and the relative expression of the gene was calculated by the 2(-△△CT) method.

[0058] Through the above embodiments of the present invention, the scheme of the present invention provides and confirms for the first time the objective existence of a new long non-coding RNA NDUFV2-AS1 gene in liver cancer tissue; and the NDUFV2-AS1 marker and kit for early screening of liver cancer provided in the scheme of the present invention can provide a more reliable judgment basis for early screening of liver cancer, and can comprehensively evaluate the expression level of the NDUFV2-AS1 molecular marker with other early screening markers for tumors through objective indicators, thereby improving the diagnostic accuracy, simplifying the diagnostic process, and playing a significant role in the diagnosis and treatment of liver cancer.

[0059] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A long non-coding RNA molecular marker NDUFV2-AS1 for hepatitis B-related hepatocellular carcinoma, Its characteristics are: The nucleotide sequence of the molecular marker NDUFV2-AS1 is shown in SEQ ID NO.

1.

2. Use of the hepatitis B-related hepatocellular carcinoma long non-coding RNA molecular marker NDUFV2-AS1 as described in claim 1 in detecting liver cancer tissue.

3. Use of a specific primer for amplifying the nucleotide sequence of NDUFV2-AS1, a long non-coding RNA molecular marker for hepatitis B-related hepatocellular carcinoma as claimed in claim 1, in the preparation of a kit for early screening of liver cancer.

4. The use according to claim 3, Its characteristics are: The amplification product of the nucleotide sequence of the molecular marker NDUFV2-AS1 is a single band, and there is no non-specific amplification. The nucleotide sequence of the specific primer is: Upstream primer: 5′-TGCTGGAACCCTACCAAAGG-3′; Downstream primer: 5′-ACCGTCACTAAGGTGTAGGG-3′.

5. The use according to claim 3, Its characteristics are: The kit uses a two-step real-time fluorescence quantitative PCR method to detect NDUFV2-AS1 in liver cancer tissues.

6. The use according to claim 5, Its characteristics are: The kit comprises reverse transcriptase, buffer, water, amplification primers, DNA polymerase and dNTP.

Images