An antibody targeting PD-L1 and its application

Abstract

The application discloses an antibody targeting PD-L1 and application. The antibody targeting PD-L1 has the advantage of high affinity. The antibody targeting PD-L1 and / or a nucleic acid molecule encoding the antibody are applied to the preparation of an anti-tumor drug. The application connects the antibody targeting PD-L1 and the antibody targeting bFGF, and the obtained double-targeting PD-L1 and bFGF double-specific double-chain antibody has the ability of specifically combining PD-L1 and bFGF, can target PD-L1 to block the combination of PD-L1 / PD-1, and has a double inhibition effect on liver cancer cells. Therefore, the double-targeting PD-L1 and bFGF double-specific double-chain antibody can be applied to the preparation of an anti-tumor drug.

Description

Technical Field

[0001] This invention belongs to the field of antibodies, and specifically relates to an antibody targeting PD-L1 and its application. Background Technology

[0002] Programmed cell death ligand 1 (PD-L1) is a transmembrane protein highly expressed on tumor cells. It binds to programmed cell death receptor 1 (PD-1) on T cells, thereby inhibiting T cell activation and negatively regulating adaptive immune responses. This interaction ultimately allows tumors to evade the surveillance of the immune system and adversely affects patient prognosis. Therefore, anti-PD-L1 antibodies are also considered anti-tumor drugs.

[0003] Despite the considerable success of anti-PD-L1 antibodies in clinical trials, their response rate to solid tumors is only 20-30%, resulting in a relatively low overall response rate. This may be partly due to their poor localization and penetration in solid tumors. Because monoclonal antibodies are large molecules, their distribution within tumor blood vessels can be poor, and limited penetration leads to uneven distribution, thus affecting treatment efficacy. Small molecule antibody formulations may be more suitable for treating tumors with these limitations. Fab antibodies, single-chain antibodies (scFv), and double-chain antibodies (diabody) are all small molecule antibodies, simpler to prepare than other genetically engineered antibodies, and exhibit weaker immunogenicity. Due to their small molecular weight (25-50kD), they can more easily cross blood vessel walls and enter tissues to exert their therapeutic effect compared to monoclonal antibodies (150kD), making them more suitable for tumor treatment. Diabody, with its disulfide bond stability...

[0004] (Disulfide-stabilized Diabody, ds-Diabody) is an antibody with enhanced stability formed by shortening the linker peptide and covalently binding the light and heavy chain variable regions between single chains to form a Diabody on the basis of single-chain antibodies. Then, a disulfide bond is introduced between VH44 and VL100 to form a disulfide bond. It has greater potential as an anti-tumor drug.

[0005] bFGF (basic fibroblast growth factor) is a 155-amino acid polypeptide originally isolated from the brain and pituitary gland, serving as a growth factor for fibroblasts. In the tumor microenvironment, bFGF acts similarly to vascular endothelial growth factor (VEGF) and the two work synergistically, promoting not only tumor cell proliferation and angiogenesis but also tumor cell migration and metastasis.

[0006] In recent years, significant progress has been made in the field of tumor immunotherapy, improving patient survival rates. However, due to the complexity of tumor pathogenesis, immunotherapy targeting a single target often fails to effectively eliminate target cells, leading to poor treatment response or drug resistance in some patients. To address this issue, the development of bispecific antibodies (BsAbs) has been advanced. BsAbs are prepared through cell fusion, recombinant DNA technology, and protein engineering, possessing a unique dual binding capability, enabling them to bind specifically to two different antigens simultaneously or sequentially, or to different epitopes of the same antigen.

[0007] A growing body of research indicates that combining anti-angiogenic therapy with immune checkpoint blockade can significantly enhance the inhibitory effect against various cancers. PD-1 blockade can sensitize tumors to anti-angiogenic therapy and prolong its efficacy in models of metastatic breast cancer, pancreatic neuroendocrine tumors, and melanoma. Anti-angiogenic therapy can improve the treatment of immune checkpoint inhibitors because the formation of hyperendothelial venules within tumors promotes the therapeutic effects of immune checkpoint inhibitors, enabling them to exert effects such as cytotoxic T cell (CTL) infiltration, activation, and tumor clearance. Therefore, there is a bidirectional link and synergistic effect between anti-angiogenic drugs and immunotherapy. Developing new therapeutic drugs that can simultaneously inhibit angiogenesis and block immune checkpoints is a more rational and effective approach to cancer treatment. Summary of the Invention

[0008] The primary objective of this invention is to overcome the shortcomings and deficiencies of the prior art and provide an antibody that targets PD-L1.

[0009] Another object of the present invention is to provide the application of the above-mentioned antibody targeting PD-L1.

[0010] Another object of the present invention is to provide a bispecific double-chain antibody targeting PD-L1 and bFGF, which contains the above-mentioned antibody targeting PD-L1.

[0011] Another object of the present invention is to provide a method for preparing and applying the above-mentioned bispecific double-chain antibody against PD-L1 and bFGF.

[0012] The objective of this invention is achieved through the following technical solution:

[0013] An antibody targeting PD-L1, comprising a light chain and a heavy chain; wherein,

[0014] The amino acid sequences of the three CDRs on the light chain are as follows: CDR1 is SLRSYY, CDR2 is GKN, and CDR3 is NSRDAVLDWV;

[0015] The amino acid sequences of the three CDRs on the heavy chain are as follows: CDR1 is GGSISSYY, CDR2 is IKQDESTK, and CDR3 is ARVWWPGRAALSDY.

[0016] The preferred amino acid sequence of the heavy chain is shown in SEQ ID NO.1.

[0017] The sequence of the nucleic acid encoding the heavy chain is preferably as shown in SEQ ID NO.2.

[0018] The preferred amino acid sequence of the light chain is shown in SEQ ID NO.3.

[0019] The sequence of the nucleic acid encoding the light chain is preferably as shown in SEQ ID NO.4.

[0020] The aforementioned antibody targeting PD-L1 is a disulfide-bonded stable human double-chain antibody against PD-L1, and its preferred amino acid sequence is shown in SEQ ID NO.5.

[0021] A nucleic acid molecule encoding the aforementioned antibody targeting PD-L1; its preferred nucleic acid sequence is shown in SEQ ID NO.6.

[0022] The application of the aforementioned PD-L1-targeting antibodies in the preparation of anti-tumor drugs.

[0023] The tumors mentioned are preferably liver cancer, lung cancer, breast cancer, melanoma, lymphoma, etc.

[0024] A bispecific double-chain antibody targeting PD-L1 and bFGF comprises an antibody targeting PD-L1 and an antibody targeting bFGF linked together by a linker peptide; it contains 6 CDRs of the antibody targeting PD-L1 and 6 CDRs of the antibody targeting bFGF; wherein,

[0025] The amino acid sequences of the six CDRs of the antibody targeting PD-L1 are as follows: CDR1 of the light chain is SLRSYY, CDR2 of the light chain is GKN, CDR3 of the light chain is NSRDAVLDWV, CDR1 of the heavy chain is GGSISSYY, CDR2 of the heavy chain is IKQDESTK, and CDR3 of the heavy chain is ARVWWPGRAALSDY.

[0026] The amino acid sequences of the six CDRs of the antibody targeting bFGF are shown below: CDR1 of the light chain is SSDVGGYNY, CDR2 of the light chain is DVS, and CDR3 of the light chain is SSYTSSSTVV; CDR1 of the heavy chain is GFTFSSYE, CDR2 of the heavy chain is ISSSGSTI, and CDR3 of the heavy chain is ARELTGDWGAFDIW.

[0027] The preferred amino acid sequence of the bispecific double-chain antibody targeting PD-L1 and bFGF is shown in SEQ ID NO.8.

[0028] A product, selected from any of the following:

[0029] 1) A nucleic acid molecule encoding the above-mentioned bispecific double-stranded antibody targeting PD-L1 and bFGF; its nucleotide sequence is preferably shown in SEQ ID NO.9;

[0030] 2) A recombinant expression vector containing the nucleic acid molecule described in 1);

[0031] 3) A recombinant expression cell containing the nucleic acid molecule described in 1) or the recombinant expression vector described in 2).

[0032] The recombinant expression vector's vector framework includes prokaryotic expression plasmids and eukaryotic expression plasmids; preferably eukaryotic expression plasmids; more preferably yeast expression plasmids; most preferably pPICZα series plasmids; and further preferably pPICZαA plasmids.

[0033] The method for preparing the recombinant expression vector includes the following steps: cloning the above-mentioned nucleic acid molecule into a vector framework to obtain the recombinant expression vector.

[0034] The starting cells for the recombinant expression cells include prokaryotic expression cells and eukaryotic expression cells; preferably eukaryotic expression cells; more preferably yeast expression cells; most preferably Pichia pastoris expression cells; and further preferably GS115.

[0035] The recombinant expression cells described above are preferably prepared by the following steps: the above nucleic acid molecules or the above recombinant expression vector are transferred into the starting cells to obtain recombinant expression cells.

[0036] The above-mentioned method for preparing bispecific double-chain antibodies targeting PD-L1 and bFGF can be prepared by chemical synthesis or by genetic engineering; preferably by genetic engineering; more preferably, it includes the following steps: culturing recombinant expression cells, inducing expression, purifying, and obtaining bispecific double-chain antibodies targeting PD-L1 and bFGF.

[0037] The above-mentioned bispecific double-chain antibodies targeting PD-L1 and bFGF are used in the preparation of antitumor drugs.

[0038] The tumors mentioned are preferably liver cancer, lung cancer, breast cancer, melanoma, lymphoma, etc.

[0039] The present invention has the following advantages and effects compared with the prior art:

[0040] (1) The present invention screened an antibody with high affinity targeting PD-L1.

[0041] (2) In this invention, an antibody targeting PD-L1 and an antibody targeting bFGF are linked together to obtain a bispecific double-chain antibody that targets both PD-L1 and bFGF. This antibody has the ability to specifically bind to PD-L1 and bFGF in vitro, and can target PD-L1 to block PD-L1 / PD-1 binding, thus having a dual inhibitory effect on liver cancer cells.

[0042] (3) This invention successfully and efficiently expressed a bispecific diabody antibody targeting both PD-L1 and bFGF using a Pichia pastoris eukaryotic expression system through codon optimization and expression condition screening. Moreover, using this recombinant vector, 17.6 mg of antibody could be obtained per 1 L of fermentation broth in shake-flask culture. Attached Figure Description

[0043] Figure 1 This is a graph showing the Phage-ELISA results after screening a phage antibody mutation library using PD-L1 as the antigen.

[0044] Figure 2 This is a graph showing the results of relative affinity determination of phage antibody mutants using the NH4SCN elution method.

[0045] Figure 3 This is a gel electrophoresis result of the constructed dual-target antibody gene fragments; in the image, lane M represents the nucleic acid molecular weight standard; lanes 1 and 2 represent the anti-PD-L1 light chain variable region + Linker gene fragment obtained by PCR amplification; lanes 3 and 4 represent the anti-PD-L1 heavy chain variable region + Linker gene fragment obtained by PCR amplification; lanes 5 and 6 represent the anti-bFGF light chain variable region + Linker gene fragment obtained by PCR amplification; and lanes 7 and 8 represent the anti-bFGF heavy chain variable region + Linker gene fragment obtained by PCR amplification.

[0046] Figure 4 This image shows the results of colony PCR identification of Pichia pastoris GS115 transformed with the pPICZαA-bispecific diabody recombinant vector. Lane M represents the nucleic acid molecular weight standard; lane P represents the gene fragment amplified by PCR from the empty GS115-pPICZαA vector; lane '-' represents the gene fragment amplified by PCR from the empty pPICZαA vector; lane '+' represents the gene fragment amplified by PCR from the pPICZαA-bispecific diabody recombinant plasmid vector; and lanes 1-45 represent the gene fragment amplified by PCR from the pPICZαA-bispecific diabody transformants.

[0047] Figure 5This is a Western blot result of yeast expression supernatant of dual-targeting PD-L1 and bFGF bispecific diabody antibody after reducing gel electrophoresis SDS-PAGE; in which lane K1 is the yeast expression supernatant of pPICZαA empty vector; lanes 1-40 are the yeast expression supernatant of pPICZαA-bispecific diabody antibody of different transformants.

[0048] Figure 6 This is the SDS-PAGE gel electrophoresis result of the expressed dual-targeting antibody after purification by Ni Sepharose™ 6×Fast Flow; lane M is the protein molecular weight standard; lanes 1-9 are: sample, 25, 50, 75, 100, 150, 300, 500 mM imidazole elution component, and NaOH elution component, respectively.

[0049] Figure 7 This is a graph showing the activity of the dual-targeting PD-L1 and bFGF bispecific Diabody antibody bound to the antigen PD-L1 by indirect ELISA detection.

[0050] Figure 8 This is a graph showing the activity of a dual-targeting PD-L1 and bFGF bispecific Diabody antibody bound to antigen bFGF using indirect ELISA.

[0051] Figure 9 This image shows the immunofluorescence assay of the binding of anti-PD-L1 diabody and bispecific diabody antibodies to HepG2 human liver cancer cells. DiI (Difluorescein I) stains the cell membrane of liver cancer cells with red fluorescence; FITC (Fluorescent Secondary Antibody) binds to anti-PD-L1 ds-Diabody or bispecific diabody protein, showing green fluorescence; Merge (Fluorescent Secondary Antibody) combined with FITC imaging shows the localization of the two prepared antibody proteins (fluorescent secondary antibody green) on the cell membrane (red) of liver cancer cells.

[0052] Figure 10 This is a graph showing the results of detecting the effects of dual-targeting PD-L1 and bFGF bispecific Diabody antibodies in a T-cell and liver cancer cell co-culture system.

[0053] Figure 11 This is a graph showing the results of CCK8 assay detection of the effects of dual-targeting PD-L1 and bFGF bispecific Diabody antibodies on the proliferation of HepG2 and SK-HEP1 liver cancer cells.

[0054] Figure 12This is a graph showing the results of a plate colony formation assay to detect the effect of dual-targeting PD-L1 and bFGF bispecific Diabody antibodies on the colony formation ability of HepG2 and SK-HEP1 liver cancer cells.

[0055] Figure 13 This is a graph showing the results of a Transwell assay to detect the effects of dual-targeting PD-L1 and bFGF bispecific Diabody antibodies on the migration ability of HepG2 and SK-HEP1 liver cancer cells.

[0056] Figure 14 This is a graph showing the results of a Transwell assay to detect the effects of dual-targeting PD-L1 and bFGF bispecific Diabody antibodies on the invasive ability of HepG2 and SK-HEP1 liver cancer cells.

[0057] Figure 15 This is a graph showing the results of Western blotting analysis of the effects of dual-targeting PD-L1 and bFGF bispecific Diabody antibodies on EMT-related signaling pathways in HepG2 and SK-HEP1 liver cancer cells. Detailed Implementation

[0058] The present invention will be further described in detail below with reference to examples and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0059] In addition to well-known culture media, the composition of the culture medium used is as follows:

[0060] 2×YT-G: Prepare 180 mL of 2×YT medium, autoclave for 20 min, then add 20 mL of 20% glucose. 2×YT-ATG: Prepare 180 mL of 2×YT medium, autoclave for 20 min, then add 20 mL of 20% glucose, 20 mg ampicillin, and 2 mg tetracycline. 2×YT-ATK: Prepare 180 mL of 2×YT medium, autoclave for 20 min, then add 20 mg ampicillin, 2 mg tetracycline, and 2 mg kanamycin.

[0061] Example 1

[0062] Screening of phage antibody mutant libraries targeting PD-L1 and screening of anti-PD-L1 Fab antibodies:

[0063] (1) Rescue and titration of phage antibody mutant libraries targeting PD-L1:

[0064] An appropriate amount of Fab antibody mutant library bacterial suspension (preserved by the inventors' team after five rounds of solid-phase screening, and operated according to Example 1 of the invention patent application No. 202211576619.8, entitled "A High-Affinity Anti-PD-L1 Human Antibody and Its Application") was inoculated into 2×YT-ATG liquid medium. After culturing to the logarithmic growth phase, helper phage VCSM13 with an infection multiplicity of 20 was added, and the mixture was incubated at 37°C for 30 min in a water bath and at 37°C with shaking at 100 rpm for 30 min. Then, the bacterial cells were precipitated by centrifugation at 4000g for 20 min, and the bacterial cells were resuspended in an equal volume of 2×YT-ATK liquid medium and cultured overnight with shaking at 30°C. The following day, collect the overnight culture and centrifuge at 10,000g for 20 min at 4°C. Transfer the supernatant to a clean, sterile centrifuge tube and add 1 / 5 volume of PEG8000 / NaCl solution (200g PEG8000 powder and 146.1g NaCl dissolved in 800mL ddH2O, brought to a final volume of 1L, autoclaved for 20 min, and stored at 4°C for later use). Concentrate on ice for 1 hour. Centrifuge the concentrated culture at 10,000g for 20 min at 4°C, discard the supernatant, resuspend the phage pellet in 1mL PBS, filter through a 0.22μm filter, aliquot into sterile centrifuge tubes on ice, and store at 4°C.

[0065] The concentrated phage antibody library was diluted using the serial dilution method and infected with logarithmically growing Escherichia coli XL1-Blue. The recovered phage antibody library was then plated on 2×YT plates containing ampicillin and titrated to determine its capacity.

[0066] (2) Solid-phase screening of phage antibody mutant libraries targeting PD-L1:

[0067] First, PD-L1 (Nearshore Protein Technology Co., Ltd.) was diluted to 5 μg / mL with 0.05 mol / L carbonate buffer (pH 9.6) and coated onto an ELISA plate. The plate was incubated overnight at 4°C. The next day, 200 μL of 5% (w / v) skim milk powder prepared with 0.01 M PBS (pH 7.4) containing 0.05% (v / v) Tween 20 was added, and the plate was blocked at 37°C for 2 hours. The blocking solution was discarded, and 100 μL of phage antibody library (approximately 10 μg / mL) was added. 13 CFU), incubate at 37°C for 2 hours, discard residual phage antibody solution, and wash 5 times with PBST (10 times in the second round, and more than 20 times thereafter). Add 100 μL of Gly-HCl elution buffer (glycine-hydrochloric acid buffer, 0.1 mol / L, pH 2.2) to each well and incubate at room temperature for 10 minutes, gently pipetting during incubation. Immediately add 6 μL of 2M Tris solution, mix gently, and neutralize the eluted phage antibody.

[0068] The collected phage antibody eluent was added to 2 mL of logarithmically growing *E. coli* XL1-Blue and incubated at 37°C for 30 min to allow the phage antibody to fully infect the *E. coli*. 100 μL of the diluted solution was plated onto 2×YT-Amp (ampicillin concentration 100 μg / mL) plates for phage antibody library volume determination. The remainder was plated onto 2×YT-ATG plates. The next day, the culture was collected using 2×YT-G liquid medium. After determining the bacterial concentration, 50% glycerol was added to obtain the screened phage antibody bacterial library.

[0069] (3) Preparation of phage antibodies and detection of anti-PD-L1 specificity:

[0070] Colonies were randomly selected from the screened culture plates and cultured overnight at 37°C in 2×YT-ATG medium. The next day, 20 μL of bacteria were transferred to 400 μL of 2×YT-ATG medium and cultured at 37°C until the logarithmic growth phase. Helper virus VCSM13 was then added. The culture was first incubated at 37°C for 30 min, then incubated at 37°C with shaking at 100 rpm for 30 min. After centrifugation at 4000g for 10 min, the bacterial pellet was resuspended in an equal volume of 2×YT-ATK liquid medium and cultured overnight at 30°C. The supernatant was then collected.

[0071] Perform ELISA detection according to the following procedure: Dilute the antigen (PD-L1) to 10 μg / mL, coat the ELISA plate with 100 μL of the diluted antigen, and incubate overnight at 4°C, then discard the liquid in the wells. Add 200 μL of 5% skim milk powder prepared with PBS (0.01 M, pH 7.4) containing 0.05% Tween 20 for blocking, then add the prepared phage antibody, incubate at 37°C for 2 h, wash 5 times with PBST, add 1:10000 diluted HRP-anti-M13 mouse monoclonal antibody (Sino-Pharmaceutical), wash, add TMB substrate for color development, and read the A450 value. The results are as follows. Figure 1 As shown, some clones have high absorbance values, while others have low absorbance values. Next, 10 clones with high A450 values ​​were selected for sequencing.

[0072] (4) Determination of the relative affinity of positive phage antibodies:

[0073] Clones with repetitive sequences were removed based on the sequencing results, and the remaining 8 clones were subjected to relative affinity determination. The specific steps are as follows:

[0074] The positive phage antibodies after sequencing analysis were prepared in large quantities using the same method as above.

[0075] The antigen (PD-L1) was diluted to 1 μg / mL, and 100 μL of the diluted antigen was used to coat an ELISA plate. After coating overnight at 4°C, the liquid in the wells was discarded. 200 μL of 5% skim milk powder prepared with 0.01 M PBS (pH 7.4) containing 0.05% Tween 20 was added for blocking. Then, the prepared positive phage antibody was added, with 8 replicates per clone. The plates were incubated at 37°C for 2 h and washed 5 times with PBST. Then, 100 μL of different concentrations of NH4SCN (0, 1, 2, 3, 4, 5, 6, 7 mol / L) were added to each well, and the plates were incubated at room temperature for 15 min. After washing 5 times with PBST, 1:10000 diluted HRP-anti-M13 mouse monoclonal antibody (Sino-Pharmaceutical) was added for reaction. After washing, TMB substrate was added for color development, and the A450 value was read. The detection results are as follows: Figure 2 As shown, the relative affinity of the antibody (mut25, relative affinity 3.85) prepared from the screened clone is increased by 6 times compared to the original strain fab48 (i.e. the maternal Fab antibody (NC) in CN202211576619.8, with a relative affinity of 0.64).

[0076] The sequence of mut25 is as follows:

[0077] The gene sequence (SEQ ID NO.2) encoding the heavy chain variable region (VH) of the Fab antibody against PD-L1 is shown below:

[0078] GAGGTGCAGCTGCTCGAGTCTGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCATCAGTAGTTACTACTGGAGCTGGATCCGGCAGCCCCCGGGGAAGGGACTGGAGTGGGTGGCCAACATAAAGCAAGATGAAAGTACGAAAAACTATGT GGACTCTGTGAAGGGCCGATTCACCATCTCCAGAGACAACGCCAAGAACTCACTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGTTTGGTGGCCGGGCCGGGCCGCCCTGAGCGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA.

[0079] The gene sequence (SEQ ID NO.4) encoding the light chain variable region (VL) of the Fab antibody against PD-L1 is shown below:

[0080] CAGGACCCTGTTGTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACATGCCAAGGAGACAGCCTCAGAAGCTATTATGCAAGCTGGTACCAGCAGAAGCCAGGACAGGCCCCTGTACTTGTCATCTATGGTAAAAACAACCGGCCCTCAGGG ATCCCAGACCGATTCTCTGGCTCCAGCTCAGGAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAACTCCCGGGACGCCGTCCTCGACTGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTA.

[0081] Example 2

[0082] The disulfide-stabilized humanized double-chain antibody against PD-L1 in this invention is based on the VL and VH gene fragments encoding the anti-PD-L1 Fab antibody prepared in Example 1. Covalent disulfide bonds are introduced into the antibody VL and VH (by mutating glycine at position 95 of the light chain and position 44 of the heavy chain to cysteine). Simultaneously, a gene fragment encoding a linker peptide (amino acid sequence GGGGS) is used to construct the VL-GGGGS-VH gene fragment (684 bp in length). The two expressed VL-GGGGS-VH molecules (molecular weight 52.14 KD) are covalently linked by disulfide bonds, forming a stable disulfide bond. The double-chain antibody was developed, and the codon usage frequency (CAI value, which is positively correlated with the expression level of the foreign gene in the host, is analyzed according to the gene sequence. It is generally believed that a CAI between 0.8 and 1.0 can improve the expression level of the foreign protein in the host bacterium P. pastoris. The gene sequence was optimized using an online codon optimization website, which improved the codon usage frequency and adjusted the GC content. The CAI value of the sequence was increased from 0.61 to 0.97, and the GC content was adjusted from 58% to 41%.

[0083] The optimized nucleotide sequence of the anti-PD-L1 human double-stranded antibody (SEQ ID NO.6) is shown below:

[0084] .

[0085] The disulfide-bonded stable anti-bFGF human double-chain antibody in this invention is based on the antibody gene sequence previously obtained by the inventors' team. Codon optimization and GC content adjustment were performed, increasing the CAI value of the sequence from 0.63 to 0.96 and adjusting the GC content from 54% to 44%.

[0086] The optimized nucleotide sequence of the anti-bFGF human double-stranded antibody (SEQ ID NO.7) is shown below:

[0087] .

[0088] Using the optimized anti-PD-L1 ds-Diabody and anti-bFGF ds-Diabody sequences as templates, the VL and VH of the two antibodies were amplified by PCR. A linker with three repeat units (GGGGS) was introduced into the 5' end of the anti-bFGF VL and the 3' end of the VH. The sequences were then linked by homologous recombination in the order of PL-Linker, Linker-BH-(G4S), (G4S)-BL-Linker, and Linker-PH.

[0089] The nucleotide sequence (SEQ ID NO.9) of the dual-targeting PD-L1 and bFGF bispecific Diabody antibody gene is shown below:

[0090]

[0091] The method for constructing the dual-targeting PD-L1 and bFGF bispecific Diabody antibody gene in this invention comprises the following steps:

[0092] PCR amplification of four gene fragments: anti-PD-L light chain variable region + Linker (PL-Linker), Linker + anti-bFGF antibody heavy chain variable region (Linker-BH), anti-PD-L heavy chain variable region + Linker (BL-Linker), and anti-PD-L light chain variable region + Linker (Linker-PH).

[0093] Reaction 1): Primer design:

[0094] Primer 1: 5′-AGAGAGGCTGAAGCTGAATTCCAAGATCCAG-3′;

[0095] Primer 2: 5′-AGAACCACCACCACCCAAAACAGTCAACTT-3′.

[0096] The reaction system ① is: 2×Hieff Plus PCR Master Mix 25 μL (Shanghai Yisheng Biotechnology Co., Ltd.), primers 1 and 2 (10 μmol / L) 2 μL each, pPICZαA-anti-PD-L1 ds-Diabody recombinant vector (synthesized by Beijing Qingke Biotechnology Co., Ltd., with the nucleic acid sequence shown in SEQ ID NO.6 inserted at the EcoRI and NotI restriction sites on the pPICZαA vector) 2 μL, sterile deionized water 19 μL; total volume 50 μL.

[0097] The PCR amplification program was as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 65℃ annealing for 20 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min. The reaction product was subjected to 1.5% agarose gel electrophoresis, and the gel was recovered and purified to obtain the recombinant fragment of PL-Linker.

[0098] Reaction 2): Primer design:

[0099] Primer 3: 5′-GGTGGTGGGTGGTTCTGAGGTTCAATTGTTG-3′;

[0100] Primer 4: 5′-TGTTCTAGAAAGCTGGCGGCCGCATTATGGTGATGATGATG-3′.

[0101] Reaction system ② is: 2×Hieff Plus PCR Master Mix 25μL (Shanghai Yisheng Biotechnology Co., Ltd.), primers 3 and 4 (10μmol / L) 2μL each, pPICZαA-anti-PD-L1 ds-Diabody recombinant vector 2μL, sterile deionized water 19μL; total volume 50μL.

[0102] The PCR amplification procedure is as follows:

[0103] Pre-denaturation at 98℃ for 3 min; denaturation at 98℃ for 10 s, annealing at 65℃ for 20 s, extension at 72℃ for 30 s, 30 cycles; extension at 72℃ for 5 min. The reaction product was subjected to 1.5% agarose gel electrophoresis, and the gel was recovered and purified to obtain the recombinant fragment of Linker-PH.

[0104] Reaction 3): Primer design:

[0105] Primer 5: 5′-AGAGAGGCTGAAGCTGAATTCCAATCCGTT-3′;

[0106] Primer 6: 5′-AGAACCACCACCACCCAACACTGTCAATTT-3′.

[0107] Reaction system ③ is:

[0108] 2×Hieff Plus PCR Master Mix 25 μL (Shanghai Yisheng Biotechnology Co., Ltd.), primers 5 and 6 (10 μmol / L) 2 μL each, pPICZαA-anti-bFGF ds-Diabody recombinant vector (synthesized by Beijing Qingke Biotechnology Co., Ltd., with the nucleic acid sequence shown in SEQ ID NO. 7 inserted at the EcoRI and Not I restriction sites on the pPICZαA vector) 2 μL, sterile deionized water 19 μL; total volume 50 μL.

[0109] The PCR amplification procedure is as follows:

[0110] Pre-denaturation at 98℃ for 3 min; denaturation at 98℃ for 10 s, annealing at 65℃ for 20 s, extension at 72℃ for 30 s, 30 cycles; extension at 72℃ for 5 min. The reaction product was subjected to 1.5% agarose gel electrophoresis, and the gel was recovered and purified to obtain the recombinant fragment of (G4S)-BL-Linker.

[0111] Reaction 4): Design primers:

[0112] Primer 7: 5′-GGTGGTGGTGGTTCTCAAGTCCAACTGCAAG-3′;

[0113] Primer 8: 5′-CAGATCCTCTTCTGAGATGAGTTTTTGTTCTGAACTAACGGTAAC-3′.

[0114] Reaction system ④ is: 2×Hieff Plus PCR Master Mix 25 μL (Shanghai Yisheng Biotechnology Co., Ltd.), primers 7 and 8 (10 μmol / L) 2 μL each, pPICZαA-anti-bFGF ds-Diabody recombinant vector 2 μL, sterile deionized water 19 μL; total volume 50 μL.

[0115] The PCR amplification program was as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 65℃ annealing for 20 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min. The reaction product was subjected to 1.5% agarose gel electrophoresis, and the gel was recovered and purified to obtain the recombinant fragment of Linker-BH-(G4S).

[0116] The agarose gel electrophoresis results of the fragments constructed above are as follows: Figure 3 As shown.

[0117] (II) Construction of the recombinant expression vector pPICZαA-bispecific diabody (abbreviated as pPICZαA-Bispecific diabody)

[0118] ① The expression vector pPICZαA was double-digested with EcoRI and NotI restriction endonucleases, respectively.

[0119] Enzyme digestion system (50 μL): 1 μg pPICZαA fragment, 5 μL 10×Buffer H, 5 μL BSA, 2 μL NotⅠ (4–12 U / μL), 2 μL EcoRI (8–20 U / μL), and deionized water to a final volume of 50 μL. Digestion was performed at 37℃ for 8 h. The digestion products were subjected to 1.5% agarose gel electrophoresis, and the gel was recovered and purified to obtain the expression vector pPICZαA containing EcoRI and NotⅠ restriction sites.

[0120] ② The sequences were ligated into the double-digested expression vector pPICZαA by homologous recombination in the order of PL-Linker, Linker-BH-(G4S), (G4S)-BL-Linker, and Linker-PH.

[0121] The reaction system (10 μL) consisted of: 2 μL of 5×CE II Buffer, 1 μL of Exnase II (Beijing Qingke Biotechnology Co., Ltd.), 1 μL of PL-Linker, 1 μL of Linker-BH-(G4S), 1 μL of (G4S)-BL-Linker, 1 μL of Linker-PH, and 3 μL of sterile deionized water, for a total volume of 10 μL.

[0122] The reaction was carried out at 37℃ for 30 min. The recombinant reaction product was transformed into *E. coli* DH5α competent cells and inoculated onto low-salt (NaCl content 3.75 mg / mL) LB agarose culture plates containing 25 μg / mL Zeocin+ overnight. Single colonies were randomly picked for colony PCR amplification to preliminarily identify the construction of the recombinant expression vector. The results are as follows: Figure 4 As shown, the recombinant expression vector pPICZαA-bispecific diabody was successfully constructed.

[0123] (III) Expression and Western Blot Identification of Dual-Targeting Antibodies

[0124] (1) Pichia pastoris GS115 was transformed with the recombinant expression vector pPICZαA-bispecific diabody.

[0125] First, Pichia pastoris GS115, stored at -80℃, was streaked onto YPD plates and incubated upside down at 28℃ for 2-3 days until white, round, single colonies appeared. Then, well-separated single colonies of Pichia pastoris were selected and inoculated into 5 mL of YPD liquid medium for overnight activation at 29℃ and 230 rpm. The next day, 1 mL of the overnight culture was inoculated into 100 mL of YPD liquid medium and incubated at 29℃ and 230 rpm until the logarithmic growth phase of Pichia pastoris, i.e., an OD600 value of 1.0-1.3. The yeast culture was then transferred to a 50 mL centrifuge tube and centrifuged at 4℃ and 4000 rpm for 5 min to collect the cells. The supernatant was discarded, and the remaining liquid was aspirated. The cells were resuspended in 40 mL of pre-cooled sterile water, washed, and centrifuged at 4℃ and 4000 rpm for 5 min. The supernatant was discarded; this step was repeated once. Wash the bacterial cells with 10 mL of pre-chilled sterile water, centrifuge at 4000 rpm for 5 min at 4°C, and discard the supernatant. Resuspend the bacterial cells in 10 mL of pre-chilled 1M sorbitol, centrifuge at 4°C for 4000 rpm for 5 min, and discard the supernatant. Finally, add 200 μL of ice-cold 1M sorbitol to resuspend the bacterial cells, aliquot the mixture onto ice into 80 μL tubes. These are the GS115 competent cells, prepared and used immediately.

[0126] The recombinant expression vector pPICZαA-bispecific diabody with the correct sequence was seeded into low-salt LB medium containing 25 μg / mL Zeocin and cultured at 37°C with shaking at 230 rpm for 16 h. The recombinant plasmid pPICZαA-bispecific diabody was extracted using a plasmid miniprep kit. The recombinant plasmid was linearized by restriction endonuclease SacⅠ. The digestion system was as follows: 40 μL of recombinant expression vector pPICZαA-bispecific diabody, 2 μL of SacⅠ restriction enzyme, 5 μL of 10×H Buffer, and deionized water to a total volume of 50 μL. The digestion was incubated overnight at 37°C. The linearized pPICZαA-bispecific diabody plasmid was subjected to 1.5% agarose gel electrophoresis, and the completely linearized plasmid band was excised and recovered.

[0127] Linearized recombinant plasmids were transformed into competent Pichia pastoris cells via electroporation (electroporation parameters: voltage 1.5 kV, capacitance 25 μF, resistance 400 Ω). Immediately after electroporation, 900 μL of pre-chilled 1 M sorbitol was added to resuspend the cells, and the transformed culture was transferred to a sterile 1.5 mL centrifuge tube and incubated at 28 °C for 2 h. Finally, 300 μL of the culture was plated onto a YPD plate containing 250 μg / mL Zeocin and incubated at 28 °C for 3-4 days until transformants appeared. Fast-growing transformants were spotted onto YPD plates containing 0.5 μg / mL Zeocin using a sterile pipette tip and incubated until new transformants appeared. This process was repeated, successively spotting transformants onto YPD plates containing 700 μg / mL bleomycin and 1 mg / mL Zeocin.

[0128] White transformants with good growth were selected, and colony PCR was performed using primers D-P1:5'-GAATTCCA AGATCCAGTTGT-3' and D-P2:5'-GCGGCCGCATGGTGATGATG-3' to identify positive transformants. The results showed that 41 transformants were able to amplify the target band, indicating that they were all positive transformants.

[0129] (2) Expression, Western-Blot and ELISA identification of dual-targeting antibodies

[0130] Forty-one positive transformants were inoculated into test tubes containing 5 mL of YPD liquid medium and cultured overnight at 29°C and 230 rpm with shaking. The next day, the overnight bacterial culture was inoculated at a 1:100 ratio into test tubes containing 3 mL of BMGY medium and cultured at 29°C and 230 rpm with shaking until the OD600 value was 4-6. Then, 5 mL of BMMY medium was added to the test tubes, and the culture was continued at 29°C and 230 rpm with shaking. Methanol was added to the medium every 24 hours to a final concentration of 1%, and the culture was continued for 96 hours. Finally, the bacterial culture was collected into 15 mL centrifuge tubes and centrifuged at 8000 rpm for 10 min at 4°C, and the supernatant was collected.

[0131] The supernatant from the induced expression was concentrated using TCA. 1 mL of the supernatant was transferred to a 1.5 mL centrifuge tube, and 100 μL of 100% TCA was added. The mixture was thoroughly mixed and incubated at -20°C overnight. The supernatant was discarded after centrifugation at 12000g for 10 min. Then, 1 mL of anhydrous ethanol was added, the mixture was resuspended, and centrifuged at 12000g for 10 min at 4°C. The supernatant was discarded again; this process was repeated once to ensure complete removal of TCA. Finally, the protein precipitate was dried at room temperature for 30 min to allow the ethanol to evaporate completely. It was then reconstituted with 50 μL of ddH2O, mixed with 5× Loading Buffer, boiled in water for 10 min, and stored at -20°C for later use.

[0132] Take 25 μL of the concentrated sample, proceed according to molecular cloning procedures, and perform Western blotting after reducing SDS-PAGE. The results are as follows: Figure 5 As shown, after reducing SDS-PAGE, a protein band was observed at a molecular weight of approximately 60 kDa, indicating that the dual-targeting method was successfully constructed.

[0133] (iv) Exploration of the isolation and purification conditions of dual-targeting antibodies.

[0134] (1) Investigation into the concentration of saturated ammonium sulfate precipitate

[0135] After centrifuging the yeast expression supernatant at 8500 rpm for 10 min at 4 °C, the supernatant was collected and aliquoted into 5 mL EP tubes at 2 mL per tube. Different amounts of pH 8.0 saturated ammonium sulfate solution were added to achieve final concentrations of 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, and 60%. The tubes were incubated at 4 °C for 48 h to allow for precipitation. The protein precipitate was collected by centrifugation at 4 °C. 20 μL of PBS was added to dissolve the precipitate, followed by the addition of 5× loading buffer. The mixture was boiled in water for 10 min before SDS-PAGE analysis.

[0136] (2) Investigation of nickel ion affinity chromatography purification conditions for dual-targeting antibodies

[0137] Add saturated ammonium sulfate solution (pH 8.0) to the supernatant collected by centrifugation to a final concentration of 50%, and incubate at 4°C for 36–48 hours. Collect the protein precipitate by centrifugation at 4°C, and dissolve it in PBS buffer (pH 7.4). Activate and leak-test the dialysis bag by heating, add the protein solution, and dialyze using PBS at 4°C, changing the buffer every 2.5 hours and repeating three times. Collect the supernatant by centrifugation at 4°C after dialysis, and filter using a 0.45 μm filter membrane to prevent clogging of the nickel column. Wash the nickel column with deionized water and PBS buffer with a 25 mM imidazole concentration. Adjust the imidazole concentration in the sample solution to 25 mM using a 500 mM imidazole solution before loading the sample, and collect the protein solution corresponding to the peak value during this process. Next, unbound proteins were washed with PBS containing 25 mM imidazole, contaminating proteins were eluted with PBS containing 50 mM and 75 mM imidazole, the target protein was eluted with PBS containing 100 mM and 150 mM imidazole, and the remaining residual proteins were eluted with PBS containing 300 mM and 500 mM imidazole. Peak values ​​were collected at each stage. The collected peak values ​​were then added to 5× loading buffer and analyzed by SDS-PAGE to determine the column pass rate. Results are as follows: Figure 6 As shown, 25 mM imidazole can elute most of the contaminating proteins, and the target protein in the sample was successfully attached to the column. At 50 mM imidazole, a small amount of the target protein was eluted; 75 mM and 100 mM imidazole eluted most of the target protein. No protein was eluted at 300 mM imidazole, indicating that the target protein was completely eluted at 150 mM imidazole. Subsequent purification conditions can use 25 mM imidazole to elute contaminating proteins and 100 mM imidazole to elute the target protein.

[0138] Example 3

[0139] The following are tests of the biological activities of the dual-targeting PD-L1 and bFGF bispecific Diabody antibodies prepared according to the above method. The test methods and results are as follows:

[0140] (I) Indirect ELISA detection of the binding activity of dual-target PD-L1 and bFGF bispecific Diabody antibody to antigens PD-L1 and bFGF.

[0141] Recombinant human PD-L1 (Nearshore Protein Technology Co., Ltd.) was diluted to 1 μg / mL with 0.05 mol / L carbonate buffer (pH 9.6). 100 μL of the solution was coated onto each well of an ELISA plate. After incubation at 37°C for 3 h, the liquid in the wells was discarded, and the plate was washed three times with PBST (0.015 mol / L PBS containing 0.05% Tween-20, pH 7.4). After blocking with 5% skim milk-PBST, a certain concentration of the dual-targeting antibody and anti-PD-L1 ds-Diabody prepared in Example 2 was added to each well at 100 μL / well. The mixture was incubated at 37°C for 1 h. After washing three times with PBST, 100 μL of anti-His-tag mouse monoclonal antibody (Mingyan Biotechnology) diluted 1:5000 was added to each well. The mixture was incubated at 37°C for 1 h. After washing three times with PBS-T, 100 μL of HRP-labeled goat anti-mouse polyclonal antibody (Beijing Solarbio Science & Technology Co., Ltd.) diluted 1:5000 was added to each well. The mixture was incubated at 37°C for 0.5 h. After washing five times with PBST, TMB was added for color development, and the A450 value was measured. PBS was used as a negative control in the experiment.

[0142] The results are as follows Figure 7 As shown, compared to anti-PD-L1 ds-Diabody, the dual-targeting method can still achieve good specific binding to the PD-L1 antigen and still has good affinity.

[0143] Recombinant human bFGF (Beijing Abogen Biosciences Co., Ltd.) was diluted to 1 μg / mL with 0.05 mol / L carbonate buffer (pH 9.6). 100 μL of the solution was coated onto each well of an ELISA plate. After incubation at 37°C for 3 h, the liquid in the wells was discarded, and the plate was washed three times with PBST (0.015 mol / L PBS containing 0.05% Tween-20, pH 7.4). After blocking with 5% skim milk-PBST, 100 μL / well of the dual-targeting antibody and anti-bFGF ds-Diabody prepared in Example 2 were added. The mixture was incubated at 37°C for 1 h. After washing three times with PBST, 100 μL of anti-His-tag mouse monoclonal antibody (Mingyan Biotechnology) diluted 1:5000 was added to each well. The mixture was incubated at 37°C for 1 h. After washing three times with PBS-T, 100 μL of HRP-labeled goat anti-mouse polyclonal antibody (Beijing Solarbio Science & Technology Co., Ltd.) diluted 1:5000 was added to each well. The mixture was incubated at 37°C for 0.5 h. After washing five times with PBST, TMB was added for color development, and the A450 value was measured. PBS was used as a negative control in the experiment.

[0144] The results are as follows Figure 8 As shown, compared to anti-bFGF ds-Diabody, the dual-targeting method can still achieve good specific binding of the antigen bFGF and still has good affinity.

[0145] (II) Immunofluorescence staining to detect the localization of antibody proteins in HEPG2

[0146] Add 1 mL of DMEM medium containing 10% FBS and double antibodies (0.1 kU / mL penicillin, 0.1 mg / mL streptomycin) to a 20 mm laser confocal culture dish. Add 100 μL of digested and transfected cell suspension to the dish, shake well, and incubate at 37°C and 5% CO2 for 6 h to allow cell adhesion. Wash cells twice with PBS. The blank control group received no antibody, while the experimental groups received 100 μg / mL of anti-PD-L1ds-Diabody and bispecific diabody, respectively, and were incubated for 5 h. Prepare the red staining solution for cell membranes under light-protected conditions. After washing with PBS, add 1 mL of the working solution to each dish and incubate at 37°C and 5% CO2 for 5 min. After washing with PBS, add 1 mL of 4% paraformaldehyde to each dish for fixation and incubate at room temperature for 1 h. After washing with PBS, add 1 mL of anti-HIS mouse monoclonal antibody diluted 1:1000 with antibody diluent to each dish, place on a 4°C shaker, and incubate overnight. After primary antibody recovery, wash the cells thoroughly with PBS, then add 1 mL of Goat Anti-Mouse IgG H&L / AF488 fluorescent secondary antibody diluted 1:1000 with antibody diluent. Incubate at room temperature for two hours to ensure sufficient binding of the fluorescent secondary antibody to the sample. After secondary antibody recovery, wash the sample three times with PBS, each wash lasting 5 min. After washing, add 1 mL of PBS to infiltrate the cells, and place the culture dishes in the dark in preparation for subsequent observation. Observe the fluorescence of liver cancer cells using a laser confocal microscope under light-protected conditions. The cell membrane was observed under excitation light of 549 nm and emission light of 565 nm; the antibody protein was observed under excitation light of 488 nm and emission light of 515 nm.

[0147] The results are as follows Figure 9 As shown in the Merge fluorescence synthesis image, except for the blank control group where no green fluorescence was observed on the surface of liver cancer cells, all experimental groups showed green fluorescence, proving that the prepared antibody protein can bind to the cell membrane surface of liver cancer cells. This experiment demonstrates that both anti-PD-L1 ds-Diabody and bispecific diabody can bind to PD-L1 ligands on the surface of tumor cells and possess biological activity.

[0148] (III) T cell co-culture detection of PD-L1 binding activity of dual-targeting antibody

[0149] Tumor cells were divided into 2×10 5Cells were seeded at a density of 10 cells / well in 6-well plates and cultured. After adherence, cells were transfected with the lipo2000 and PLVX-OE-PD-L1 plasmids (PLVX-OE-PD-L1 is obtained by inserting the 873nt nucleotide sequence from NCBI accession number CCDS6464.1 between Xho I and BamHI in the pLVX-Puro vector). Jurkat cells were activated with phytohemagglutinin (PHA) (1 μg / mL) for 48 hours. Activated Jurkat cells (2 × 10⁶ cells / well) were then seeded at an E / T (effective cells to target cells) ratio of 10:1. 6 Tumor cells (HepG2 and SK-Hep-1 liver cancer cells, respectively) were added to each well, and anti-PD-L1 ds-Diabody and bispecific diabody were added to a final concentration of 200 μg / mL, respectively. The cells were co-cultured at 37°C and 5% CO2 for 48 hours. After aspirating the supernatant, the cells were washed twice with PBS, and 1 mL of 4% paraformaldehyde was added to each well for cell fixation. Cells were fixed at room temperature for 1 hour. 1 mL of 0.1% crystal violet staining solution was added to each well, and staining was performed at room temperature for 30 minutes. OD values ​​were then measured using a multi-mode microplate reader. 570 The absorbance was measured and statistically analyzed.

[0150] The results are as follows Figure 10 As shown, compared with the negative control group without antibodies, the survival rate of liver cancer cells in the antibody groups of both cell types was significantly reduced, indicating that the prepared antibodies can block the binding of PD-L1 on the surface of liver cancer cells to PD-1 on the surface of T cells by binding to PD-L1 on the surface of liver cancer cells.

[0151] (IV) Effect of CCK8 assay on the proliferation of liver cancer cells by dual-targeting antibody

[0152] The cell density was adjusted to 4 × 10⁴. 3 Cells were seeded per well into 96-well plates and cultured for 24 hours. After cell adhesion, the medium was replaced with low-serum DMEM (1% serum) and starved for 12 hours. Anti-bFGF ds-Diabody and bispecific diabody, along with a negative control PBS, were added to each group at final concentrations of 6.25, 12.5, 25, 50, 100, and 200 μg / mL. Each group used a medium containing 10 ng / mL of bFGF. After 48 hours, the old medium was removed, CCK8 solution was added, and the cells were cultured for another 1–4 hours. OD values ​​were then measured. 450 Absorbance value. The cell proliferation inhibition rate is calculated using the formula: 100% × (OD). 450 Negative control - OD 450 Experimental group) / (OD) 450 Negative control - OD 450 Blank group).

[0153] The results are as follows Figure 11 As shown, the bispecific diabody still maintains a better ability to inhibit the proliferation of liver cancer cells compared to anti-bFGF ds-Diabody.

[0154] (V) Detection of the effect of dual-targeting antibody on the proliferation ability of liver cancer cells by plate clone assay

[0155] The cell density was adjusted to 2×10⁻⁶. 4 Cells were seeded per well in a 6-well plate. Anti-bFGF ds-Diabody, bispecific diabody, and an equal volume of PBS were added to each well to a final concentration of 200 μg / mL. The culture medium used for each group contained 10 ng / mL of bFGF. Culture was terminated when each clonal cluster contained approximately 50 cells. Cells were fixed with paraformaldehyde, stained with crystal violet, washed with PBS, and allowed to dry inverted at room temperature. The 6-well plates were photographed under an operating light, and the clonal clusters were counted using ImageJ software.

[0156] The results are as follows Figure 12 As shown, compared to the control group, both anti-bFGF ds-Diabody and bispecific diabody significantly inhibited the colony formation ability of the two types of liver cancer cells. Furthermore, a differential analysis of the colony formation rate in the two antibody experiments revealed no significant difference between the experimental results of the two antibodies at the same concentration in both cell types, indicating that the bispecific diabody maintained a better ability to inhibit liver cancer cell proliferation compared to anti-bFGF ds-Diabody.

[0157] (VII) Transwell migration assay to detect the effect of dual-targeting antibody on the migration ability of liver cancer cells

[0158] After starvation for 12 hours, the cell density was adjusted to 2 × 10⁶ cells / year using DMEM medium. 5 Cells / mL. Anti-bFGF ds-Diabody, bispecific diabody, and an equal volume of PBS were added to 24-well plates to a final concentration of 200 μg / mL. The culture medium used for each group was DMEM containing 10 ng / mL bFGF. 100 μL of cell suspension was added to the upper chamber, and the cells were then placed into the 24-well plate using forceps. After 48 h of culture, the chambers were removed and washed with PBS. Cells were fixed with paraformaldehyde, stained with crystal violet, and then washed with PBS. Unmigrated cells inside the chambers were wiped away with cotton swabs, and images were taken using a cell imaging system. ImageJ analysis was performed using the formula: Migration rate = (Number of migrating cells in experimental group / Number of migrating cells in control group) × 100%.

[0159] The results are as follows Figure 13 Experiments showed that both anti-bFGF ds-Diabody and bispecific diabody could inhibit the migration of liver cancer cells. Furthermore, a differential analysis of migration rates between the two antibody groups revealed no significant difference in migration rates between the two cell types, indicating that bispecific diabody maintained a better ability to inhibit liver cancer cell migration compared to anti-bFGF ds-Diabody.

[0160] (VIII) Transwell invasion assay to detect the effect of dual-targeting antibody on the invasive ability of liver cancer cells

[0161] Pre-cool the materials used in the experiment at -20°C and thaw the Matrigel at 4°C. Dilute the Matrigel with pre-cooled DMEM medium at a volume ratio of 8:1 on ice. Add 100 μL of Matrigel to the chamber, incubate at 37°C for 2 hours, discard the unsolidified portion, add 100 μL of serum-free medium, and discard the remaining liquid after 30 minutes. Add anti-bFGF ds-Diabody, bispecific diabody, and an equal volume of PBS to 1 mL of complete medium in 24-well plates containing 10 ng / mL of bFGF, respectively, to a final concentration of 200 μg / mL. Adjust the cell density to 3 × 10⁶ cells using low-serum medium after starving the cells for 12 hours. 4 One cell per well was prepared, and the wells were then placed into 24-well plates. After 48 hours of incubation, the wells were removed, and any unmigrated cells and Matrigel cells on the membrane of the upper well were gently wiped away with a cotton swab. The cells were then washed with PBS. The cells were fixed with paraformaldehyde, stained with crystal violet, and then washed with PBS. The cells were photographed under an upright microscope. The cell invasion rate was calculated as (number of invasive cells in the experimental group / number of invasive cells in the control group) × 100%.

[0162] The results are as follows Figure 14 This indicates that both anti-bFGF ds-Diabody and bispecific diabody can inhibit the invasion of liver cancer cells. Furthermore, a difference analysis of the invasion rates in the two antibody experiments revealed no significant difference in invasion rates between the two antibody treatment groups in both cell types, indicating that bispecific diabody maintains a better ability to inhibit liver cancer cell invasion compared to anti-bFGF ds-Diabody.

[0163] (viii) Western blot analysis of the effects of dual-targeting on the expression levels of proliferation and migration-related proteins in liver cancer cells.

[0164] The cell density was adjusted to 3 × 10⁶ cells using complete culture medium.5 Cells were seeded at a density of 10 μg / mL into six-well plates and cultured for 24 h. The plates were then starved with low-serum medium. After 12 h, 200 μg / mL of anti-bFGF ds-Diabody and bispecific diabody were added to the corresponding wells, with each group using medium containing 10 ng / mL of bFGF. The plates were cultured for another 24 h. After digestion, the cell pellet was collected by centrifugation, washed with PBS, and incubated on ice for 15 min with an appropriate amount of cell lysis buffer. The supernatant was collected after centrifugation at 4 °C, and protein concentration was determined using the BCA method. Sample preparation was performed by adding loading buffer. Western blotting was used to detect proliferation-related p-AKT and p-MAPK levels, and EMT-related E-cadherin and N-cadherin levels.

[0165] Experimental results are as follows Figure 15 As shown, both anti-bFGF ds-Diabody and bispecific diabody can inhibit the proliferation and migration of liver cancer cells at the protein level. It was found that in both cell types, bispecific diabody maintained a better ability to inhibit the proliferation and migration of liver cancer cells compared to anti-bFGF ds-Diabody.

[0166] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. An antibody targeting PD-L1, comprising a light chain and a heavy chain; characterized in that: The amino acid sequences of the 3 CDRs on the light chain are as follows: CDR1 is SLRSYY, CDR2 is GKN, and CDR3 is NSRDAVLDWV. The amino acid sequences of the 3 CDRs on the heavy chain are as follows: CDR1 is GGSISSYY, CDR2 is IKQDESTK, and CDR3 is ARVWWPGRAALSDY.

2. The antibody targeting PD-L1 according to claim 1, characterized in that: the amino acid sequence of the heavy chain is shown as SEQ ID NO. 1; the amino acid sequence of the light chain is shown as SEQ ID NO.

3.

3. The antibody targeting PD-L1 according to claim 2, characterized in that: the sequence of the nucleic acid encoding the heavy chain is shown as SEQ ID NO. 2; the sequence of the nucleic acid encoding the light chain is shown as SEQ ID NO.

4.

4. The antibody targeting PD-L1 according to claim 1, characterized in that: The antibody targeting PD-L1 is a disulfide-stabilized anti-PD-L1 human-derived double-chain antibody.

5. The antibody targeting PD-L1 according to claim 4, characterized in that: The amino acid sequence of the disulfide-stabilized anti-PD-L1 human-derived double-chain antibody is shown as SEQ ID NO.

5.

6. A nucleic acid molecule, characterized in that: The nucleic acid molecule is a nucleic acid encoding the antibody targeting PD-L1 according to any one of claims 1-5.

7. The nucleic acid molecule of claim 6, wherein: The nucleic acid sequence of the nucleic acid molecule is shown as SEQ ID NO.

6.

8. Use of the antibody targeting PD-L1 according to any one of claims 1-5 or the nucleic acid molecule according to any one of claims 6-7 in the preparation of an anti-tumor drug.

9. A bispecific diabody targeting PD-L1 and bFGF, characterized in that: is a protein obtained by linking the antibody targeting PD-L1 and the antibody targeting bFGF according to any one of claims 1-5 with or without a linking peptide; contains 6 CDRs of the antibody targeting PD-L1 and 6 CDRs of the antibody targeting bFGF; wherein, The amino acid sequences of the 6 CDRs of the antibody targeting PD-L1 are as follows: CDR1 of the light chain is SLRSYY, CDR2 of the light chain is GKN, CDR3 of the light chain is NSRDAVLDWV, CDR1 of the heavy chain is GGSISSYY, CDR2 of the heavy chain is IKQDESTK, and CDR3 of the heavy chain is ARVWWPGRAALSDY; The amino acid sequences of the 6 CDRs of the antibody targeting bFGF are as follows: CDR1 of the light chain is SSDVGGYNY, CDR2 of the light chain is DVS, CDR3 of the light chain is SSYTSSSTVV, CDR1 of the heavy chain is GFTFSSYE, CDR2 of the heavy chain is ISSSGSTI, and CDR3 of the heavy chain is ARELTGDWGAFDIW.

10. The bispecific diabody targeting PD-L1 and bFGF of claim 9, characterized in that: The amino acid sequence of the bispecific double-chain antibody targeting PD-L1 and bFGF is shown as SEQ ID NO.

8.

11. A product characterized by: The product is selected from any one of the following: 1) a nucleic acid molecule encoding the bispecific double-chain antibody targeting PD-L1 and bFGF according to claim 9 or 10; 2) a recombinant expression vector containing the nucleic acid molecule of 1); 3) a recombinant expression cell containing the nucleic acid molecule of 1) or the recombinant expression vector of 2).

12. The product of claim 11, wherein: The nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO.

9.

13. Use of the bispecific diabody targeting PD-L1 and bFGF according to claim 9 or 10 in the preparation of an antitumor medicament.

Images