St3gal4 gene snp molecular marker related to yellow-feathered broiler feed conversion rate and application thereof

By developing SNP molecular markers for the ST3GAL4 gene in yellow-feathered broilers, especially the rs1059726276 locus, individuals with the GG genotype were screened. This solved the problem of the limited number of SNP markers related to chicken feed conversion ratio in existing technologies, enabling efficient breeding of yellow-feathered broilers with low feed conversion ratio, and improving breeding efficiency and economic benefits.

CN119162341BActive Publication Date: 2026-06-26SOUTH CHINA AGRICULTURAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTH CHINA AGRICULTURAL UNIVERSITY
Filing Date
2024-11-08
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

The number of SNP molecular markers related to chicken feed conversion rate in the existing technology is small, and there is a lack of effective molecular markers for the breeding of yellow-feathered hens with low feed conversion rate, resulting in long breeding cycles, high costs and low breeding accuracy.

Method used

A molecular marker for the ST3GAL4 gene SNP associated with feed conversion ratio in yellow-feathered broilers was developed, specifically a polymorphism of G/A at rs1059726276, located at base 471871 on chromosome 24 of chicken. PCR amplification and sequencing were performed using designed primer combinations and kits to screen homozygous individuals with the GG genotype to reduce feed conversion ratio.

Benefits of technology

This technology enables efficient screening and breeding of yellow-feathered broilers with low feed conversion rates, reducing feed consumption during production, improving the company's economic benefits and competitiveness, shortening the breeding cycle, and avoiding the phenomenon of introduction-degeneration-reintroduction.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119162341B_ABST
    Figure CN119162341B_ABST
Patent Text Reader

Abstract

The application discloses a SNP molecular marker of a ST3GAL4 gene related to feed conversion rate of yellow-feathered broilers and application thereof, and belongs to the technical field of genetic genes. The SNP molecular marker has an RS number of rs1059726276, a polymorphism of G / A, and is located at the 471871th base of a 24th chromosome of a chicken. The molecular marker provided by the application is verified to be significantly related to a feed conversion rate character of a yellow-feathered broiler breeder, can be applied to breeding of the yellow-feathered broiler breeder, and can effectively reduce feed consumption in a production process and improve economic benefits and competitiveness of enterprises in the breeding process by selecting and keeping yellow-feathered broiler breeders with low feed conversion rate. The primer and the kit for identifying the SNP molecular genetic marker are provided, and can be applied to high-efficiency screening of yellow-feathered broiler breeders with excellent feed conversion rate.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic technology, specifically to a SNP molecular marker of the ST3GAL4 gene related to feed conversion rate in yellow-feathered broiler chickens and its application. Background Technology

[0002] Feed conversion ratio (FCR) is an important economic trait that has always been a key focus for poultry farming enterprises and breeder improvement companies both domestically and internationally. In the mid-20th century, the feed / gain ratio (F / G) was used to study feed efficiency, and this trait is a quantitative trait with moderate heritability. Yellow-feathered broilers are a unique genetic resource in my country, and high quality and efficiency are the breeding directions for them. In 2015, Mignon G et al. detected 13 QTLs related to FCR in chickens. ST3GAL4 encodes an enzyme involved in glycosylation modification, which adds sialic acid groups to sugar chains. Glycosylation modification plays an important role in protein synthesis and cell signaling, especially in the synthesis of glycolipids and glycoproteins, processes closely related to energy metabolism and metabolic regulation. A study selected the SNP locus rs475471G>A on ST3GAL4 and conducted population genetic analysis on 18 chicken breeds. The analysis showed that QTLs within ST3GAL4 were highly correlated with alkaline phosphatase (ALP) levels, and ALP activity can reflect the growth traits of animals. Among them, individuals with the AA genotype had the highest ALP levels, followed by carriers of the GA and GG genotypes. Carriers of the AA and GA genotypes had higher body weight, half-visceral weight, visceral weight, and leg weight at 4 weeks of age than those with the GG genotype.

[0003] Using SNP markers to assist in the selection of feed utilization efficiency-related traits has a significant impact on chicken production management and enterprise economic benefits. (1) Chickens with low feed conversion ratios have high feed utilization efficiency, which can reduce the amount of feed used and production costs in production, thereby saving feed resources and reducing the amount of pollution discharged by chickens to a certain extent, thus alleviating the pressure of poultry competing with humans for food resources and the environmental problems of the chicken industry. (2) Developing effective molecular markers for the selection of feed efficiency-related traits can greatly shorten the breeding cycle, reduce breeding costs, improve the accuracy of selection, accelerate genetic progress, and avoid the phenomenon of introduction-degeneration-reintroduction.

[0004] Currently, the number of SNP molecular markers related to chicken feed conversion ratio is still relatively small. Discovering and utilizing new genes related to feed conversion ratio is of great significance for chicken genetic breeding. Summary of the Invention

[0005] To address the aforementioned technical problems, the present invention aims to provide a ST3GAL4 gene SNP molecular marker related to feed conversion rate in yellow-feathered broilers and its application, thereby solving the problem that the number of existing SNP molecular markers related to chicken feed conversion rate is relatively small and there is a lack of research on the breeding of yellow-feathered hens with low feed conversion rates using SNP molecular markers.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows:

[0007] A SNP molecular marker for the ST3GAL4 gene associated with feed conversion ratio in yellow-feathered broilers was identified. The RS number of the SNP molecular marker is rs1059726276, the polymorphism is G / A, and it is located at base 471871 on chromosome 24 of chicken.

[0008] Furthermore, the mutation sites and upstream and downstream sequences of the above SNP molecular markers are shown in SEQ ID NO.1, where n is the G>A mutation site. When n is G, it represents yellow-feathered broiler chickens with low feed conversion ratio.

[0009] SEQ ID NO.1: 5'-CTGGGACGCGAGGATGCTCACCCCGAAGGAGA ACATCGGTGGGACTTTGCTCACTCGGCGGTGGTGTTTGGAGAGGTCTCATTGTTCTTAGCGGAGAACAAAGGGATTCTTCCCCCGGGGGGTTCCGCTCCCGTATGGGCGCAGTGCTCGGTGGCCGCGGTCCGTGGGCAGGGAGATGAGGTGCTGAGCGCCGGGTGTTTGnGGAACCGTGCTGGATTT GTGCTGGATTTCAGTGCCGCGGGACCTGGGGAGGTCCCCGTCCTGCTCGGCTGTTGGCAGCTCCAACGCTTTAAGGGCACGTCCGAGCTGCAGTGAGCTCCTGACGTTGCTACCAGCCATAGCATGGGAGCTGCTGGACTCTTCCTACCGCCTGTGCTTAATTATCTGCATCATTAAGGGCTG-3'.

[0010] A primer combination for amplifying the above-mentioned SNP molecular marker, wherein the sequence of the upstream primer is shown in SEQ ID NO.2 and the sequence of the downstream primer is shown in SEQ ID NO.3;

[0011] SEQ ID NO.2: 5'-AACATCGGTGGGACTTTGCTC-3';

[0012] SEQ ID NO. 3: 5'-AATTAAGCACAGGCGGTAGGA-3'.

[0013] A kit for detecting the above-mentioned SNP molecular markers, comprising the above-mentioned upstream primer and downstream primer.

[0014] The above-mentioned SNP molecular markers or primer combinations or kits are used in screening yellow-feathered broiler chickens with excellent traits of low feed conversion ratio.

[0015] A method for screening yellow-feathered broiler chickens with excellent traits of low feed conversion ratio involves using PCR technology to amplify and sequence the SNP molecular markers of the individuals to be tested, and screening to obtain homozygous individuals with the GG genotype at the SNP molecular marker position.

[0016] Furthermore, the SNP molecular markers are amplified and sequenced using the primer combinations or kits described above.

[0017] Furthermore, the PCR amplification system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to a final volume of 20 μL.

[0018] Furthermore, the PCR reaction conditions were as follows: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 15 s, 35 cycles; 72℃ extension for 5 min.

[0019] The present invention has the following beneficial effects:

[0020] (1) The molecular marker provided by the present invention has been verified to be significantly correlated with the feed conversion rate trait of yellow-feathered broiler breeder hens. It can be applied to the breeding of yellow-feathered broiler breeder hens. By selecting and retaining yellow-feathered broiler breeder hens with low feed conversion rate during the breeding process, the amount of feed consumed during production can be effectively reduced, thereby improving the economic benefits and competitiveness of enterprises.

[0021] (2) The present invention provides primers and kits for identifying the above-mentioned SNP molecular genetic markers, which can be applied to efficiently screen individuals or parents of yellow-feathered broiler breeder hens with excellent feed conversion rate. Attached Figure Description

[0022] Figure 1 Manhattan plot of SNP molecular markers in Example 1;

[0023] Figure 2 This is a sequencing diagram of the SNP molecular marker genotype in Example 2. Detailed Implementation

[0024] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0025] Example 1: Screening of SNP molecular markers

[0026] 1892 healthy yellow-feathered broiler breeder hens were selected and fed mixed-feed until 56 days of age, then transferred to individual cages for feeding. The experiment ended at 98 days of age. Daily feed intake, initial body weight, and final body weight were recorded for each hen. Feed conversion ratio was calculated using the following formula:

[0027]

[0028] In the formula, FCR is the feed conversion ratio; W f This refers to feed consumption, expressed in grams (g); W a Weight gain for living organisms, measured in grams.

[0029] A lower FCR value, indicating a lower feed conversion ratio, means less feed is consumed for the same production capacity, thus saving feed. Blood samples were collected from 1872 chickens for DNA extraction. DNA sample quality was assessed using a Qubit Fluorometer for DNA concentration and agarose gel electrophoresis for DNA fragment size and degradation. The results showed 99 samples were substandard, and the remaining 1773 qualified DNA samples from yellow-feathered breeding hens were used for library construction and sequencing. Simplified genome sequencing was performed using high-throughput sequencing technology. Sequencing data underwent quality control and filtering to remove low-quality reads and potential false positive SNPs. Feed conversion ratio was used as a phenotype and correlated with SNP data. GWAS analysis was performed using the EMMAX program (http: / / genetics.cs.ucla.edu / emmax / index.html), and the analysis model is as follows:

[0030] y = Xb + Za + Wp + e;

[0031] In the model, y represents the true value of the trait record, X represents the fixed-effects association matrix, b represents the fixed-effects vector, the fixed effects include batch effects and three principal component effects, Z represents the additive genetic effects association matrix, u represents the individual additive genetic effects vector, e represents the residual, and u ~ N(0, Gσ) 2 α ), e~N(0, Iσ 2 ε α), G represents the genomic kinship matrix, I represents the identity matrix, σ2 α σ 2 ε α represents the variance of the additive genetic effect and the variance of the residuals, respectively, and m represents the SNP marker effect.

[0032] Based on the association analysis results, a SNP molecular marker associated with the feed conversion ratio trait in yellow-feathered hens was identified. This molecular marker is located on chromosome 24 of the chicken. Figure 1 As shown in the Manhattan diagram.

[0033] The 200bp sequences upstream and downstream of the mutation site of this SNP molecular genetic marker are shown below:

[0034] 5'-CTGGGACGCGAGGATGCTCACCCCGAAGGAGAACATCGGTGG GACTTTGCTCACTCGGCGGTGGTGTTTGGAGAGGTCTCATTGTTCTTAGCGGAGAACAAAGGGATTCTTCCCCCGGGGGGTTCGCTCCCGTATGGGCGCAGTGCTCGGTGGCCGCGGTCCGTGGGCAGGGAGATGAGGTGCTGAGCGCCGGGTGTTTGnGGAACCGTGCTGGATTTGTGCTGG ATTTCAGTGCCGCGGGACCTGGGGAGGTCCCCGTCCTGCTCGGCTGTTGGCAGCTCCAACGCTTTAAGGGCACGTCCGAGCTGCAGTGAGCTCCTGACGTTGCTACCAGCCATAGCATGGGAGCTGCTGGACTCTTCCTACCGCCTGTGCTTAATTATCTGCATCATTAAGGGCTG-3'(SEQ ID NO.1);

[0035] n is the mutation site. The n at the 101st nucleotide of the above sequence is either A or G, i.e., n(G / A), which leads to the polymorphism of the above sequence. 5'- and -3' are the 5' end and 3' end of the nucleotide sequence, respectively.

[0036] Example 2: Validation of SNP molecular markers

[0037] The SNP molecular markers obtained in Example 1 were validated in another group of yellow-feathered broiler breeder hens, totaling 1773 healthy individuals. All experimental chickens were fed together until 56 days of age, and then transferred to individual cages for feeding. The experiment ended at 98 days of age. The daily feed intake, initial body weight, and final body weight of each chicken were recorded, and the feed conversion ratio was calculated. 150 individuals with low feed conversion ratio (FCR < 3.0) and 150 individuals with high feed conversion ratio (FCR > 3.0) were selected, and blood samples were taken for DNA extraction. The mean FCR of the 150 individuals with low feed conversion ratio was 2.8 ± 0.18, and the mean FCR of the individuals with high feed conversion ratio was 3.2 ± 0.19.

[0038] Using the extracted DNA as a template, the forward primer sequence is shown in SEQ ID NO.2, specifically: 5'-AACATCGGTGGGACTTTGCTC-3'; the reverse primer sequence is shown in SEQ ID NO.3, specifically: 5'-AATTAAGCACAGGCGGTAGGA-3'.

[0039] PCR was performed using the following amplification system: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to a final volume of 20 μL. The PCR conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 15 s, for 35 cycles; and a final extension at 72℃ for 5 min. The PCR products were sequenced using Sanger sequencing.

[0040] The sequencing results were analyzed, and the genotype of each individual was recorded according to the sequencing peak diagram of each sample, such as... Figure 2 As shown, the GG genotype sequencing peak diagram shows only one peak at the corresponding site, indicating that the alleles are the same, both being G; the GA genotype sequencing peak diagram shows two peaks at the corresponding site, indicating that the alleles are different, one being G and the other being A.

[0041] One-way ANOVA using SPSS 26.0 was used to analyze the genotype and allele frequencies of SNP molecular markers in relation to residual feed intake. The results are shown in Tables 1 and 2. Among these SNP molecular markers, both genotype and allele frequencies showed highly significant differences between the low feed conversion ratio (FCR) and high FCR groups (P < 0.01). In the low FCR group, the frequency of the G allele was higher than that of the A allele, and the frequency of the GG genotype was higher than that of the GA genotype, indicating that individuals with the GG genotype at position 201 had a superior residual feed intake phenotype compared to those with the GA genotype. This further demonstrates that the polymorphism of the screened molecular markers is significantly correlated with the feed conversion ratio trait, and these are SNP loci associated with the feed conversion ratio trait, which can be used for breeding yellow-feathered broiler breeder hens with low feed conversion ratio. Table 1: Statistical differences in the distribution of SNP molecular marker genotypes between low and high feed conversion ratios.

[0042] chromosome site genotype High FCR (%) Low FCR (%) Chi-square value (P) Chr24 471871bp GG 62(41.3%) 93(62%) 14.321 GA 88(58.7%) 57(38%) <![CDATA[3.1×10 -6 ]]>

[0043] Table 2. Statistical table of distribution differences of SNP molecular marker alleles between low and high feed conversion ratios.

[0044] chromosome site genotype High FCR (%) Low FCR (%) Chi-square value (P) Chr24 471871bp G 212(70.7%) 243(81%) 10.231 A 88(29.4%) 57(19%) <![CDATA[2.1×10 -6 ]]>

[0045] Example 3: A method for assisting molecular breeding of feed conversion ratio traits using SNP molecular marker alleles.

[0046] This embodiment provides a method for assisting molecular breeding of traits with low feed conversion ratio using the above-mentioned SNP molecular marker kit, including the following steps:

[0047] (1) Blood was collected from the wing vein of the individual to be tested, anticoagulated with EDTA, stored at -20℃, and DNA was extracted.

[0048] (2) Amplification was performed using the DNA extracted in step (1) as a template via a kit. The PCR amplification system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to a final volume of 20 μL. The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 15 s, for 35 cycles; and 72℃ extension for 5 min.

[0049] (3) The PCR products obtained in step (2) were sequenced using the Sanger sequencing method.

[0050] (4) Based on the genotyping results, homozygous individuals with the SNP marker rs1059726276 as the GG genotype were selected for breeding to reduce feed conversion rate and effectively reduce feed consumption and breeding costs. Individuals with this marker were selected to join the core breeding population, which can achieve rapid homozygosity of the alleles related to this trait and provide technical support for accelerating the progress of genetic selection.

[0051] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer combination or kit for amplifying the ST3GAL4 gene SNP molecular marker associated with feed conversion ratio in yellow-feathered broilers, used in screening yellow-feathered broilers with low feed conversion ratio, characterized in that, The RS number of the SNP molecular marker is rs1059726276, and the polymorphism is G / A. When the SNP is G, it indicates a yellow-feathered broiler with low feed conversion ratio. The kit includes the primer combination.

2. The application according to claim 1, characterized in that, The mutation sites and upstream and downstream sequences of the SNP molecular marker are shown in SEQ ID NO.1, where n is the G>A mutation site. When n is G, it is a yellow-feathered broiler with low feed conversion ratio.

3. The application according to claim 1, characterized in that, The forward primer sequence is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.

3.

4. A method for screening yellow-feathered broiler chickens with excellent low feed conversion ratio, characterized in that, Using PCR technology, the SNP molecular markers described in any one of claims 1-3 of the individuals to be tested are amplified and sequenced to screen for homozygous individuals with the GG genotype at the SNP molecular marker location.

5. The method for screening yellow-feathered broiler chickens with excellent low feed conversion ratio according to claim 4, characterized in that, SNP molecular markers are amplified and sequenced using the primer combinations or kits described in any one of claims 1-3.

6. The method for screening yellow-feathered broiler chickens with excellent low feed conversion ratio according to claim 4, characterized in that, The PCR amplification system was as follows: 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O added to a final volume of 20 μL.

7. The method for screening yellow-feathered broiler chickens with excellent low feed conversion ratio according to claim 4, characterized in that, The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃ denaturation for 15 s, 56℃ annealing for 10 s, 72℃ extension for 15 s, 35 cycles; 72℃ extension for 5 min.