Kit for rapidly and jointly detecting multiple pathogen nucleic acids related to dyspnea pregnancy outcome and application of kit

Abstract

The invention belongs to the technical field of in-vitro diagnostic reagents for rapid detection of human pathogenic microorganisms, and particularly relates to a kit for rapid combined detection of multiple pathogen nucleic acids related to a dyspnea pregnancy outcome and application of the kit. The pathogen is selected from one or more of escherichia coli, candida albicans, candida glabrata, group B streptococcus, lactobacillus, streptococcus gonorrhoeae, chlamydia trachomatis or ureaplasma urealyticum. The kit comprises a rapid pathogen detection micro-fluidic chip, a primer group for detecting the pathogen nucleic acid and an array consisting of an amplification control and a blank control are fixed on the micro-fluidic chip. According to the present invention, the microfluidic chip rapid detection technology and the nucleic acid amplification technology are adopted to achieve the purposes of rapid detection and multiple detection so as to rapidly and conveniently determine the poor prognosis risk of the pregnant woman at present, timely take the specific measures, and avoid the occurrence of the poor prognosis.

Description

Technical Field

[0001] The present invention belongs to the technical field of in vitro diagnostic reagents for rapid detection of human pathogenic microorganisms, and specifically relates to a kit for rapid combined detection of multiple pathogen nucleic acids associated with adverse pregnancy outcomes and uses thereof. Background Art

[0002] Lactobacillus is dominant in the reproductive tract flora of women during normal pregnancy. It secretes lactic acid to maintain the low pH environment of the reproductive tract and produces antibacterial components such as hydrogen peroxide and cytokines, and occupies the ecological niche of the reproductive tract microenvironment to prevent the growth and reproduction of pathogens, thereby maintaining the normal ecology of the reproductive tract. In addition, Lactobacillus can also affect the expression of immune factors in vaginal epithelial cells by producing lactic acid. When the microenvironment of the reproductive tract flora changes, lactic acid bacteria are no longer dominant, but other pathogens or conditional pathogens dominate, which can lead to vaginitis and even reproductive system diseases such as cervicitis. Studies have shown that reproductive tract infection is a high-risk factor for spontaneous abortion, which may affect both pregnant women and newborns. Therefore, it is of great significance to explore the infection of reproductive tract pathogens in pregnant women and develop corresponding rapid detection methods to prevent adverse pregnancy outcomes.

[0003] In the study of the distribution of reproductive tract pathogens in pregnant women, it was found that Candida and Mycoplasma accounted for a high proportion, among which Candida was mainly Candida albicans and Mycoplasma was mostly Ureaplasma urealyticum. Therefore, it is necessary to pay special attention to the impact of vaginal infection of Candida albicans and Ureaplasma urealyticum on pregnant women. In addition, Chlamydia (mainly Chlamydia trachomatis) is also a major pathogen of reproductive tract infection.

[0004] At present, the commonly used detection methods for reproductive tract infections in clinical practice are culture, PCR, and sequencing. The culture method is low-cost and widely used, but it is not suitable for some reproductive tract pathogens such as Chlamydia and often takes several days or even a week, which cannot meet the needs of rapid diagnosis; the PCR method has high sensitivity and short time consumption, but PCR detection of single pathogens is often carried out clinically, and it is difficult to identify the pathogen when the symptoms are not specific; the sequencing method has a very wide detection range and can detect tens of thousands of pathogens. However, it is generally used for infections whose causes cannot be ascertained, the cost is high, and it is not suitable for prevention and early intervention. Therefore, it is of certain significance to find new methods for detecting reproductive tract pathogens.

[0005] Microfluidic chip, also known as microfluidic chip or lab-on-a-chip, integrates all reaction units into a chip that is only the size of a palm or even a fingernail and can realize the entire process of biochemical reaction. In the field of biological science research, microfluidic chip can be combined with PCR nucleic acid detection, integrating the entire PCR reaction process on the chip, with the advantages of micro-quantification, integration and rapid detection.

[0006] The present invention is the first to apply microfluidic chips combined with PCR nucleic acid detection technology to the detection of female reproductive tract pathogens clinically associated with adverse pregnancy outcomes. By collecting clinically positive samples of corresponding pathogens for detection by this method, the results are methodologically compared with the commonly used culture methods for clinical microbiological testing, thereby developing a method that can predict pregnancy outcomes by rapidly detecting reproductive tract pathogens in pregnant women. Summary of the invention

[0007] In order to overcome the defects and shortcomings in the prior art, the present invention proposes a group of pathogens that clinically have varying degrees of adverse effects on pregnancy outcomes, and uses microfluidic chip rapid detection technology and nucleic acid amplification technology to achieve the purpose of rapid detection and multiple detection, thereby quickly and conveniently determining the current adverse prognosis risk of pregnant women, and taking targeted measures in a timely manner to avoid the occurrence of adverse prognosis.

[0008] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions: In the first aspect, the present invention provides a kit for rapid combined detection of multiple pathogen nucleic acids associated with adverse pregnancy outcomes, wherein the pathogens are selected from one or more of the following: Escherichia coli, Candida albicans, Candida glabrata, Group B Streptococcus, Lactobacillus, Streptococcus gonorrhoeae, Chlamydia trachomatis or Ureaplasma urealyticum, and the kit comprises a pathogen rapid detection microfluidic chip, on which a primer set for detecting the pathogen nucleic acid and an array consisting of an amplification control and a blank control are fixed.

[0009] As an optional method, in the above kit, the amplification control is a control sample containing a positive amplification template or a negative amplification template, which is used to monitor whether the amplification system operates normally.

[0010] As an optional method, in the above kit, the blank control is a control sample without template, which is used to monitor whether non-specific fluorescent signals appear in the reaction system.

[0011] As an optional method, in the above kit, the extraction control is a control sample containing an internal reference gene, which is used to monitor whether the process from extraction to amplification is normal.

[0012] As an optional mode, in the above kit, the pathogen is Escherichia coli, Candida albicans, Candida glabrata, Group B Streptococcus, Lactobacillus, Streptococcus gonorrhoeae, Chlamydia trachomatis and Ureaplasma urealyticum.

[0013] As an optional method, in the above-mentioned kit, the kit is suitable for microfluidic chip combined with PCR nucleic acid detection technology.

[0014] As an optional manner, in the above-mentioned kit, the microfluidic chip can be any microfluidic chip known in the art.

[0015] As an example, the present invention can be used as follows Figure 1 The microfluidic chip shown. The microfluidic chip used in the present invention can be based on the principle of continuous flow. A constant flow pump drives the amplification system containing the sample to be tested to pass through different temperature zones at a uniform speed. In three different temperature zones, the sample can complete DNA denaturation, annealing and extension. Each time a position transfer is completed, a DNA amplification process is completed. When the sample flows out of the microfluidic chip, the entire amplification process is completed. Based on the above principles, the speed of the nucleic acid amplification process is no longer limited by the heating and cooling rates of the temperature control device, but instead controls the liquid flow rate and the heat transfer efficiency of the liquid-solid two phases under the microchannels in the chip. This method can complete a PCR amplification cycle within 5 seconds. Taking 45 cycles as an example, all amplifications are completed in about 4 minutes.

[0016] As an optional method, in the above kit, the primer set for detecting the pathogen nucleic acid includes one or more of the following, from 5' to 3' direction: Escherichia coli: F primer: GTTAATACCTTTGCTCATTGA (SEQ ID NO. 1); R primer: ACCAGGGTATCTTAATCCTGTT (SEQ ID NO. 2); Candida albicans: F primer: GACTAGCATTAGTGGGTTGCG (SEQ ID NO. 3); R primer: CACCCAGCAGAATACACCG (SEQ ID NO. 4); Candida glabrata: F primer: ACAGGGTCTGATCAGCAACCA (SEQ ID NO. 5); R primer: GCCAACTATCCCAACTGGTGT (SEQ ID NO. 6); Group B Streptococcus: F primer: CAGTTGTAAGGAATGTGGTAAAGG (SEQ ID NO. 7); R primer: AAAGTTGGCTTCAGCATAGG (SEQ ID NO. 8); Ureaplasma urealyticum: F primer: CACAGATGTCCTTGATGTACCC (SEQ ID NO. 9); R primer: GTAAAAATTATTTGTAAATTGGGC (SEQ ID NO. 10); Neisseria gonorrhoeae: F primer: CCGGAACTGGTTTCATCTG (SEQ ID NO. 11); R primer: GTTTCAGCGGCAGCATTCA (SEQ ID NO. 12); Chlamydia trachomatis: F primer: CCTGCTGAACCAAGCCTTAT (SEQ ID NO. 13); R primer: TGATAGCGTCACACCAAGTG (SEQ ID NO. 14); Lactobacillus: F primer: GAGGCAGCAGTAGGGAATCTTC (SEQ ID NO. 15); R primer: GGCCAGTTACTACCTCTATCCTTCTTC (SEQ ID NO. 16).

[0017] As an optional mode, in the above-mentioned kit, the detection sample of the kit is a vaginal-derived tissue sample, including vaginal secretions, cervical secretions or cervicovaginal exfoliated cells.

[0018] In a second aspect, the present invention provides use of the kit described in the first aspect above in preparing a product for rapid combined detection of nucleic acids of multiple pathogens associated with adverse pregnancy outcomes.

[0019] As an optional method, in the above-mentioned uses, if Neisseria gonorrhoeae, Chlamydia trachomatis or Group B Streptococcus is detected, regardless of whether Lactobacillus is detected, it indicates that the pregnant woman has a higher risk of adverse pregnancy outcomes, including premature birth, miscarriage or other adverse pregnancy outcomes. Even if Lactobacillus is detected, close monitoring and timely appropriate treatment measures are still required.

[0020] As an optional method, in the above-mentioned uses, if Escherichia coli, Ureaplasma urealyticum, Candida albicans or Candida glabrata are detected and Lactobacillus is not detected, it indicates that the pregnant woman has a serious degree of vaginal flora imbalance and a high risk of adverse pregnancy outcomes, and should be given special attention and appropriate treatment measures should be taken.

[0021] As an option, in the above uses, if Escherichia coli, Ureaplasma urealyticum, Candida albicans or Candida glabrata are detected and Lactobacillus is detected, it indicates that the pregnant woman has a moderate risk of adverse pregnancy outcomes, but regular testing and appropriate treatment measures are still required.

[0022] As an optional method, in the above-mentioned use, if no pathogens and no lactobacilli are detected, it indicates that the vaginal flora of pregnant women is imbalanced and the risk of infection is high, and further monitoring and evaluation are required to prevent potential infection.

[0023] As an optional method, in the above-mentioned use, if no pathogens are detected and lactobacilli are detected, it indicates that the vaginal flora of pregnant women is healthy and the risk of adverse pregnancy outcomes is low, and routine follow-up can be continued without special intervention.

[0024] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention proposes a group of pathogens that have different degrees of adverse effects on pregnancy outcomes in clinical practice, and uses microfluidic chip rapid detection technology and nucleic acid amplification technology to achieve the purpose of rapid detection and multiple detection, so as to quickly and conveniently determine the adverse prognosis risk of pregnant women at present, and take targeted measures in time to avoid the occurrence of adverse prognosis.

[0025] (2) The pathogens in the sample are jointly detected by using a primer set containing multiple pathogen designs and a detection method on a microfluidic chip fixed with the primer set. The detection method provided by the present invention can detect pathogens with the advantages of strong specificity, convenience, rapidity, and a wide range of applications. At the same time, it also has the advantages of low reagent consumption and low pollution. The entire experiment is a closed-cover reaction, which reduces the possibility of contamination, is low-cost, and portable.

[0026] (3) The method of the present invention can jointly detect a variety of common clinical reproductive tract pathogens that endanger pregnancy, thereby conducting a preliminary risk assessment of pregnancy outcomes. The method used has high detection efficiency and can complete the detection within a few hours, which is much shorter than the commonly used clinical culture method, which takes about three days. It also has high accuracy and can detect more pathogens than the culture method, allowing for a more detailed assessment of the risk of adverse pregnancy. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 : Schematic diagram (upper figure) and actual picture (lower figure) of the microfluidic chip used in the method of the present invention. DETAILED DESCRIPTION

[0028] The present invention will be further described with reference to specific embodiments below. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the scope of the present invention.

[0029] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0030] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0031] Example: 1. Research subjects and methods 1.1 Research subjects Approval has been obtained from the Ethics Committee of Peking University Third Hospital, and all operations are in compliance with ethical requirements. Pregnant women who underwent reproductive tract pathogen testing at Peking University Third Hospital from January 1, 2023 to April 1, 2024.

[0032] 1.2 Research Methods 1.2.1 Retrospective analysis (1) Pregnancy outcomes of patients with positive GBS nucleic acid test: Query the LIS system of Peking University Third Hospital, retrieve patients (pregnant women) with positive rectal-vaginal swab group B Streptococcus (GBS) nucleic acid test from January 1, 2023 to December 28, 2023 in the molecular biology laboratory, and query their pregnancy outcomes.

[0033] (2) Pregnancy outcomes of patients with positive cervical and vaginal exfoliated cell microbial culture: Query the LIS system of Peking University Third Hospital, retrieve patients (pregnant women) with positive cervical and vaginal exfoliated cell culture in the Microbiology Laboratory from January 1, 2023 to December 28, 2023, and query their pregnancy outcomes.

[0034] 1.2.2 Screening of target pathogens Based on the results of retrospective analysis and literature reports, seven common reproductive tract pathogens that affect pregnancy outcomes were identified: Escherichia coli, Candida albicans, Candida glabrata, Group B Streptococcus, Ureaplasma urealyticum, Neisseria gonorrhoeae, and Chlamydia trachomatis.

[0035] 1.2.3 Determine primers The specific primer sequences used in the PCR detection of the above-identified pathogens and lactobacilli reported in the published literature were consulted and analyzed, and adjusted accordingly to make them suitable for microfluidic chip fluorescence PCR. The primer sequences used are shown in Table 1.

[0036] Table 1: Primer sequences used

[0037] 1.2.3 Collect and store samples Cervical and vaginal exfoliated cell swab samples from the microbiology laboratory and GBS, UU, CT, and NG nucleic acid test positive samples from the molecular biology laboratory were collected from January 20, 2024 to April 10, 2024 and stored in a -20℃ refrigerator.

[0038] Register the barcode numbers of the collected samples and query the LIS system to record the test results of the clinical methods used for each sample.

[0039] Vaginal swab samples need to be tested after extracting microbial genomic DNA. The extracted microbial genomic DNA is pre-treated by mechanical crushing and then extracted by a machine or manually extracted according to the instructions of a commercial extraction kit.

[0040] Add samples and react. Add 5 μL DNA samples to the reaction wells containing PCR reaction solution 1-8. Positive and negative quality controls should be set as controls for each test. Like the samples being tested, both positive and negative controls need to be tested with reaction solution 1-8. After adding samples, seal the plate with a sealing film or cover the tube tightly, vortex gently to mix, and start amplification after a short centrifugation. Record the experimental results.

[0041] The data were analyzed using Python 3.11.2. Count data were expressed as frequency (%). The results of microfluidic chip technology were compared with those of traditional methods. The chi-square test was used to determine whether there were differences in the data between the groups, and P < 0.05 was considered statistically significant.

[0042] 2. Experimental Results 2.1 Retrospective analysis results 2.1.1 Data Results From January 1, 2023 to December 28, 2023, there were 323 positive samples of GBS infection in pregnant women, including 89 cases of gestational diabetes, 15 cases of preeclampsia, 61 cases of premature rupture of membranes, and 16 cases of other adverse outcomes (threatened abortion, fetal distress, recurrent miscarriage, etc.), with an adverse rate of 56.04%.

[0043] From January 1, 2023 to December 28, 2023, 561 cases of positive cervical and vaginal exfoliated cell culture in the microbiology department were found, of which 80 cases had adverse outcomes for Escherichia coli and 38 cases had normal outcomes. There were 48 cases of adverse outcomes for Candida albicans and 37 cases of normal outcomes. There were 46 cases of adverse outcomes for Lactobacillus samples and 312 cases of normal outcomes. The pregnancy outcomes of patients with negative microbial culture samples were queried, and 425 cases were randomly selected from 3058 cases, of which 45 cases had adverse outcomes and 380 cases had normal outcomes. The specific statistical results are shown in Table 2.

[0044] Table 2: Statistics on infections and pregnancy outcomes among pregnant women in 2023

[0045] 2.1.2 Data Analysis The chi-square test was performed on the above results to obtain the results shown in Table 3 below.

[0046] Table 3: Chi-square test results of positive microbiological tests and adverse pregnancy

[0047] 2.2 Results of collected samples 2.2.1 Data Results A total of 820 samples of cervical and vaginal exfoliated cells and molecular biological pathogen nucleic acid detection samples were collected, and 288 samples were selected for microfluidic chip detection. The results are shown in Table 4 below: Table 4: Comparison between culture method and microfluidic chip detection

[0048] In addition, in addition to the 38 pathogen-positive cases reported by the culture method, the microfluidic chip test detected an additional 23 pathogens outside the reporting range. The results are shown in Table 5 below: Table 5: Additional pathogens detected by microfluidic chip (not included in culture results)

[0049] Other pathogens refer to pathogens within the detection range of the microfluidic chip other than the reported pathogens, such as Candida albicans reported as positive by culture method, Candida albicans detected as positive by microfluidics, and Escherichia coli, Ureaplasma urealyticum, and Chlamydia trachomatis detected as positive.

[0050] The nucleic acid was extracted from the pathogen for testing, and the results are shown in Table 6: Table 6: Comparison of PCR and microfluidic chip detection of pathogenic pure nucleic acid samples

[0051] The pregnancy outcomes of the patients corresponding to the collected samples were queried, and the results are shown in Table 7 below.

[0052] Table 7: Relationship between pathogen positivity and adverse outcomes

[0053] 2.3 Data Analysis The compliance rate was calculated according to the CNAS-GL039 Molecular Diagnostic Test Procedure Performance Verification Guidelines. The positive compliance rate of microfluidic chip detection and culture method was 92.59%, the negative compliance rate was 84.72%, and the overall compliance rate was 87.55%. The positive compliance rate of microfluidic chip detection of pure nucleic acid samples and PCR method was 98.75%.

[0054] A chi-square test was performed to compare the pregnancy outcomes of patients with positive lactobacillus with those of patients with positive Candida albicans, Escherichia coli, and GBS, and the chi-square value was calculated to be 6.855, with a corresponding P value of 0.0088.

[0055] 3. Discussion and Conclusion Normally, the female reproductive tract has a flora dominated by lactobacilli, namely the vaginal flora. Lactobacilli break down sugars to produce lactic acid, thereby maintaining a low pH environment in the vagina, and secrete antibacterial ingredients such as hydrogen peroxide, which helps inhibit the growth of pathogens and maintain vaginal health. This natural defense mechanism is an important part of the female reproductive system, helping to prevent pathogens from entering the human body along the reproductive tract and causing diseases such as pelvic inflammatory disease. When this barrier is destroyed in pregnant women and pathogenic microorganisms become dominant, it may affect the patient's pregnancy outcome. Some studies in recent years have confirmed the correlation between the two.

[0056] However, early genital tract pathogen infection may be asymptomatic or have non-specific symptoms, which can easily lead to missed diagnosis. The commonly used clinical pathogen detection methods, culture method, PCR method, and sequencing method are not suitable for this early diagnosis. This is because: some pathogens have strict requirements on culture conditions or cannot be obtained through conventional culture, such as mycoplasma and chlamydia, and it takes a long time; the PCR method is often used for specific pathogen detection and is used for confirmation of specific pathogens, which is not suitable for early screening; the sequencing method is expensive and is not conducive to clinical promotion. Therefore, we propose to apply microfluidic chip detection technology to the detection of genital tract pathogens in pregnant women, taking into account high sensitivity and multiple detection capabilities, and can achieve rapid detection.

[0057] In the present invention, a retrospective study was conducted. The proportion of adverse pregnancy outcomes in patients with positive E. coli, Candida albicans, and GBS cultured from reproductive tract specimens of pregnant women in Peking University Third Hospital was tested by chi-square test, and the results showed that positive E. coli, Candida albicans, and GBS were correlated with adverse pregnancy outcomes (p<0.05), which confirmed the feasibility of the present invention.

[0058] Subsequently, clinical samples were collected for microfluidic chip testing, and the results of microfluidic chip testing and clinical testing methods were statistically analyzed and compared. The results showed that the results of microfluidic chip testing and culture method were consistent. Subsequently, nucleic acid purification of pathogens and PCR testing and microfluidic chip testing were performed, with a compliance rate of 98.75%.

[0059] Afterwards, the inventor consulted the pregnancy outcomes of the patients corresponding to the collected specimens, and performed a chi-square test on the adverse pregnancy outcome rates of patients positive for Candida albicans, Escherichia coli, and GBS and those of patients positive for Lactobacillus. The chi-square value was 6.855, and the corresponding P value was 0.0088, which once again proved the feasibility of the present invention.

[0060] In summary, the present invention clarifies the association between positive detection of reproductive tract pathogens such as group B Streptococcus, Escherichia coli and Candida albicans in the reproductive tract of pregnant women and adverse pregnancy outcomes through retrospective analysis. The experimental results showed that the proportion of pregnant women with premature rupture of membranes, preeclampsia and gestational diabetes in these pathogen-positive pregnant women was significantly higher than that in the negative group. The microfluidic chip detection method showed a high positive compliance rate (92.59%) and total compliance rate (87.55%), showing its reliability and practicality compared with the traditional culture method. The efficiency and accuracy of this method are expected to provide faster and more extensive pregnancy-related pathogen detection in the clinic, thereby promoting early intervention of reproductive tract infections during pregnancy and preventing adverse pregnancy outcomes.

[0061] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A kit for rapid joint detection of multiple pathogen nucleic acids associated with adverse pregnancy outcomes, characterized in that: The pathogen is selected from one or more of the following: Escherichia coli, Candida albicans, Candida glabrata, Group B Streptococcus, Lactobacillus, Streptococcus gonorrhoeae, Chlamydia trachomatis or Ureaplasma urealyticum. The kit comprises a microfluidic chip for rapid detection of pathogens, on which a primer set for detecting nucleic acid of the pathogen and an array consisting of an amplification control and a blank control are fixed.

2. The kit according to claim 1, characterized in that: The kit is suitable for microfluidic chip combined with PCR nucleic acid detection technology.

3. The kit according to claim 1, characterized in that: The primer set for detecting the pathogen nucleic acid includes one or more of the following, in the 5' to 3' direction: Escherichia coli: F primer: the nucleotide sequence shown in SEQ ID NO. 1; R primer: the nucleotide sequence shown in SEQ ID NO. 2; Candida albicans: F primer: the nucleotide sequence shown in SEQ ID NO. 3; R primer: the nucleotide sequence shown in SEQ ID NO. 4; Candida glabrata: F primer: the nucleotide sequence shown in SEQ ID NO. 5; R primer: the nucleotide sequence shown in SEQ ID NO. 6; Group B Streptococcus: F primer: the nucleotide sequence shown in SEQ ID NO. 7; R primer: the nucleotide sequence shown in SEQ ID NO. 8; Ureaplasma urealyticum: F primer: the nucleotide sequence shown in SEQ ID NO. 9; R primer: the nucleotide sequence shown in SEQ ID NO. 10; Neisseria gonorrhoeae: F primer: the nucleotide sequence shown in SEQ ID NO. 11; R primer: the nucleotide sequence shown in SEQ ID NO. 12; Chlamydia trachomatis: F primer: the nucleotide sequence shown in SEQ ID NO. 13; R primer: the nucleotide sequence shown in SEQ ID NO. 14; Lactobacillus: F primer: the nucleotide sequence shown in SEQ ID NO. 15; R primer: the nucleotide sequence shown in SEQ ID NO.

16.

4. The kit according to claim 1, characterized in that: The test sample of the kit is a vaginal tissue sample, including vaginal secretions, cervical secretions or cervicovaginal exfoliated cells.

5. Use of the kit according to any one of claims 1 to 4 in the preparation of a product for rapid combined detection of nucleic acids of multiple pathogens associated with adverse pregnancy outcomes.

6. The use according to claim 5, characterized in that: If Neisseria gonorrhoeae, Chlamydia trachomatis or Group B Streptococcus is detected, regardless of whether Lactobacillus is detected, it indicates that the pregnant woman is at higher risk of adverse pregnancy outcomes, including premature birth, miscarriage or other adverse pregnancy outcomes. Even if Lactobacillus is detected, close monitoring and timely appropriate treatment measures are still needed.

7. The use according to claim 5, characterized in that: If Escherichia coli, Ureaplasma urealyticum, Candida albicans or Candida glabrata are detected and Lactobacillus is not detected, it indicates that the pregnant woman has a serious degree of vaginal flora imbalance and a high risk of adverse pregnancy outcomes. Special attention should be paid and appropriate treatment measures should be taken.

8. The use according to claim 5, characterized in that: If Escherichia coli, Ureaplasma urealyticum, Candida albicans or Candida glabrata are detected and Lactobacillus is detected, it indicates that the pregnant woman has a moderate risk of adverse pregnancy outcomes, but regular testing and appropriate treatment measures are still required.

9. The use according to claim 5, characterized in that: If no pathogens and lactobacilli are detected, it indicates that the pregnant woman has vaginal flora imbalance and a high risk of infection, and further monitoring and evaluation are needed to prevent potential infection.

10. The use according to claim 5, characterized in that: If no pathogens are detected and lactobacilli are detected, it indicates that the pregnant woman's vaginal flora is healthy and the risk of adverse pregnancy outcomes is low. Routine follow-up can be continued without special intervention.

Images