Application of ezetimibe in preparation of medicine for treating triple negative breast cancer

Abstract

The invention relates to the field of tumor treatment, in particular to application of a small molecule compound ezetimibe in preparation of a medicine for treating triple negative breast cancer. It is proved for the first time that ezetimibe can inhibit migration and invasion of breast cancer MDA-MB-231 and 4T1 cells; it is proved for the first time that ezetimibe can inhibit EMT of MDA-MB-231 and 4T1 cells; it is proved for the first time that ezetimibe inhibits TGF beta expression of MDA-MB-231 and 4T1 cells. Ezetimibe can significantly inhibit migration and invasion of triple negative breast cancer. Therefore, the ezetimibe provided by the invention can be used for preparing the medicine for treating the triple negative breast cancer. The invention provides application of ezetimibe to preparation of a medicine for treating triple negative breast cancer, application of ezetimibe to preparation of a medicine for inhibiting migration and invasion of triple negative breast cancer, and application of ezetimibe to preparation of a medicine for treating migration and relapse of triple negative breast cancer.

Description

Technical Field

[0001] The present invention relates to the field of tumor treatment, and specifically refers to the application of using ezetimibe to inhibit the migration and invasion of triple-negative breast cancer cells through TGFβ2 and EMT. Background Art

[0002] Among chronic non-communicable diseases worldwide, cancer ranks second in both incidence and mortality. In 2020, breast cancer has become the most common cancer, and for women, the mortality rate of breast cancer ranks second among malignant tumors. Currently, common treatments for breast cancer include surgical resection, radiotherapy, chemotherapy, and immunotherapy. As an important clinical method for the treatment of breast cancer, chemotherapy not only kills tumor cells, but also damages normal cells, often leading to physical weakness, decreased immune function, adverse gastrointestinal reactions, inflammatory reactions and other drug toxicities, which bring great pain to patients and bring great difficulties to clinical treatment. Therefore, it is very urgent to find a safe and effective drug for the treatment of breast cancer. Tumor metastasis is one of the main reasons for the failure and recurrence of clinical treatment of breast cancer. Studies have shown that cholesterol can promote tumor metastasis. Cholesterol is a key component of mammalian cell membranes, participates in the survival, proliferation, migration and invasion of tumor cells, and is closely related to the occurrence and development of tumors.

[0003] At present, drugs that intervene in cholesterol metabolism through different mechanisms have been used in anti-tumor research. Targeting the synthesis, uptake and storage of cholesterol may become a potential effective way to inhibit tumor progression. Statins are the most common drugs that intervene in cholesterol synthesis. They work by inhibiting hydroxymethylglutaryl coenzyme A reductase (HMGCR), the rate-limiting enzyme of the mevalonate pathway. Studies have shown that statins can reduce low-density lipoprotein cholesterol (LDL-C), destroy cell homeostasis, and affect the activity of cell survival-related proteins, thereby achieving the effect of inhibiting tumor growth. Studies have shown that the recurrence rate and mortality rate of breast cancer patients using lipophilic statins are significantly reduced. These results show that therapeutic drugs targeting cholesterol metabolism can not only reduce cholesterol levels, but also inhibit the metastasis of breast cancer. Ezetimibe is the only selective cholesterol absorption inhibitor currently on the market, which mainly blocks the exogenous absorption pathway of cholesterol. As a new cholesterol-lowering drug, ezetimibe has been reported to inhibit cancer. In vivo experiments have shown that ezetimibe can inhibit tumor growth by reducing angiogenesis in prostate cancer-bearing mice fed a high-cholesterol diet. Kristine Pelton and other scholars found that ezetimibe can improve the tumor microenvironment by stabilizing tumor vascular structure and inhibiting angiogenesis in SCID mice with breast cancer, thereby inhibiting tumor development. These studies have demonstrated that ezetimibe inhibits tumor growth by reducing angiogenesis in different tumor models, but the effect of ezetimibe on tumor metastasis has not been studied.

[0004] Therefore, in this study, we wanted to observe whether zetimibe could inhibit the migration and invasion of breast cancer cells. Summary of the invention

[0005] The present invention confirms the effect of ezetimibe on breast cancer cell migration, invasion and EMT through wound healing experiments, invasion experiments and Western blotting experiments. After ezetimibe treated breast cancer cells, differentially expressed genes were analyzed by transcriptome sequencing, and verified by Western blot detection and qRT-PCR. Then, breast cancer cells overexpressing TGFβ2 were constructed, and the effect of TGFβ2 on the migration and invasion of breast cancer cells treated with ezetimibe was confirmed by wound healing and invasion experiments.

[0006] Therefore, the main contents of the present invention are summarized as follows: Ezetimibe inhibits the migration, invasion and EMT of breast cancer cells, and significantly inhibits the expression of TGFβ2 in breast cancer cells. The enhancement of TGFβ2 expression reverses the inhibitory effect of Ezetimibe on the migration and invasion of breast cancer cells, and Ezetimibe is a potential drug for the treatment of breast cancer metastasis.

[0007] The details of the present invention are as follows:

[0008] 1. We demonstrated for the first time that ezetimibe can inhibit the migration and invasion of breast cancer MDA-MB-231 and 4T1 cells;

[0009] 2. We demonstrated for the first time that ezetimibe can inhibit EMT in MDA-MB-231 and 4T1 cells;

[0010] 3. We demonstrated for the first time that ezetimibe inhibited TGFβ expression in MDA-MB-231 and 4T1 cells;

[0011] 4. We demonstrated for the first time that TGFβ reversed the inhibitory effects of ezetimibe on the migration and invasion of MDA-MB-231 and 4T1 cells BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Attached Figure 1Effects of ezetimibe on the survival rate and migration ability of triple-negative breast cancer cells MDA-MB-231 and 4T1: (A) The CCK-8 method was used to detect the survival rate of MDA-MB-231 and 4T1 cells treated with different concentrations of ezetimibe (0, 1, 5, 10, 15, 20, 40, 60, 80, 100 (μmol / L)) for 48 hours. (B) The scratch healing assay was used to detect the cell healing rate of MDA-MB-231 and 4T1 cells after being treated with different concentrations of ezetimibe (0, 10, 20 (μmol / L)) for 24 hours. Cell images at 0h and 24h were taken at a magnification of ×40 in three random areas of each experimental setting under a light microscope. The results shown in the figure are representative experimental results from three independent experiments, and the results are expressed as mean ± standard deviation (Mean ± SD): *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0013] Attached Figure 2 Effect of ezetimibe on the invasion ability of triple-negative breast cancer cells MDA-MB-231 and 4T1: Transwell invasion assay was used to detect the number of cells in the lower chamber of MDA-MB-231 and 4T1 cells treated with different concentrations of ezetimibe (0, 10, 20 (μmol / L)) for 24 hours. Cell images at 0h and 24h were taken at a magnification of ×100 for three random areas of each experimental setting under a light microscope. The results shown in the figure are representative experimental results from three independent experiments, and the results are expressed as mean ± standard deviation (Mean ± SD): *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0014] Attached Figure 3 Effects of ezetimibe on the morphology and EMT-related markers of MDA-MB-231 and 4T1 cells: (A) MDA-MB-231 and 4T1 cells were treated with 20 μmol / L ezetimibe for 24 hours, and then the cell morphology was observed under a microscope and photographed, with a magnification of × 100. (B) MDA-MB-231 and 4T1 cells were treated with different concentrations of ezetimibe (0, 10, 20 μmol / L) for 24 hours, and then the expression of E-cadherin, N-cadherin, vimentin and snail proteins was detected by Western blot, and the gray value of each protein band in the cells was analyzed. The results in the figure are representative of three independent experiments, and the results are expressed as mean ± standard deviation (Mean ± SD): *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0015] Attached Figure 4Effects of ezetimibe on the transcriptome of MDA-MB-231 cells and the mRNA and protein levels of TGFβ2 in MDA-MB-231 and 4T1 cells: (A) Transcriptome sequencing was performed in MDA-MB-231 cells treated with 20 μM ezetimibe for 48 h, and the differentially expressed genes between ezetimibe-treated and control cells were plotted as a volcano plot. (B) Differentially expressed genes between MDA-MB-231 cells treated with exemestane and control cells were selected based on their fold change values, using |log2-fold change| ≥ 1, up-regulation fold change > 2, and down-regulation fold change < 0.52 as filtering criteria. (C)(D) Enriched pathways were extracted and merged according to Gene Ontology, and distribution maps were plotted based on the enrichment Q value of each pathway. (C) Pathway enrichment analysis of upregulated genes in (B) is shown. (D) Pathway enrichment analysis of downregulated genes in (B) is shown. (E) After treatment with exemestane (0, 10, 20 μmol / L) for 24 h, qRT-PCR was performed to measure TGFβ2 mRNA in MDA-MB-231 and 4T1 cells. (F) MDA-MB-231 and 4T1 cells were treated with different concentrations of ezetimibe (0, 10, 20 μmol / L) for 24 h, and then the expression of TGFβ2 was determined by Western blot, and the gray value of each band was analyzed according to the experimental results. The results in the figure are representative of three independent experiments, and the results are expressed as mean ± standard deviation (Mean ± SD): *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0016] Attached Figure 5Effect of TGFβ2 overexpression on the ability of ezetimibe to inhibit the migration and invasion of MDA-MB-231 and 4T1 cells: (A) qRT-PCR and Western blot were used to detect the expression of TGFβ2 in TGFβ2-overexpressing MDA-MB-231 and 4T1 cells and control cells. (B) TGFβ2-overexpressing MDA-MB-231 and 4T1 cells and control cells were treated with different concentrations of ezetimibe (0, 10, 20 μmol / L) for 24 hours, and then the cell healing rate was detected by scratch healing assay. The cell images at 0 hours and 24 hours were taken under a light microscope at a magnification of ×40 for three random areas of each experimental setting. (C) TGFβ2-overexpressing MDA-MB-231 and 4T1 cells and control cells were treated with different concentrations of ezetimibe (0, 10, 20 μmol / L) for 24 hours, and then the number of cells that passed through the gel-coated chamber was detected by Transwell assay. Cell images at 0 h and 24 h were taken from three random areas of each experimental setting under a light microscope at a magnification of × 100. The results in the figure are representatives of three independent experiments, and the results are expressed as mean ± standard deviation (Mean ± SD): *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. DETAILED DESCRIPTION

[0017] All experimental materials and methods mentioned in the Examples section

[0018] 1. Cell Culture

[0019] MDA-MB-231 cells were cultured in DMEM (WISENT, catalog #319-005-CL) with 10% fetal bovine serum (FBS) (WISENT, catalog #086150035) and penicillin (WISENT, catalog #450-201-EL):streptomycin solution (Gibco, catalog #15140163). 4T1 cells were cultured in RPMI 1640 (WISENT, catalog #350-000-CL) with 10% FBS and penicillin:streptomycin solution. All cells were cultured in a 37°C, 5% carbon dioxide incubator.

[0020] 2. Preparation of Ezetimibe

[0021] Ezetimibe (MedChemExpress, catalog number HY-17376) was added to a sterile tube and dissolved in DMSO for long-term storage at 4°C.

[0022] 3. Cytotoxicity Assay

[0023] The cells were first treated with different concentrations of ezetimibe for 48 hours, and then 10 μL of CCK8 solution was added and the cells were cultured for 1 hour at 37°C. The absorbance of each well was measured at OD450 nm using a microplate reader.

[0024] 4. Wound Healing Assay

[0025] The wound healing assay was performed in 24-well culture plates with culture inserts (Ibidi, catalog #80206). After pulling out the culture plates, the cells were washed twice with PBS and cultured at 37°C with serum-free medium containing different concentrations of ezetimibe. The cells were photographed at four random fields using a microscope every 24 hours.

[0026] 5. Transwell experiment

[0027] The Transwell experiment was performed in a 24-well culture plate with a Transwell chamber (Millipore, catalog number PIHP01250) pre-coated with Matrigel (Corning, catalog number 354230) on the top of the chamber. A total of 8×104 cells were suspended in the upper cell chamber containing 300 μL of serum-free medium, and 1 mL of medium containing 10% FBS was added to the lower cell chamber, and then the cells were treated with different concentrations of ezetimibe. After the cells invaded for 24 hours at 37°C, the Transwell membrane was fixed with 4% paraformaldehyde and stained with 0.1% crystal violet for 1 hour at room temperature. The field of view was randomly selected under a microscope and photographed to calculate the cells that invaded the membrane.

[0028] 6. Lentiviral overexpression

[0029] Cells were seeded overnight in 12-well plates at a density of 5×104 cells per well until the cell confluence reached 30%. According to the multiplicity of infection (MOI) of the cells, a purified high-titer lentiviral suspension (GENEChem) was prepared with an appropriate virus dilution, and the cells were subsequently infected with the virus dilution for 24 hours (MOI = 10 for the two cell lines used). After replacing the culture medium, cell lines that stably overexpressed TGFβ2 were selected by adding 2 μM puromycin. The protein expression level of TGFβ2 was detected by Western blot.

[0030] 7. Quantitative RT-PCR

[0031] Cells were seeded overnight in 12-well plates at a density of 2 × 105 cells per well and cultured for 48 hours. Total RNA was extracted using TRIzol reagent (Life Technologies, 15596-018) and reverse transcribed using Transcriptase cDNA Synthesis Kit (Vazyme, R323) according to the manufacturer's instructions. Real-time PCR analysis was performed in an Applied Biosystems 7500 Real-Time PCR system using ChamQ SYBR qPCR Master Mix (Vazyme, Q341) according to the manufacturer's instructions. Primers (F, TGTCCCTGCTGCACTTTTGTA, and R, GGTGCCATCAATACCTGCAAATC) were synthesized by GenScript and used to detect TGFB2 mRNA expression.

[0032] 8. Western blot analysis

[0033] Cells were lysed with NP40 buffer on ice and proteins were extracted. The concentration of total protein was measured by the BCA method. Equal amounts of harvested total protein were loaded onto sodium dodecyl sulfate-polyacrylamide gel electrophoresis and electrotransferred to polyvinylidene difluoride membranes. Then, the membranes were blocked for 2 h at room temperature, incubated with primary antibodies overnight at 4 °C, and then incubated with HRP-conjugated secondary antibodies for 2 h at room temperature. After washing three times in TBST, protein bands were observed using the ECL chemiluminescence system (Bio-Rad). The primary antibodies were against N-Cadherin (CST, 13116, 1:1000), E-Cadherin (CST, 3195, 1:1000), Vimentin (CST, 5741, 1:1000), Snail (CST, 3879, 1:1000), GAPDH (Biogot technology, MB001, 1:1000), TGFβ2 (Abcam, ab167655, 1:1000).

[0034] 9. Statistical Analysis

[0035] Statistical analysis was performed by GraphPad Prism 8.0. The differences between the two groups were compared using an independent t-test, and statistically significant differences were defined as P < 0.05.

[0036] Example 1 Effects of Ezetimibe on Migration and Invasion of MDA-MB-231 and 4T1 Cells

[0037] In order to evaluate the effect of ezetimibe on the metastasis of triple-negative breast cancer, we used CCK8 assay to detect the effect of ezetimibe on the survival rate of triple-negative breast cancer cells MDA-MB-231 and 4T1. The survival curves of MDA-MB-231 and 4T1 cells after being treated with different concentrations of ezetimibe for 48 hours are shown in the figure. Figure 1 As shown in A. After calculation, the IC50 of ezetimibe for MDA-MB-231 and 4T1 treated for 48 hours was 45.71μM and 34.67μM, respectively. When the concentration of ezetimibe was 10μM, the cell viability of MDA-MB-231 and 4T1 after 48 hours of treatment was 88.17% and 85.99%, respectively. When the concentration of ezetimibe was 20μM, the cell viability of MDA-MB-231 and 4T1 after 48 hours of treatment was 81.83% and 76.83%, respectively. It can be seen that 10μM and 20μM ezetimibe had little effect on the survival rate of triple-negative breast cancer cells MDA-MB-231 and 4T1. These two concentrations were selected to study the effect of ezetimibe on the migration and invasion of triple-negative breast cancer cells MDA-MB-231 and 4T1. The scratch test was then used to evaluate the effect of ezetimibe on the migration ability of MDA-MB-231 and 4T1 cells. We found that the healing rates of MDA-MB-231 and 4T1 cells treated with 10 μM and 20 μM ezetimibe for 24 hours were significantly lower than those of the control group cells not treated with ezetimibe, and the cell healing area showed a dose-dependent inhibition ( Figure 1 B). The results showed that ezetimibe could inhibit the migration of triple-negative breast cancer cells. After observing that ezetimibe could inhibit the migration of triple-negative breast cancer cells, we further explored the effect of ezetimibe on the invasion ability of triple-negative breast cancer cells. We used Transwell invasion assay to evaluate the effect of ezetimibe on the invasion ability of MDA-MB-231 and 4T1 cells. Figure 2 As shown in the figure, the number of cells that passed through the gel chamber of MDA-MB-231 and 4T1 cells after 24 hours of treatment with ezetimibe was significantly less than that of the untreated control group, and it was dose-dependent. The results showed that the invasion ability of triple-negative breast cancer cells treated with ezetimibe was significantly reduced compared with the untreated control cells, and ezetimibe had the effect of inhibiting the invasion ability of triple-negative breast cancer cells.

[0038] Example 2 Effect of Ezetimibe on EMT of MDA-MB-231 and 4T1 cells

[0039] We found that ezetimibe can inhibit the migration and invasion of MDA-MB-231 and 4T1 cells, and epithelial-mesenchymal transition (EMT) plays an important role in the invasion and subsequent metastasis of tumor cells. Therefore, we studied whether ezetimibe would affect the EMT of MDA-MB-231 and 4T1 cells. We first observed the cell morphology of MDA-MB-231 and 4T1 cells treated with ezetimibe by microscopy after 24 hours. Figure 3 As shown in A. Compared with the spindle-shaped cells treated with DMSO, the cells treated with ezetimibe were cobblestone-shaped with a phenotype of low invasiveness and migration ability, indicating that ezetimibe slowed down the morphological transition of triple-negative breast cancer cells to EMT. We detected the expression of EMT-related markers in MDA-MB-231 and 4T1 cells by Western blot. Figure 3 As shown in B, compared with untreated cells, the levels of mesenchymal markers N-cadherin, vimentin, and snail proteins in the ezetimibe-treated group were significantly downregulated, while the expression of epithelial marker E-cadherin was significantly increased in the ezetimibe-treated group. These results indicate that MDA-MB-231 and 4T1 cells treated with ezetimibe show lower EMT levels, and ezetimibe can significantly inhibit the EMT of triple-negative breast cancer cells, thereby affecting the migration and invasion ability of triple-negative breast cancer cells.

[0040] Example 3 Effect of Ezetimibe on TGFβ2 Expression in MDA-MB-231 and 4T1 Cells

[0041] We have demonstrated that ezetimibe can inhibit the migration and invasion ability and EMT of triple-negative breast cancer cells. To clarify the mechanism of action of ezetimibe, we used transcriptome sequencing to compare the differential gene expression profiles between ezetimibe-treated and untreated MDA-MB-231 cells. The gene expression profiles of transcriptome sequencing are shown in Table S1 and Figure S1. We screened out 146 differentially expressed genes based on the fold change value and P value less than 0.05. Among them, the fold difference of 44 genes exceeded 2 times, and the fold difference of 102 genes was less than 0.5. The differential gene cluster analysis diagram and volcano diagram of transcriptome sequencing are shown in Figure 4 A, 4B and Table S2. Based on the fold change values ​​of up-regulated genes greater than 2 and down-regulated genes less than 0.52, we identified 6 up-regulated genes and 14 down-regulated genes in ezetimibe-treated cells with FPKM greater than 1 and P value less than 0.05. We then further performed pathway enrichment analysis on these differentially expressed genes.

[0042] Gene Ontology analysis results are shown in Figure 4 C and 4D, according to the pathway enrichment q value, the upregulated genes are mainly related to the toxin metabolism process ( Figure 4 C), which may be a normal metabolic process of cells after treatment with the cholesterol-lowering drug ezetimibe. This study focused on tumor migration and invasion; therefore, the downregulated genes were explored. According to the pathway enrichment q value, the downregulated genes were related to cell morphology pathways, which were related to breast cancer cell migration, invasion, and EMT in our previous studies. We then screened out two downregulated genes related to cell morphology: il7r (interleukin 7 receptor) and TGFβ2 (transforming growth factor β2) ( Figure 4 D). Since il7r is related to inflammation and immunity, by consulting the literature to analyze the correlation between each downregulated gene and tumor migration and invasion, and considering the fold change ranking of the genes, we found that TGFβ2 among the downregulated genes was closely related to tumor metastasis. As a member of the TGFβ family, TGFβ2 plays a key role in the EMT of cells. Many studies have shown that increased expression of TGFβ2 promotes the metastasis of breast cancer. It is worth noting that recent studies have pointed out that a high-cholesterol diet significantly induced TGFβ2 expression in mouse liver. These results guided us to further explore the relationship between ezetimibe and TGFβ2 in breast cancer cells. We verified the effect of ezetimibe on TGFβ2 mRNA by qRT-PCR, and the results showed that compared with untreated cells, TGFβ2 mRNA in MDA-MB-231 and 4T1 cells treated with ezetimibe was significantly decreased ( Figure 4 C). We next tested the effect of ezetimibe on TGFβ2 protein expression by Western blot analysis. Compared with untreated cells, the expression level of TGFβ2 in MDA-MB-231 and 4T1 cells treated with ezetimibe was significantly decreased ( Figure 4 D). These results indicate that the mRNA and protein expression levels of TGFβ2 were significantly decreased in MDA-MB-231 and 4T1 cells treated with ezetimibe.

[0043] Example 4 Effect of overexpression of TGFβ2 on the inhibitory effect of ezetimibe on the migration and invasion of MDA-MB-231 and 4T1 cells

[0044] The sequencing results and verification experiments suggested that TGFβ2 may play a key role in the inhibition of migration and invasion of triple-negative breast cancer cells by ezetimibe. Given that previous studies have shown that increased TGFβ2 expression promotes the metastasis of breast cancer, we speculate that ezetimibe inhibits the migration and invasion of triple-negative breast cancer cells through TGFβ2-mediated.

[0045] First, we used lentiviral transfection technology to achieve overexpression of TGFβ2 in MDA-MB-231 and 4T1 cells and verified it by real-time PCR and Western blot experiments. Figure 5As shown in A, TGFβ2-overexpressing MDA-MB-231 and 4T1 cells were successfully constructed. We then treated TGFβ2-overexpressing MDA-MB-231 and 4T1 cells and control cells with ezetimibe. The migration ability of cells was evaluated by scratch assay, and the healing rate of cells overexpressing TGFβ2 was significantly higher than that of control cells ( Figure 5 B), indicating that overexpression of TGFβ2 in triple-negative breast cancer cells can resist the inhibitory effect of ezetimibe on cell migration.

[0046] Similarly, we treated TGFβ2-overexpressing MDA-MB-231 and 4T1 cells and control cells with ezetimibe, and then evaluated the invasive ability of the cells by Transwell invasion assay. We found that the number of TGFβ2-overexpressing MDA-MB-231 and 4T1 cells that passed through the gel-coated chamber was significantly higher than that of the control cells ( Figure 5 C), indicating that TGFβ2 overexpression significantly weakened the inhibitory effect of ezetimibe on triple-negative breast cancer cells. In summary, we demonstrated that TGFβ2 overexpression can reverse the inhibitory effect of ezetimibe on the migration and invasion of triple-negative breast cancer cells. Therefore, the ability of ezetimibe to inhibit the migration and invasion of triple-negative breast cancer occurs through TGFβ2.

[0047] Summary of the invention

[0048] The present invention proves that ezetimibe inhibits the migration, invasion and EMT of breast cancer cells, and finds the key role of TGFβ2 in this inhibition process, providing evidence that ezetimibe inhibits the expression of TGFβ2 to treat the migration and invasion of breast cancer cells. We have revealed for the first time the effect of ezetimibe on tumor migration and invasion, and the potential mechanism is the inhibition of TGFβ2 and EMT of breast cancer cells by ezetimibe.

[0049] The present invention adds new evidence for regulating the cholesterol metabolism of tumor cells to inhibit the migration and invasion of tumor cells. The present invention also provides new evidence for the use of drugs that regulate cholesterol metabolism to control the metastasis and recurrence of tumors. The present invention also provides a preliminary basis and foundation for the clinical transformation of ezetimibe for the treatment of breast cancer metastasis and recurrence.

Claims

1. The application of ezetimibe in the preparation of drugs for the treatment of triple-negative breast cancer.

2. Application of ezetimibe in the preparation of preparations for inhibiting EMT of triple-negative breast cancer cells.

3. Application of ezetimibe in the preparation of TGFβ preparations for inhibiting triple-negative breast cancer.

4. Application of ezetimibe in the preparation of preparations for inhibiting the migration and invasion of triple-negative breast cancer.

5. Application of ezetimibe in the preparation of drugs for the treatment of metastasis and recurrence of triple-negative breast cancer.

Images