CRISPR (clustered regularly interspaced short palindromic repeats)-based recombinant screening method and corresponding kit

Abstract

The invention provides a CRISPR (clustered regularly interspaced short palindromic repeats)-based recombinant screening method and a corresponding kit, and particularly provides a CRISPR-based recombinant screening method, which comprises the following steps: (i) providing recipient cells subjected to a step of artificially introducing DNA (deoxyribonucleic acid) recombinant molecules, and splitting the recipient cells to obtain recipient cell splitting products, the carrier used for artificially introducing the DNA recombinant molecule contains a specific gene for identifying the carrier; (ii) performing nucleic acid amplification on the recipient cell lysis product to obtain an amplification product; and (iii) contacting the obtained amplification product with a CRISPR nucleic acid detection reagent, detecting the specific gene, and judging whether the recipient cell contains the specific gene, the method provided by the invention can be used for rapidly screening recombinants with low cost, high efficiency and multi-channel detection, and the screening time can be shortened to 3.5 h. The invention also provides a corresponding kit of the CRISPR-based recombinant screening method.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a CRISPR-based recombinant screening method and a corresponding kit. Background Art

[0002] The basic technical route of genetic engineering can be roughly summarized into four steps: 1. Obtain the target gene; 2. Construct a cloning vector; 3. After the target gene and the cloning vector are recombined, they are introduced into the recipient cell; 4. Detect and identify the target gene in the recipient cell.

[0003] The vector DNA molecule usually carries a certain selection genetic marker gene, which can be used for preliminary screening of transformants or recombinants. The method is to apply an appropriate amount of the transformed bacterial solution (including the control treatment) on the selection medium, culture it at the optimal growth temperature for a certain period of time, observe the growth of the colony, and then select the transformants.

[0004] For the recipient cells, LB medium is usually used. Adding an appropriate amount of a certain selection agent to the LB medium is the selection medium. The selection agent is determined by the selection marker gene carried on the vector DNA molecule. The most common method is drug resistance screening. This is a method of screening using the drug resistance selection marker on the vector DNA molecule. It is mainly used for transformant screening of recombinant plasmid DNA molecules. The recombinant plasmid DNA molecule carries a specific drug resistance selection marker gene and grows normally on the selection medium containing the corresponding selection drug.

[0005] Plasmid PCR or colony PCR can be used to further screen the recipient cells. Plasmid PCR is to pick out each colony for culture and extract plasmids, and then sequence the plasmids or digest them to verify the target fragments. However, it takes too much time from culturing bacteria to sending them for sequencing.

[0006] Colony PCR does not require the extraction of target gene DNA or enzyme digestion identification. Instead, it directly uses the DNA exposed after bacterial pyrolysis as a template for PCR amplification, saving time and effort. It is recommended to use universal primers on the vector to screen positive clones. This PCR method is usually used to screen the inserted target gene or DNA sequencing analysis. The final PCR product size is the size of the fragment between the universal primers of the vector. Colony PCR has the disadvantages of being time-consuming and the product cannot be directly sent for sequencing. Therefore, there is an urgent need in this field to develop a new recombinant screening method that can shorten the recombinant screening time. Summary of the invention

[0007] The purpose of the present invention is to provide a new recombinant screening method which can shorten the recombinant screening time.

[0008] The first aspect of the present invention provides a recombinant screening method, comprising the steps of:

[0009] (i) providing a recipient cell that has undergone a step of artificially introducing a DNA recombinant molecule, and lysing the recipient cell to obtain a recipient cell lysate, wherein the vector used for the artificially introduced DNA recombinant molecule contains a specific gene that recognizes the vector;

[0010] (ii) performing nucleic acid amplification on the recipient cell lysis product to obtain an amplified product;

[0011] (iii) contacting the obtained amplification product with a CRISPR nucleic acid detection reagent to detect the specific gene and determine whether the recipient cell contains the specific gene.

[0012] In another preferred embodiment, the method further comprises the following steps before step (i):

[0013] The recombinant DNA molecules are artificially introduced into the recipient cells, thereby obtaining the recipient cells which have undergone the step of artificially introducing the recombinant DNA molecules, and the recipient cells are cultured.

[0014] In another preferred embodiment, the method further comprises: (iv) screening recipient cells according to the detection results of the specific gene to obtain recombinants.

[0015] In another preferred embodiment, the method further comprises: (v) sequencing the recombinants to identify the target recombinants.

[0016] In another preferred embodiment, the culture includes plate culture and bacterial liquid culture.

[0017] In another preferred embodiment, the culture time is 8-20 hours, preferably, 9-15 hours, and more preferably, 12-14 hours.

[0018] In another preferred embodiment, the specific gene includes: a resistance gene, a replicon or a terminator.

[0019] In another preferred embodiment, the nucleic acid amplification method includes isothermal amplification.

[0020] In another preferred embodiment, the isothermal amplification includes rolling circle amplification (RCA).

[0021] In another preferred embodiment, the CRISPR nucleic acid detection reagent comprises:

[0022] Type V Cas proteins;

[0023] A guide RNA, wherein the guide RNA comprises a direct repeat sequence (DirectRepeat, DR) capable of binding to the V-type Cas protein and a guide sequence capable of targeting a specific gene of the vector; and

[0024] The Cas protein trans-cuts the reporter molecule, wherein the Cas protein trans-cuts the reporter molecule comprises a single-stranded nucleic acid molecule or a single-stranded nucleic acid analog molecule, and the single-stranded nucleic acid molecule or the single-stranded nucleic acid analog molecule does not hybridize with the guide sequence of the guide RNA.

[0025] In another preferred embodiment, the V-type Cas protein has trans-cleavage activity.

[0026] In another preferred example, the V-type Cas protein is selected from the following group: VA-type Cas protein, VB-type Cas protein, VC-type Cas protein, VD-type Cas protein, VE-type Cas protein, VF-type Cas protein, VG-type Cas protein, VH-type Cas protein, VI-type Cas protein, VJ-type Cas protein, VL-type Cas protein, VM-type protein, or a combination thereof.

[0027] In another preferred example, the V-type Cas protein includes Cas12.

[0028] In another preferred embodiment, the V-type Cas protein is selected from the group consisting of Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas12l, Cas12m, or a combination thereof;

[0029] In another preferred embodiment, the Cas12a is selected from the group consisting of FnCas12a, LbCas12a, ErCas12a, Evcas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, CeCas12a, PrCas12a, CsbCas12a, BhCas12a, SsCas12a 2a, Lb3Cas12a, BpCas12a, PdCas12a, BfCas12a, PcCas12a, cMtCas12a, PeCas12a, LiCas12a, Lb2Ca s12a, PmCas12a, MbCas12a, EeCas12a, CsbCas12a, ArCas12a, BsCas12a, AbCas12a, AsCas12a, or combinations thereof.

[0030] In another preferred embodiment, the source of Cas12a is selected from the group consisting of Leptotrichia, Listeria, Corynebacterium, Sutterella, Legionella, Treponema, Linebacteria, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Azospirillum, Sphaerochaeta, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, Campylobacter, Lachnospira, or a combination thereof.

[0031] In another preferred embodiment, the source of Cas12a is selected from the following group: Francisella tularensis (FnCas12a), Acidaminococcus sp. BV3L6 (Acidaminococcus sp. BV3L6) (AsCas12a), Lachnospiraceae bacterium ND2006 (LbCas12a), Lachnospiraceae bacterium NC2008 (Lb5Cas12a), Helcococcus sp kunzii (HkCas12a), Oribacterium sp. NK2B42 (OsCas12a), Thiomicrospira sp. XS5 (TsCas12a), Bacteroides KA00251 (Bacteroidales bacterium KA00251) (BbCas12a), Bacteroidetes oral taxon 274)(BoCas12a), Lachnospiraceaebacterium MC2017(Lb4Cas12a), Coprococcus eutactus(CeCas12a), Prevotella ruminicola strain BPI-34(PrCas12a), CandidatusSaccharibacteria bacterium(CsbCas12a), Butyrivibrio hungateistrain MB2003(BhCas12a), Smithella sp.SC_K08D17)(SsCas12a), Lachnospiraceae bacterium MC2017(Lb3Cas12a), Bytyrivibrio proteoclasticus(BpCas12a), Prevotelladisens(PdCas12a), Butyrivibrio fibrisolvens MD2001(BfCas12a), Porphyromonas crevioricanis(PcCas12a), CandidatusMethanoplasma termitum(CMtCas12a), Peregrinibacteria bacterium(PeCas12a), Leptospira inadaiserovar Lyme(LiCas12a), Lachnospiraceae bacterium MA2020(Lachnospiraceae bacterium MA2020)(Lb2Cas12a), Porphyromonas macaca(PmCas12a), Moraxella bovoculi 237(MbCas12a), Eubacterium eligens(EeCas12a), Candidatus Saccharibacteria bacterium(CsbCas12a), Eubacterium rectal(ErCas12a), Agathobacter rectalis strain(ArCas12a), Butyrivibrio sp. NC3005(BsCas12a), Arcobacter butzleri(AbCas12a), or a combination thereof. .

[0032] In another preferred embodiment, the source of Cas12b is selected from the following group: Alicyclobacillus kakegawensis, Bacillus V3-13, Bacillushisashii, Lentisphaeria bacterium, Laceyella sediminis or a combination thereof.

[0033] In another preferred embodiment, the Cas12b is selected from the following group: AacCas12b, AaCas12b, BthCas12b, AapCas12b, AkCas12b, AmCas12b, Bs3Cas12b, LsCas12b, BrCas12b (from Brevibacillus sp.SYP-B805, from article PMID: 31926228 DOI: 10.1016 / j.ijbiomac.2020.01.079), or a combination thereof.

[0034] In another preferred embodiment, the Cas protein trans-cleavage reporter molecule is selected from the following group: a reporter molecule based on gold nanoparticles, a reporter molecule based on fluorophores, a reporter molecule based on fluorescence polarization, a reporter molecule based on colloidal phase change / dispersion, a reporter molecule based on electrochemical signals, a reporter molecule based on semiconductor signals, and a color-based reporter molecule.

[0035] In another preferred example, the Cas protein trans-cleavage reporter molecule includes a molecule selected from the following group: a single-stranded nucleic acid molecule, a single-stranded nucleic acid analog molecule or a combination thereof.

[0036] In another preferred embodiment, the single-stranded nucleic acid molecule is selected from the following group: an unmodified single-stranded nucleic acid molecule, a modified single-stranded nucleic acid molecule, a single-stranded nucleic acid molecule containing an abasic spacer, or a combination thereof.

[0037] In another preferred embodiment, the Cas protein trans-cleaves the reporter molecule, i.e., the nucleic acid probe.

[0038] In another preferred embodiment, the nucleic acid probe carries a detectable label.

[0039] In another preferred embodiment, the detectable label includes a fluorescent group and a quencher group.

[0040] In another preferred embodiment, the fluorescent group is selected from the following group: FAM, HEX, Cy3, Cy5, Cy5.5, Cy7, ROX, VIC, JOE, TET, Texas Red, FITC, LC RED640, RB200 or a combination thereof.

[0041] In another preferred embodiment, the quenching group is selected from the following group: TAMARA, BHQ1, BHQ2, BHQ3, DABSYL, Dabcyl, eclipse or a combination thereof.

[0042] In another preferred embodiment, the fluorescent group and the quenching group are independently located at the 5' end, the 3' end and the middle of the nucleic acid of the nucleic acid probe.

[0043] In another preferred embodiment, the length of the nucleic acid probe is 3-300 nt, preferably 5-100 nt, more preferably 5-50 nt, and most preferably 5-15 nt.

[0044] In another preferred embodiment, the nucleic acid probe includes single-stranded DNA, single-stranded RNA or single-stranded nucleic acid analog molecule.

[0045] In another preferred embodiment, the nucleic acid probe comprises a single-stranded DNA, single-stranded RNA or single-stranded nucleic acid analog molecule with a detectable label.

[0046] In another preferred embodiment, the single-stranded DNA is a fluorescent and biotin-labeled single-stranded DNA, single-stranded RNA or single-stranded nucleic acid analog molecule.

[0047] In another preferred embodiment, the single-stranded DNA is a fluorescently labeled single-stranded DNA, single-stranded RNA or single-stranded nucleic acid analog molecule.

[0048] In another preferred example, when the V-type Cas protein is Cas12b, the CRISPR nucleic acid detection reagent also includes tracrRNA.

[0049] In another preferred embodiment, before step (i), the method further includes the steps of obtaining the target gene and connecting it to a vector to obtain a recombinant DNA molecule.

[0050] In another preferred embodiment, the artificial introduction of recombinant DNA molecules is carried out by transforming, transfecting or transducing the recipient cells with a vector.

[0051] In another preferred embodiment, the vector includes a cloning vector, an expression vector, a sequencing vector, a shuttle vector, a probe vector or an integration vector.

[0052] In another preferred embodiment, the vector is selected from the following group: a plasmid vector, a phage vector, a cosmid cloning vector, a phagemid vector, an artificial chromosome vector, an episomal vector, a viral vector, or a combination thereof.

[0053] In another preferred embodiment, the artificial chromosome vector is selected from the following group: bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), P1 artificial chromosome (PAC), or a combination thereof.

[0054] In another preferred embodiment, the viral vector is selected from the following group: retroviral vector, adenoviral vector, adeno-associated viral vector, herpes virus vector, poxvirus vector, baculovirus vector, papillomavirus vector, papillomavirus vector, HBP Epstein Barrvirus vector, vaccinia virus vector, Semliki Forest virus (SFV), or a combination thereof.

[0055] In another preferred embodiment, the vector is selected from the following group: pcDNA, pTT, pTT3, pEFBOS, pBV, pJV, pBJ, pGEX, VSV, pBR322, pCMV-HA, pEN, YAC, BAC, lambda phage, M13 phage, phagemid, pCAS9, pCEN6, pYES1L, p3HPRT1, pFN2A, pBC, pTZ, pGEM, pGEMK, pEX, pSAR, pCEP, cosmid, pBluescript, pKJK, pFloxin, pCP, pHR, pUC, pMAL, pAL TER, pBAD, pCal, pL, pET, pGEMEX, pCI, pCMV, pEGFP, pEGFT, pSV2, pFUSE, pVITRO, pVIVO, pMONO, pSELECT, pUNO, pDUO, Psg5L, pBABE, pWPXL, pBI, p15TV-L, pPro18, pTD, pRS420, pLexA, pACT2.2, pRS403, pRS404, pRS405, pRS406, pRS413, pRS414, pRS415, pRS416, or a combination thereof.

[0056] In another preferred embodiment, the recipient cell includes a prokaryotic cell or a eukaryotic cell.

[0057] In another preferred embodiment, the prokaryotic cell is selected from the group consisting of Escherichia coli, lactic acid bacteria, Bacillus subtilis, cyanobacteria, Streptomyces, Pseudomonas, Propionibacterium, Pectinatus sp., Bacteroides sp., Bacillus subtilis subtilis), Streptomyces, Anabaena, Arthrobacter, Agrobacterium, Acetobacter, Acetobacterium, Bacillus, Brevibacillus, Bifidobacterium, Brachybacterium, Brevibacterium, Carnobacterium, Xenorhabdus, Photorhabdus, Corynebacterium, Enterobacter, Pasteurella, Lactobacillus, Alcaligenes, Flavobacteriumspp.), Clostridium, Pasteuria, Escherichia, Gluconacetobacter, Gluconobacter, Hafnia, Halomonas, Klebsiella, Kocuria, Leucononstoc, Macrococcus, Methylomonas, Methylobacterium lobacter), Methylocella, Methylococcus, Microbacterium, Micrococcus, Microcystis, Moorella, Oenococcus, Pediococcus, Prochlorococcus, Propionibacterium, Proteus, Pseudoalteromonas ), Pseudomonas, Psychrobacter, Rhodobacter, Rhodococcus, Rhodopseudomonas, Erwinia, Shigella, Serratia, Salmonella, Staphylococcus, Streptococcus, Streptomyces, Rhizobium, Synechococcus Synechococcus, Synechocystis, Tetragenococcus, Weissella, Xanthomonas, Zymomonas, Rhodopseudomonas, and Salmonella typhimuium, Methylophilius, Azotobacter, Ensifer, Sphingomonas, Burkholderia, CandidatusGlomeribacter, Dai's bacteria, Grass Spirillum, Bradyrhizobium, Grevibacter, Sphingobacterium, Fermentobacterium, Serratia, Aeromonas, Vibrio, Desulfovibrio, Spirochaete, Acetobacter, or a combination thereof.

[0058] In another preferred embodiment, the prokaryotic cell is selected from the following group: Escherichia coli., Rodhobacter sphaeroides, Pseudoalteromonas shaloplanktis, Shewanella sp. strain Ac10, Pseudomonas fluorescens, Pseudomonas putida, Pseudomonas aeruginosa, Pseudomonas alcaligenes, Pseudomonas aeruginosa PAO1-LAC, Pseudomonas putida KT2440, Halomonas elongata, Pseudoalteromonas citrea, Chromohalobacter salex'igens), Streptomyces lividans, Streptomyces griseus, Streptomyces coelicolor, S.avermitilis, S.griseus, S.scabies, S.lividans TK24, S.lividans 1326, Nocardia lactamdurans, Mycobacterium smegmatis, Corynebacterium glutamicum, Corynebacterium ammoniagenes, Brevibacterium lactofermentum, Arthrobacter nicotianae, Acetobacter aceti, Arthrobacter arilaitensis), Bacillus cereus, Bacillus coagulans, Bacillus sphaericus, Bacillus stearothermophilus, Bacillus subtilis, Bacillus brevisbrevis), Bacillus megaterium, Bacillus licheniformis, Bacillus amyloliquefaciens, Lactococcus lactis, Lactobacillus plantarum, Lactobacillus casei, Lactobacillus reuteri, Lactobacillus gasseri, Lactobacillus acidifarinae, Lactobacillus yamanashiensis, Lactobacillus jensenii, Lactobacillus sakei, Gluconobacter oxydans, Bifidobacterium adolescentis adolescentis, Brachybacterium tyrofermentans, Brevibacterium linens, Carnobacterium divergens, Corynebacterium flavescens, Gluconacetobacter europaeus, Gluconacetobacter johannae, Gluconobacter oxydans, Klebsiella oxytoca, Actinobacillus succinogenes, Mannhei succiniciproducers MBEL 55E, Bacteroides amylophilus, Microbacterium foliorum, Propionibacterium acidipropionici), Proteus vulgaris, Psychrobacter celer, Bifidobacterium brevis / longumbifidum / breve / longum), Hafnia alvei, Anaerobiospirillum succiniciproducens, Ruminococcus flavefaciens, Prevotella ruminicola, Succcinimonas amylolytica, Succinivibrio dextrinisolvens, Wolinella succinogenes, Cytophaga succinicans, Rhizobium etli, Zymomonas mobilis, Clostridium acetobutylicum, Clostridium acetobutylicum, Clostridium ljungdahlii / aceticum / acetobutylicum / beijerinckii / butyricum), Enterococcus faecium, Micrococcus lylae, Oenococcus oeni, Macrococcus caseolyticus, Pediococcus acidilactici, Staphylococcus condimenti, Streptococcus thermophilus, Tetragenococcus halophilus, Kocuria rhizophila, Leuconostoc citreum, Weissella cibaria), Weissella koreansis, Moorella themocellum / thermoacetica, Bacillus thuringiensis, or a combination thereof.

[0059] In another preferred embodiment, the Escherichia coli is selected from the following group: BL21, BL21 (DE3), W3110, MG1655, RB791, RV308, HMS 174, HMS174 (DE3), NM533, XL1-Blue, C600, DH1, HB101, JM109, Top10, DH5α, DH10β, TG1, BW23473, BW23474, MW003, MW005 cells or a combination thereof; the Bacillus megaterium is selected from the following group: QMB1551, PV361, DSM319, or a combination thereof.

[0060] In another preferred embodiment, the eukaryotic cell is selected from the group consisting of yeast, fungi, plant cells, animal cells, or a combination thereof.

[0061] In another preferred embodiment, the yeast is selected from the following species: Rhodotorula spp., Aureobasidium spp., Saccharomyces spp., Sporobolomyces spp., or a combination thereof.

[0062] In another preferred embodiment, the yeast is selected from the group consisting of Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces fragilis (ATCC 12,424), Kluyveromyces bulgaricus (ATCC 16,045), Kluyveromyces weigeni (ATCC24,178), Kluyveromyces spp. (ATCC 56,500), K. waltii (ATCC 56500), Kluyveromyces drosophila (ATCC 36,906), Kluyveromyces thermotolerans, Kluyveromyces marxianus, Pichia pastoris, Pichia methanolica, Pichia stipitis, Yarrowia lipolytica lipolytica), Candida, Schwanniomyces occidentalis, Hansenula polymorpha, Saccharomyces carlsbergensis, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or a combination thereof.

[0063] In another preferred embodiment, the fungus is a filamentous fungus, and the filamentous fungus is selected from the following group: Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Pyrrospora, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Pha nerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, Trichoderma, Fusarium, Humicola, Neurospora, Scytalidium, Hypocrea, Chrysosporium, Filibasidium, Gibberella, Magnaporthe, Mucor, Myceliophthora, Myrothecium, Neocallimastix, or a combination thereof.

[0064] In another preferred embodiment, the fungus is selected from the group consisting of Aspergillus terreus, Aspergillus oryzae, Aspergillus niger, Aspergillus awamori, Aspergillus nidulans, Aspergillus fumigatus, Aspergillus aculeatus, Aspergillus clavatus, Aspergillus flavus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus oryzae, Rhizopus arrhizus, Rhizobus oryzae, Trichoderma reesei), Trichoderma reesei QM9414, Trichoderma reesei RUT-C30, Trichoderma reesei QM6a, Trichoderma atroviride, Trichoderma harzianum, Trichoderma virens, Trichoderma asperellum, Trichoderma longibrachiatum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma atroviride, Trichoderma virens, Trichoderma viride, Paecilomyces varioti, Penicillium viniferum), P. purpurogenum, P. funiculosum, Penicillium (Talaromyces) emersonii, P. camemberti, P. roqueforti, Phanerochaetechrysosporium, Ashbya gossypii, Byssochlamys nivea, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis chrysosporium,gilvescens), Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium lucknowense, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporiummerdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus), Coriolushirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum), Fusarium trichothecioides, Fusarium embellishment, Humicola insolens, Humicola lanuginosus, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenumpurpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, or a combination thereof.

[0065] In another preferred embodiment, the plant cell is a dicotyledonous plant cell or a monocotyledonous plant cell.

[0066] In another preferred embodiment, the dicotyledonous plant cell is selected from the group consisting of soybean cell, sunflower cell, tomato cell, Brassica crop cell, cotton cell, beet cell, tobacco cell, potato cell, petunia, Arabidopsis thaliana or a combination thereof. The monocotyledonous plant cell is selected from the group consisting of barley cell, maize cell, corn cell, oat cell, rice cell, sorghum cell, sugarcane cell, wheat cell or a combination thereof.

[0067] In another preferred embodiment, the animal cell is an insect cell or a mammalian cell.

[0068] In another preferred embodiment, the insect cell is selected from the group consisting of Autographa californica (alfalfa looper), Spodoptera frugiperda (fall army worm), Spodoptera exigua (beet armyworm), Trichoplusia ni (cabbage looper), Lymantria dispar (gypsy moth), Bombyx mori (silkworm), Anticarsia gemmatalis (velvet bean caterpillar), Heliothis virescens (tobacco budworm), Heliothis subflexa (Subflexus straw moth), Mamestra brassicae (cabbage moth), Helicoverpa armigera (cotton bollworm), Helicoverpa zea (corn earworm), Agrotis ipsilon (black cutworm), Anagrapha falcifera (celery looper), Galleria mellonella (honeycomb moth), Rachiplusia ou (gray looper), Plutella xylostella (diamondback moth), Drosophila melanogaster (fruit fly), Aedes aegypti (mosquito), or a combination thereof.

[0069] In another preferred embodiment, the insect cells are selected from the following group: Sf9 cells from Spodoptera frugiperda, Sf21 cells from Spodoptera frugiperda, High-Five cells from Trichoplusiani (same as Hi5, same as High-Five BTI-TN-5B1-4), Tn-368 cells from Trichoplusiani, Se301 cells from Spondoptera exigua, S2 cells from Drosophila melanogaster, Bm5 cells from Bombyx mori, Ld652Y from Gypsy Moth, LdEIta from Gypsy Moth, or a combination thereof.

[0070] In another preferred embodiment, the mammalian cell is selected from the following group: SV40 transformed monkey kidney cell CV1 line (COS-7, ATCC CRL1651); human embryonic kidney cell line (HEK293 or suspension cultured 293 cell subclone, Graham et al., J. GenVirol. 36:59 (1977)), such as Expi293; baby hamster kidney cells (BHK, ATCC CCL 10); baby hamster kidney cells (BHK); Chinese hamster ovary cells / -DHFR (CHO, Urlaub et al., Proc. Natl. Acad. Sci. USA 77:4216 (1980)); mouse testicular supporting cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCL70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human cervical cancer cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); Buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (HepG2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals N.Y. Acad. Sci. 383:44-68 (1982)); MRC 5 cells; FS4 cells; CHO cells; NSO cells; myeloma cell lines such as YB 2 / 0, YO, NS0, P3X63 and Sp2 / 0, etc.; lymphocytes (e.g., Y0, NS0, Sp20 cells); or a combination thereof.

[0071] In another preferred embodiment, the mammalian cells are selected from human cells, and the human cells are selected from the following groups: HeLa, Huh7, HEK293, HepG2, KATO-III, IMR32, MT-2, pancreatic β-cells, keratinocytes, bone marrow fibroblasts, CHP212, primary neural cells, W12, SK-N-MC, Saos-2, WI38, primary hepatocytes, FLC4, 143TK-, DLD-1, embryonic lung fibroblasts, primary foreskin fibroblasts, Saos-2 osteosarcoma, MRC5, MG63 cells or a combination thereof.

[0072] In another preferred embodiment, before the step (i), the primers and the recipient cells are mixed.

[0073] In another preferred embodiment, in step (i), the primers and recipient cell lysate are mixed.

[0074] In another preferred embodiment, in step (i), the recipient cells are lysed by increasing the temperature (from room temperature to 98° C.).

[0075] In another preferred embodiment, in step (i), if the vector exists in the recipient cell, the vector will be released; if the vector does not exist in the recipient cell, the vector cannot be released.

[0076] In another preferred embodiment, before step (ii), an enzyme for nucleic acid amplification is added.

[0077] In another preferred embodiment, the enzyme used for nucleic acid amplification includes: Phi29 DNA polymerase.

[0078] In another preferred embodiment, before step (ii), a nucleic acid amplification buffer is added.

[0079] In another preferred embodiment, in the step (i), the recipient cells are lysed and then a nucleic acid amplification buffer is added.

[0080] In another preferred embodiment, the nucleic acid amplification buffer comprises: Tris-HCl, MgCl2, (NH4)2SO4, and DTT.

[0081] In another preferred embodiment, the step (iii) further comprises the following steps:

[0082] (a) contacting the amplified product with a CRISPR nucleic acid detection reagent, wherein the CRISPR nucleic acid detection reagent includes a V-type Cas protein, a guide RNA, and a Cas protein trans-cleavage reporter molecule; the guide RNA includes a direct repeat sequence (DR) capable of binding to the V-type Cas protein and a guide sequence capable of targeting the specific gene; the Cas protein trans-cleavage reporter molecule includes a single-stranded nucleic acid molecule or a single-stranded nucleic acid analog molecule, and the single-stranded nucleic acid molecule or the single-stranded nucleic acid analog molecule does not hybridize with the guide sequence of the guide RNA;

[0083] (b) By detecting the signal change of the Cas protein trans-cutting the reporter molecule, the specific gene is detected to determine whether the recipient cell contains the specific gene.

[0084] In another preferred example, the detecting of the signal change of the Cas protein trans-cleavage reporter molecule is to detect whether the Cas protein trans-cleavage reporter molecule is cleaved by a V-type Cas protein.

[0085] In another preferred example, if the Cas protein trans-cleavage reporter molecule is cleaved by the V-type Cas protein, it means that the recipient cell contains the specific gene and the recipient cell is a recombinant; if the Cas protein trans-cleavage reporter molecule is not cleaved by the V-type Cas protein, it means that the recipient cell does not contain the specific gene and the recipient cell is a non-recombinant.

[0086] The second aspect of the present invention provides a recombinant screening kit, comprising:

[0087] i) a first container and a CRISPR nucleic acid detection reagent in the first container, wherein the CRISPR nucleic acid detection reagent comprises a V-type Cas protein, a guide RNA and a Cas protein trans-cleavage reporter molecule; the guide RNA comprises a direct repeat sequence (DR) capable of binding to the V-type Cas protein and a guide sequence capable of targeting the specific gene; the Cas protein trans-cleavage reporter molecule comprises a single-stranded nucleic acid molecule or a single-stranded nucleic acid analog molecule, and the single-stranded nucleic acid molecule or the single-stranded nucleic acid analog molecule does not hybridize with the guide sequence of the guide RNA;

[0088] ii) an optional second container and reagents for nucleic acid amplification within the second container.

[0089] In another preferred embodiment, the kit further comprises one or more containers selected from the group consisting of:

[0090] iii) a third container and a recipient cell in the third container, wherein the recipient cell is a recipient cell transformed, transfected or transduced by a vector, and the vector contains a specific gene for recognizing the vector;

[0091] iv) a fourth container and a buffer solution in the fourth container.

[0092] In another preferred embodiment, any two, three, four (or all) of the first container, the second container, the third container, and the fourth container may be the same (or identical) or different containers.

[0093] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0094] Figure 1 It is a schematic diagram of the recombinant screening method described in the specific implementation mode.

[0095] Figure 2 It is a flow chart comparing the recombinant screening method described in the specific implementation manner with the traditional method.

[0096] Figure 3 It is a schematic diagram of the process of the recombinant screening method described in the specific implementation manner.

[0097] Figure 4 This is a fluorescence signal diagram obtained by amplifying the products of different amplification times by CRISPR / Cas12a detection using the Amp-resistant vector in Example 1.

[0098] Figure 5 This is a fluorescence signal diagram obtained by using a Kan-resistant vector for amplification in Example 2, and detecting products of different amplification times through CRISPR / Cas12a.

[0099] Figure 6 This is a fluorescence signal diagram obtained by using a Chl-resistant vector for amplification in Example 3, and detecting the products of different amplification times by CRISPR / Cas12a. DETAILED DESCRIPTION

[0100] After extensive and in-depth research, the inventors first artificially introduced (such as transformation or transfection or transduction) DNA recombinant molecules (the vector used contains a specific gene that recognizes the vector) into the recipient cells for culture, lysis, nucleic acid amplification, and then contacted with CRISPR nucleic acid detection reagents (including V-type Cas protein, guide RNA and Cas protein trans-cutting reporter molecules), which can quickly, low-cost, efficient, multi-channel detection to screen out recombinants, and the screening time can be shortened to 3.5 hours. In addition, the present invention can use the resistance gene of the vector (such as a plasmid) as the detection target of CRISPR to achieve the standardization of recombinant screening, and reduce the problems of inconsistent operation and standards caused by different screening reagents for screening different target genes in the prior art.

[0101] Specifically, the method of the present invention is to culture the recipient cells after artificial introduction (such as transformation or transfection or transduction) of DNA recombinant molecules, lyse the recipient cells, design random primers on the target gene, perform nucleic acid amplification, and simultaneously or subsequently perform CRISPR nucleic acid detection, using the specific gene of the vector as the target, and detect whether the specific gene of the vector exists, thereby preliminarily screening out the recombinant. The present invention provides a new method for screening recombinants. Compared with the current colony PCR and plasmid PCR, the screening method of the present invention is time-consuming and has a high accuracy rate. On this basis, the inventors have completed the present invention.

[0102] the term

[0103] CRISPR-Cas: A unique genomic element derived from bacteria and archaea that serves as an adaptive immune defense system to resist invading phages or foreign nucleic acids. The system consists of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (abbreviated as Cas proteins, Cas).

[0104] Limit of Detection (LOD): The lowest concentration of an analyte in a sample that can be consistently detected with a typical probability of 95% certainty

[0105] Cycle Threshold (Ct) Value: The number of cycles required for the fluorescent signal to exceed the background level in a PCR reaction. The Ct value is inversely proportional to the amount of target nucleic acid in the sample (i.e., the lower the Ct level, the greater the amount of target nucleic acid in the sample). A Ct value of ≤36 is clearly positive. Questionable, indeterminate / weakly positive results show Ct values ​​between 37 and 40. This may represent early or late infection, or environmental contamination.

[0106] The term "Cas protein" refers to CRISPR-associated protein, which is the associated protein in the CRISPR system.

[0107] The term "V-type Cas protein" refers to the effector protein of the V-type family in CRISPR-associated proteins, which has diversity at the N-terminus but retains a unified RuvC-like endonuclease (RuvC) domain at the C-terminus, derived from the TnpB protein encoded by autonomous or non-autonomous transposons (Shmakov, S., Smargon, A., Scott, D., Cox, D., Pyzocha, N., Yan, W., et al. (2017). Diversity and evolution of class 2 CRISPR-Cas systems. Nat. Rev. Microbiol. 15, 169–182. doi: 10.1038 / nrmicro.2016.184). According to different CRISPR effector proteins, the V-type system is further subdivided into many subtypes.

[0108] The term "Cas12a" (formerly known as "Cpf1") refers to a crRNA-dependent endonuclease, which is a type VA enzyme in the CRISPR system classification.

[0109] The terms "Cas12b" and "C2c1" are used interchangeably and refer to the sgRNA-dependent endonuclease, which is a type VB enzyme in the CRISPR system classification.

[0110] The term "transformation" includes all processes or methods for artificially introducing recombinant DNA molecules into recipient cells, including but not limited to transformation, transfection, transduction, conjugation and other physical means, such as electroporation and microinjection of recipient cells.

[0111] The term "transformant" refers to a transformed cell that has taken up foreign DNA (vector or recombinant molecule).

[0112] The term "non-transformant" refers to a non-transformed cell that has not taken up foreign DNA (vector or recombinant molecule).

[0113] The term "recombinant" refers to a transformant containing a recombinant molecule.

[0114] The term "non-recombinants" refers to transformants containing only empty vector molecules.

[0115] The term "target recombinant" refers to a recombinant containing the correct target gene.

[0116] The term "non-target recombinant" is a recombinant that does not contain the correct target gene.

[0117] Cas proteins

[0118] The "Cas protein" described herein refers to a CRISPR-related protein (some documents translate it as CRISPR-Cas effector protein, CRISPR / Cas effector protein, CRISPR-Cas effector, CRISPR / Cas effector), which can be a type II Cas protein, a type V Cas protein, or a type VI Cas protein. Preferably, the type V Cas protein, once it binds to a cis-cleavage substrate under the guidance of a guide RNA to form a ternary complex of a Cas protein-guide RNA-cis-cleavage substrate, can induce its trans-cleavage activity, i.e., randomly cleave single-stranded nucleic acids and their equivalents (nucleic acid equivalents such as nucleic acid analogs).

[0119] The Cas protein described in this specific embodiment can be a V-type Cas protein with trans-cleavage activity; the Cas protein is selected from the following group: VA-type Cas protein, VB-type Cas protein, VC-type Cas protein, VD-type Cas protein, VE-type Cas protein, VF-type Cas protein, VG-type Cas protein, VH-type Cas protein, VI-type Cas protein, VJ-type Cas protein, VL-type Cas protein, VK-type Cas protein or a combination thereof; the Cas protein described in this specific embodiment includes Cas12, such as Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas12j, Cas12l, Cas12m or a combination thereof.

[0120] In a specific embodiment, the Cas protein referred to herein, such as Cas12, also covers functional variants of Cas proteins or homologs or orthologs thereof, which can be used in this specific embodiment. As used herein, the "functional variant" of a protein refers to a variant of such a protein that at least partially retains the activity of the protein. Functional variants may include mutants (which may be insertion, deletion or substitution mutants), including polymorphs, etc. Functional variants also include fusion products of such proteins with another generally unrelated nucleic acid, protein, polypeptide or peptide. Functional variants may be naturally occurring or may be artificial. Advantageous embodiments may relate to engineered or non-naturally occurring V-type DNA targeting effector proteins.

[0121] In one embodiment, the V-type Cas protein or its ortholog or homolog may comprise one or more mutations, and thus the nucleic acid molecule encoding it may have one or more mutations. The mutation may be an artificially introduced mutation and may include, but is not limited to, one or more mutations in the catalytic domain.

[0122] In one embodiment, the V-type Cas protein can be from: Leptotrichia, Listeria, Corynebacterium, Sutterella, Legionella, Treponema, Proteobacterium, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Azospirillum, Sphaerochaeta, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, Campylobacter, Lachnospira, or a combination thereof.

[0123] Table 1 V-type family effector properties (source: doi:10.3389 / fcell.2020.622103)

[0124]

[0125] a V stands for A, C, and G.

[0126] b R stands for A and G C B stands for C, G and T.

[0127] Guide RNA (gRNA)

[0128] As used herein, the "guide RNA" is a mature crRNA fused with tracrRNA as a guide RNA, or a mature crRNA fused with scoutRNA as a guide RNA, or crRNA alone as a guide RNA.

[0129] In general, the guide RNA may include a direct repeat (also known as a DR sequence) and a guide sequence, or may be substantially composed of or composed of a direct repeat and a guide sequence (also known as a spacer in the context of an endogenous CRISPR system). In different CRISPR systems, gRNA may include crRNA and scoutRNA, or may contain only crRNA (such as an embodiment of Cas12a in this specific embodiment) depending on the Cas protein on which it depends. CrRNA and tracrRNA may be artificially modified and fused to form a single guide RNA (sgRNA). In some cases, the guide sequence is a polynucleotide sequence that has sufficient complementarity with the cis-cutting substrate DNA to hybridize with the cis-cutting substrate DNA and guide the CRISPR / Cas protein-guide RNA complex to specifically bind to the cis-cutting substrate DNA, typically having a sequence length of 12-25nt. The direct repeat sequence may be folded to form a specific structure (such as a stem-loop structure) for Cas protein recognition to form a complex. The guide sequence does not need to be 100% complementary to the cis-cutting substrate DNA. The guide sequence is not complementary to the nucleic acid in the trans-cleavage reporter molecule.

[0130] In certain embodiments, when optimally aligned, the degree of complementarity (match) between the guide sequence and its corresponding cis-cleaved substrate DNA is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining optimal alignment is within the capabilities of one of ordinary skill in the art. For example, there are publicly available and commercially available alignment algorithms and programs, such as, but not limited to, ClustalW, Smith-Waterman in matlab, Bowtie, Geneious, Biopython, and SeqMan.

[0131] The terms "polynucleotide", "nucleotide sequence", "nucleic acid sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, which may be double-stranded or single-stranded.

[0132] The terms "homology" or "identity" are used to refer to the matching of sequences between two polypeptides or between two nucleic acids. When a position in the two sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of the two DNA molecules is occupied by adenine, or a position in each of the two polypeptides is occupied by lysine), then the molecules are identical at that position between the two sequences. Typically, the comparison is made when the two sequences are aligned to produce maximum identity. Such comparison can be by using, for example, the identity of amino acid sequence can be by conventional methods, reference such as Smith and Waterman, 1981, Adv.Appl.Math.2:482Pearson & Lipman, 1988, Pro.Natl.Acad.Sci.USA85:244, Thompson et al., 1994, Nucleic AcidsRes22:467380 etc. teaching, by computerized operation algorithm (GAP in Wisconsin Genetics software package, BESTFIT, FASTA, and TFASTA, Genetics Computer Group) determine. Also can use the BLAST algorithm that can be obtained from the National Center for Biotechnology Information (NCBI www.ncbi.nlm.nih.gov / ), use default parameters to determine.

[0133] Cis cleavage activity

[0134] Cis-cleavage activity refers to the activity of Cas protein binding to the same repeat sequence of guide RNA, and under the guidance of the guide sequence of guide RNA, recognizing and binding to the substrate, forming a Cas protein-guide RNA-substrate ternary complex with the substrate, and specifically cutting the substrate. Such a substrate is called a Cas protein cis-cleavage substrate. In the present invention, the Cas protein cis-cleavage substrate is an amplification product of a specific gene containing a vector obtained after nucleic acid amplification of the receptor cell lysis product.

[0135] Trans-cleavage activity

[0136] Trans-cleavage activity refers to the binding of Cas protein to the same-direction repeat sequence of guide RNA, and under the guidance of the guide sequence of guide RNA, it recognizes and binds to the substrate, forms a ternary complex of Cas protein-guide RNA-substrate with the substrate, and specifically cuts the substrate, and has non-specific cutting activity on single-stranded nucleic acid molecules (which can also be equivalents of nucleic acid molecules, such as nucleic acid analog molecules). If a single-stranded nucleic acid molecule is modified to have a signal reporting function, such a single-stranded nucleic acid molecule is called a trans-cleavage reporter molecule in the detection.

[0137] Nucleic acid analogs

[0138] Nucleic acid analogs are a class of derivatives of RNA and DNA. Nucleic acids are mainly composed of phosphate, pentose and bases, while nucleic acid analogs replace at least one of them with some other substances. The main nucleic acid analogs include peptide nucleic acid (PNA), morpholino (MNA), bridged nucleic acid (BNA), locked nucleic acid (LNA), glycol nucleic acid (GNA) and threose nucleic acid (TNA). Some of these nucleic acid analogs can even carry out biological processes such as replication and translation in vitro (Brudno, Yevgeny; Birnbaum, Michael E; Kleiner, Ralph E; Liu, David R. "An invitro translation, selection and amplification system for peptide nucleic acids". Nature Chemical Biology. 6(2): 148–155. doi: 10.1038 / nchembio.280.PMC2808706. PMID 20081830).

[0139] Recombinant screening method

[0140] In a preferred embodiment, the present invention provides a recombinant screening method, comprising the steps of:

[0141] (i) artificially introducing a recombinant DNA molecule into a recipient cell and culturing the recipient cell, wherein the vector used for the recombinant DNA molecule contains a specific gene that recognizes the vector;

[0142] (ii) lysing the recipient cells to obtain recipient cell lysate;

[0143] (iii) performing nucleic acid amplification on the recipient cell lysis product to obtain an amplified product;

[0144] (iv) contacting the obtained amplified product with a CRISPR nucleic acid detection reagent to detect the specific gene and determine whether the recipient cell contains the specific gene.

[0145] In the present invention, if the recipient cell contains the specific gene, it is a recombinant; if the recipient cell does not contain the specific gene, it is a non-recombinant.

[0146] CRISPR is a microbial adaptive immune system that can be found in about 50% of prokaryotes and about 90% of archaea. This immune system exhibits a nuclease activity that specifically targets invasions from bacteriophages, transposons, or plasmids. Currently, the CRISPR-Cas system has been used in various applications such as gene editing, imaging, and detection of nucleic acids.

[0147] Studies have found that the CRISPR-Cas system can be used to detect RNA. Cas13a was first shown to be able to cut specific RNA sequences in bacterial cells, and after cutting, it can exert its trans-cutting activity and continue to cut other non-target RNAs. The crRNA-target RNA duplex binds to a positively charged central channel of the nuclease lobe (NUC) in LbuCas13a, and once bound to the target RNA, LbuCas13a and crRNA undergo significant conformational changes. This crRNA-target RNA duplex formation promotes the HEPN1 domain of LbuCas13a to move to the HEPN2 domain, thereby activating the HEPN catalytic site of LbuCas13a, and then LbuCas13a cuts single-stranded target RNA and other RNAs in a non-specific manner. The first detection platform used to detect RNA was called SHERLOCK (Specific High-Sensitivity Enzymatic Reporter UnLOCKing).

[0148] The applicant's team first discovered that CRISPR-Cas12 protein has efficient "trans-cleavage activity", and based on the unique advantages of this enzyme, developed the "HOLMES" nucleic acid rapid detection platform technology (one-HOur Low-cost Multipurpose highly Efficient System), which is mainly used for DNA detection. HOLMES can also indirectly detect RNA, which requires reverse transcription of RNA into cDNA.

[0149] The CRISPR-based recombinant screening method of the present invention utilizes the rapid specificity of CRISPR detection, shortens the time of recombinant screening, and can complete the screening in as fast as 3.5 hours. In addition, the resistance gene of the plasmid can be used as the detection target of CRISPR to achieve the standardization of recombinant screening, and reduce the problems of inconsistent operation and standards caused by using different screening reagents for screening different target genes in the prior art.

[0150] See also Figure 1 , 2 In a preferred embodiment, the CRISPR-based recombinant screening method of the present invention comprises the following steps:

[0151] A. Cultivate the recipient cells into which the DNA recombinant molecule has been artificially introduced (e.g., after transformation / transfection / transduction) on a plate;

[0152] B. Lysing the recipient cells and allowing the primers to contact the recipient cell lysis products; the primers are random primers designed on the target gene;

[0153] C. performing nucleic acid amplification, wherein the nucleic acid amplification is preferably RCA amplification;

[0154] D. Perform CRISPR detection on the amplified product, using the vector-specific gene as the target, to detect whether the vector-specific gene is present, wherein the vector-specific gene is a resistance gene; or perform CRISPR detection simultaneously with nucleic acid amplification, using the vector-specific gene as the target, to detect whether the vector-specific gene is present.

[0155] Before step A, obtaining the target gene, connecting it to the vector, and artificially introducing it (such as transformation / transfection / transduction) into the recipient cell all belong to the prior art. After step D, sequencing the screened recombinants and finally identifying the desired target recombinants also belong to the prior art.

[0156] Preferably, after step A and before step B, the primers are mixed with the recipient cells; or, after the recipient cells are lysed in step B, the primers are mixed with the recipient cell lysate.

[0157] Preferably, an enzyme used for nucleic acid amplification is added after the recipient cells are lysed in step B and before step C.

[0158] Preferably, a nucleic acid amplification buffer is added after step A and before step B; or, a nucleic acid amplification buffer is added after the recipient cells are lysed in step B.

[0159] Preferably, the receptor cells are lysed to release the vector by heating and then annealing. If the vector exists in the receptor cells, the vector will be released; if the vector does not exist in the receptor cells, the vector cannot be released.

[0160] The CRISPR nucleic acid detection comprises the following steps:

[0161] a) contacting the amplified product with a Cas12 protein, a guide RNA and a trans-cleavage reporter molecule; the guide RNA comprises a direct repeat (DR) sequence capable of binding to the V-type Cas protein and a guide sequence capable of targeting the specific gene; the Cas protein trans-cleavage reporter molecule comprises a single-stranded nucleic acid molecule or a single-stranded nucleic acid analog molecule, and the single-stranded nucleic acid molecule or the single-stranded nucleic acid analog molecule does not hybridize with the guide sequence of the guide RNA;

[0162] b) detecting the signal of the trans-cleaved reporter molecule.

[0163] More preferably, the vector is a plasmid, and the specific gene of the vector is a resistance gene.

[0164] The CRISPR-based recombinant screening method of the present invention utilizes the rapid characteristics of CRISPR nucleic acid detection, shortens the time of recombinant screening, and can complete the screening in as fast as 3.5 hours. In addition, the resistance gene of the plasmid can be used as the detection target of CRISPR to achieve the standardization of transformant screening, and reduce the problems of inconsistent operation and standards caused by using different screening reagents for screening different target genes in the prior art.

[0165] The main advantages of this embodiment include:

[0166] (1) The present invention is the first to culture the recipient cells transformed or transfected or transduced with a vector (the vector contains a specific gene that recognizes the vector), amplify the nucleic acid, and then contact them with CRISPR nucleic acid detection reagents (including V-type Cas protein, guide RNA and Cas protein trans-cutting reporter molecules), which can quickly, low-cost, efficiently, and multi-channelly detect and screen positive recombinants, and the screening time can be shortened to 3.5 hours. In addition, the present invention can use the resistance gene of the plasmid as the detection target of CRISPR to achieve the standardization of recombinant screening, and reduce the problems of inconsistent operations and standards caused by using different screening reagents for screening different target genes in the prior art.

[0167] (2) The method of the present invention is to culture the transformed, transfected or transduced recipient cells, lyse the recipient cells, perform nucleic acid amplification, and simultaneously or subsequently perform CRISPR nucleic acid detection, using the specific gene of the vector as the target, to detect whether the specific gene of the vector is present, thereby preliminarily screening out recombinants. The present invention provides a new method for screening recombinants. Compared with the current colony PCR and plasmid PCR, the screening method of the present invention is time-saving and has a high accuracy rate, and can also achieve the screening of recombinants with ssDNA as the target gene.

[0168] (3) The selected recombinants can be directly sent out for sequencing, which greatly shortens the detection time compared to the traditional colony PCR method. If the CRISPR nucleic acid test proves that the transformants are not amplified, they will not be sequenced, saving time and cost.

[0169] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight. The experimental materials and reagents involved in the present invention can be obtained from commercial channels unless otherwise specified.

[0170] For a review of mammalian host cell lines suitable for protein production, see, e.g., Yazaki and Wu, Methods in Molecular Biology, Vol. 248 (BKC Lo, ed., Humana Press, Totowa, NJ), pp. 255-268 (2003).

[0171] Cloning and expression vectors useful for producing proteins in plant cell culture are known to those skilled in the art. See, e.g., Hiatt et al., Nature (1989) 342:76-78, Owen et al. (1992) Bio / Technology 10:790-794, Artsaenko et al. (1995) The Plant J 8:745-750, and Fecker et al. (1996) Plant Mol Biol 32:979-986.

[0172] Example 1

[0173] See also Figure 3 , the figure takes pUC18 plasmid as an example (where pUC18 (Plasmid addgene #50004) is a vector carrying Amp resistance and a recombinant target gene (Gene1). The screening took less than 4 hours.

[0174] pUC18 was transformed into DH5a competent cells (purchased from Shanghai Biotech Co., Ltd., hereinafter referred to as Biotech) and cultured (8-14 hours) to grow a single clone. The single clone was picked and placed in the Tolo Reaction Buffer Mix (purchased from Anhui Tolo Biotechnology Co., Ltd.) premix, treated at 98°C for 5 minutes, and then quickly placed on ice for 3 minutes. The bacteria were lysed, the plasmid and primers were combined by annealing, phi29 DNA polymerase was added, and the reaction was carried out for 3 hours; 2ul of the product was taken, and the CRISPR-Cas system was used for resistance gene detection, and the reaction was carried out at 37°C for 30 minutes. If the product produced a fluorescent signal, the product could be sent for sequencing.

[0175] The Tolo Reaction Buffer Mix premix includes Tolo Reaction Buffer Mix and primers.

[0176] Tolo Reaction Buffer Mix contains Tris-HCl (pH 7.5), magnesium chloride, sulfuric acid, DTT, and dNTPs.

[0177] The primers are random primers designed on the target gene (Gene1) of pUC18 plasmid recombination.

[0178] This embodiment includes two main experiments: Experiment 1.1 and Experiment 1.2.

[0179] Experiment 1.1 RCA exponential amplification

[0180] 1.1.1 Experimental Purpose

[0181] RCA amplification of plasmids and colonies

[0182] 1.1.2 Experimental materials and instruments

[0183] Primers: pUC18-F, pUC18-R, synthesized and purified by Shanghai Ruimian Biotechnology Co., Ltd., and configured to a concentration of 100uM for subsequent experiments.

[0184] Phi29 DNA polymerase (purchased from Anhui Tolo Biotechnology Co., Ltd.), and the reagent was equipped with 2×Tolo Reaction Buffer Mix (purchased from Anhui Tolo Biotechnology Co., Ltd.).

[0185] Fluorescence PCR instrument: Thermo fisher ordinary PCR instrument (or use water bath for RCA)

[0186] pUC18-R TGCTTCCGGCTCGTATGTTGTGT pUC18-F GTAAAACGACGGCCAGT

[0187] 1.1.3 Experimental methods and steps

[0188] Prepare the RCA reaction system according to the table below.

[0189]

[0190] The above system was heated at 98℃ for 5min, then quickly placed on ice for 3min. Then 0.5ul phi29DNA polymerase (purchased from Anhui Tolo Biotechnology Co., Ltd.) was added. After mixing, the reaction was continued at 30℃ for 0.5h / 1h / 1.5h / 2h / 2.5h / 3h.

[0191] Experiment 1.2 CRISPR / Cas12a detection of RCA products

[0192] After the amplification of experiment 1.1 is completed, the amplified product (full-length sequence of pUC18) is taken for CRISPR / Cas12a cutting.

[0193] in,

[0194] Cas12a is LbCas12a (purchased from Anhui Tolo Biotechnology Co., Ltd.)

[0195] The guide RNA sequence is:

[0196] AAUUUCUACUCUUGUAGAUCGCAUACACUAUUCUCAGAAUGA(SEQ ID NO.4)

[0197] The sequence of the Cas protein trans-cleavage reporter molecule is:

[0198] 5'6-FAM-CCCCCCCC-3'BHQ1 (DNA sequence)

[0199] Prepare the CRISPR / Cas12a reaction system according to the table below.

[0200]

[0201] The reaction was carried out at 37°C for 20 min on a Q5 instrument.

[0202] Results and Analysis

[0203] The products amplified at 0.5h, 1.0h, 1.5h, 2.0h, 2.5h, and 3.0h were subjected to CRISPR / Cas12 cleavage verification. The cleavage results are shown in the figure below. Figure 4 From the experimental results, it can be seen that with the increase of time, the exponential RCA amplification products increase, and recombinants can be screened out in 3.5 hours.

[0204] Example 2

[0205] Taking pET28a plasmid as an example (pET28a (Plasmid addgene #50351) is a vector carrying Kan resistance and a recombinant target gene (Gene2). The screening took less than 4 hours.

[0206] pET28a was transformed into DH5a competent cells (purchased from Bio-Technology) and cultured for 8-14 hours to grow a single clone. The single clone was picked and placed in the premixed solution of Tolo Reaction Buffer Mix (purchased from Anhui Tolo Port Biotechnology Co., Ltd.), treated at 98℃ for 5 minutes, and then quickly placed on ice for 3 minutes. The bacteria were lysed, the plasmid and primers were combined by annealing, phi29 DNA polymerase was added, and the reaction was carried out for 3 hours; 2ul of the product was taken, and the CRISPR-Cas system was used for resistance gene detection, and the reaction was carried out at 37℃ for 30 minutes. If the product produced a fluorescent signal, the product could be sent for sequencing.

[0207] The Tolo Reaction Buffer Mix premix includes Tolo Reaction Buffer Mix and primers.

[0208] Tolo Reaction Buffer Mix contains Tris-HCl (pH 7.5), magnesium chloride, sulfuric acid, DTT, and dNTPs.

[0209] The primers are random primers designed on the target gene (gene2) recombined by pET28a plasmid.

[0210] This embodiment includes two main experiments: Experiment 2.1 and Experiment 2.2.

[0211] Experiment 2.1 RCA exponential amplification

[0212] 2.1.1 Experimental Purpose

[0213] RCA amplification of plasmids and colonies

[0214] 2.1.2 Experimental materials and instruments

[0215] Primers: pET28a-F, pET28a-R, synthesized and purified by Shanghai Ruimian Biotechnology Co., Ltd., and configured to a concentration of 100uM for subsequent experiments.

[0216] Phi29 DNA polymerase (purchased from Anhui Tolo Biotechnology Co., Ltd.), and the reagent was equipped with 2×Tolo Reaction Buffer Mix (purchased from Anhui Tolo Biotechnology Co., Ltd.).

[0217] Fluorescence PCR instrument: Thermo fisher ordinary PCR instrument (or use water bath for RCA)

[0218] pET28a-R gcaccacctggctaatgtag pET28a-F tgacagaggcgagagaaacc

[0219] 2.1.3 Experimental methods and procedures

[0220] Prepare the RCA reaction system according to the table below.

[0221]

[0222] The above system was heated at 98°C for 5 min, then quickly placed on ice for 3 min. Then 0.5ul phi29 DNA polymerase (purchased from Anhui Tolo Biotechnology Co., Ltd.) was added. After mixing, the reaction was continued at 30°C for 0.5h / 1h / 1.5h / 2h / 2.5h / 3h.

[0223] Experiment 2.2 Detection of RCA products by CRISPR / Cas12a

[0224] After the amplification of Experiment 2.1 is completed, the amplified product (full-length sequence of pET28a) is taken for CRISPR / Cas12a cutting.

[0225] in,

[0226] Cas12a is LbCas12a (purchased from Anhui Tolo Biotechnology Co., Ltd.).

[0227] The guide RNA sequence is:

[0228] AAUUUCUACUCUUGUAGAUuauggguauaaaugggcucgcga(SEQ ID NO.5)

[0229] The sequence of the Cas protein trans-cleavage reporter molecule is:

[0230] 5'6-FAM-CCCCCCCC-3'BHQ1 (DNA sequence)

[0231] Prepare the CRISPR / Cas12a reaction system according to the table below.

[0232]

[0233] The reaction was carried out at 37°C for 20 min on a Q5 instrument.

[0234] Results and Analysis

[0235] The products amplified at 0.5h, 1.0h, 1.5h, 2.0h, 2.5h, and 3.0h were subjected to CRISPR / Cas12 cleavage verification. The cleavage results are shown in the figure below. Figure 5 From the experimental results, it can be seen that with the increase of time, the exponential RCA amplification products increase, and recombinants can be screened out in 3.5 hours.

[0236] Example 3

[0237] Taking the pTC18067 plasmid as an example (pTC18067 was constructed by ourselves for the experiment), it is a vector carrying Chl resistance and a recombinant target gene (Gene3).

[0238] pTC18067 was transformed into DH5a competent cells (purchased from Bio-Technology) and cultured for 8-14 hours to grow a single clone. The single clone was picked and placed in the premixed solution of Tolo Reaction Buffer Mix (purchased from Anhui Tolo Biotechnology Co., Ltd.), treated at 98℃ for 5 minutes, and then quickly placed on ice for 3 minutes. The bacteria were lysed, the plasmid was combined with the primers by annealing, and phi29 DNA polymerase was added to react for 3 hours; 2ul of the product was taken, and the CRISPR-Cas system was used for resistance gene detection, and the reaction was carried out at 37℃ for 30 minutes. If the product produced a fluorescent signal, the product could be sent for sequencing.

[0239] The Tolo Reaction Buffer Mix premix includes Tolo Reaction Buffer Mix and primers.

[0240] Tolo Reaction Buffer Mix contains Tris-HCl (pH 7.5), magnesium chloride, sulfuric acid, DTT, and dNTPs.

[0241] The primers are random primers designed on the target gene (gene3) recombined in the pTC18067 plasmid.

[0242] This embodiment includes two main experiments: Experiment 3.1 and Experiment 3.2.

[0243] Experiment 3.1 RCA exponential amplification

[0244] 3.1.1 Experimental Purpose

[0245] RCA amplification of plasmids and colonies

[0246] 3.1.2 Experimental materials and instruments

[0247] Primers: pTC18067-F, pTC18067-R, synthesized and purified by Shanghai Ruimian Biotechnology Co., Ltd., and configured to a concentration of 100uM for subsequent experiments.

[0248] Phi29 DNA polymerase (purchased from Anhui Tolo Biotechnology Co., Ltd.), the reagent is equipped with 2×Tolo Reaction Buffer Mix (purchased from Anhui Tolo Biotechnology Co., Ltd.).

[0249] Fluorescence PCR instrument: Thermo fisher ordinary PCR instrument (or use water bath for RCA)

[0250] pTC18067-R gaacgccatattttcctgga pTC18067-F tcagtttgtcttcgttgaag

[0251] 3.1.3 Experimental methods and procedures

[0252] Prepare the RCA reaction system according to the table below.

[0253]

[0254] The above system was heated at 98℃ for 5min, then quickly placed on ice for 3min. Then 0.5ul phi29 DNA polymerase (purchased from Anhui Tolo Biotechnology Co., Ltd.) was added. After mixing, the reaction was continued at 30℃ for 0.5h / 1h / 1.5h / 2h / 2.5h / 3h.

[0255] Experiment 3.2 CRISPR / Cas12a detection of RCA products

[0256] After the amplification of Experiment 3.1 was completed, the amplified product (full-length sequence of pTC18067) was taken for CRISPR / Cas12a cutting.

[0257] in,

[0258] Cas12a is LbCas12a (purchased from Anhui Tolo Biotechnology Co., Ltd.).

[0259] The guide RNA sequence is:

[0260] AAUUUCUACUCUUGUAGAUaggcauuucagucaguugcucaa(SEQ ID NO.6)

[0261] The sequence of the Cas protein trans-cleavage reporter molecule is:

[0262] 5'6-FAM-CCCCCCCC-3'BHQ1 (DNA sequence)

[0263] Prepare the CRISPR / Cas12a reaction system according to the table below.

[0264]

[0265] The reaction was carried out at 37°C for 20 min on a Q5 instrument.

[0266] Results and Analysis

[0267] The products amplified at 0.5h, 1.0h, 1.5h, 2.0h, 2.5h, and 3.0h were subjected to CRISPR / Cas12 cleavage verification. The cleavage results are shown in the figure below. Figure 6 From the experimental results, it can be seen that with the increase of time, the exponential RCA amplification products increase, and recombinants can be screened out in 3.5 hours.

[0268] The target gene sequences in Examples 1-3 are as follows:

[0269] Gene1 (SEQ ID NO.1):

[0270] CTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGT TGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAA

[0271] Gene2 (SEQ ID NO.2):

[0272] Atcccttcagagctccgcctgtagcacaggggttgctcttcttgtccaccatgtagttcagcttgtcgatcagcatcttctcgaacttctggtacacctgcttctccaccttcactctgctgttcttgaagccgctgttcagatcctccagagcgatcacggcatcgtacttctccaccagctcgcagatcttgtgcaccacctggctaatgtagccggccttcagctccttgatgttctcgatgctggtccagttctgtctggcctcgaatctctccttctccttcttgtccagcaggctgtggtagtcggtcttgattctgatgccgttgaagttgttgatgatctcgttcaggctgtactgctccacgatgtttcccttgccgtccaccaccacgatgtacagcaggtttctctcgcctctgtcaatgccgatcacgtaggggttgtcgtcgtgcttcagcagcactctcacctcggtgttgatcttgaagatgttcttggggcacttgttgatggcgatggggatatgcagctcgtactggtcctcgctgaatctcttgtccttgtacacgtcgtagctcagggtggtggttttcttggggttgtcggggttcttgttagcgatggggctattggcaggatgcaccaccagctcttccttcttcaggctggctcttctcatgaacagttcagcgcctccagaaagtctgatctggccgtggttgttctcgtcgaacagcagcttgaagtacatggtgtgcagattgggggttccgtgagacttgtcgctgaagtcc

[0273] Gene3(SEQ ID NO.3):

[0274]

[0275] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A recombinant screening method, characterized in that: Includes steps: (i) providing a recipient cell that has undergone a step of artificially introducing a DNA recombinant molecule, and lysing the recipient cell to obtain a recipient cell lysate, wherein the vector used for the artificially introduced DNA recombinant molecule contains a specific gene that recognizes the vector; (ii) performing nucleic acid amplification on the recipient cell lysis product to obtain an amplified product; (iii) contacting the obtained amplification product with a CRISPR nucleic acid detection reagent to detect the specific gene and determine whether the recipient cell contains the specific gene.

2. The method according to claim 1, characterized in that The method further comprises: (iv) screening the recipient cells according to the detection results of the specific gene to obtain recombinants.

3. The method according to claim 1, characterized in that The method further comprises: (v) sequencing the recombinants to identify target recombinants.

4. The method according to claim 1, characterized in that The specific gene includes: a resistance gene, a replicon or a terminator.

5. The method according to claim 1, characterized in that The method of nucleic acid amplification includes isothermal amplification.

6. The method according to claim 5, characterized in that The isothermal amplification includes rolling circle amplification (RCA).

7. The method according to claim 1, characterized in that The CRISPR nucleic acid detection reagent includes: Type V Cas proteins; A guide RNA, wherein the guide RNA comprises a direct repeat sequence (Direct Repeat, DR) capable of binding to the V-type Cas protein and a guide sequence capable of targeting a specific gene of the vector; and The Cas protein trans-cuts the reporter molecule, wherein the Cas protein trans-cuts the reporter molecule comprises a single-stranded nucleic acid molecule or a single-stranded nucleic acid analog molecule, and the single-stranded nucleic acid molecule or the single-stranded nucleic acid analog molecule does not hybridize with the guide sequence of the guide RNA.

8. The method according to claim 7, characterized in that The V-type Cas protein has trans-cleavage activity.

9. The method according to claim 8, characterized in that The V-type Cas protein is selected from the following group: VA-type Cas protein, VB-type Cas protein, VC-type Cas protein, VD-type Cas protein, VE-type Cas protein, VF-type Cas protein, VG-type Cas protein, VH-type Cas protein, VI-type Cas protein, VJ-type Cas protein, VL-type Cas protein, VM-type protein, or a combination thereof.

10. A recombinant screening kit, characterized in that: include: i) a first container and a CRISPR nucleic acid detection reagent in the first container, wherein the CRISPR nucleic acid detection reagent comprises a V-type Cas protein, a guide RNA and a Cas protein trans-cleavage reporter molecule; the guide RNA comprises a direct repeat sequence (DR) capable of binding to the V-type Cas protein and a guide sequence capable of targeting the specific gene; the Cas protein trans-cleavage reporter molecule comprises a single-stranded nucleic acid molecule or a single-stranded nucleic acid analog molecule, and the single-stranded nucleic acid molecule or the single-stranded nucleic acid analog molecule does not hybridize with the guide sequence of the guide RNA; ii) an optional second container and reagents for nucleic acid amplification within the second container.

Images