Application and method of PtoKNATa gene in regulation and control of xylem development and wood formation of poplar

Abstract

The invention discloses an application and a method of a PtoKNATa gene in regulation and control of xylem development and wood formation of poplar, a knockout vector of the PtoKNATa gene is constructed and screened, and after the obtained knockout vector is transformed into a populus tomentosa plant, the xylem cell generation speed of the populus tomentosa can be effectively increased, the fast growth of wood is improved, and the yield of the poplar is increased. A method and a germplasm basis are provided for breeding of excellent varieties of forest trees, and the wood yield and economic benefits of economic forests can be improved.

Description

Technical Field

[0001] The invention relates to the field of plant molecular biotechnology, in particular to the application of the PtoKNATa gene in regulating the xylem development and wood formation of poplars, and also to a method for constructing fast-growing poplar germplasm with increased plant height and thickened trunk diameter. Background Art

[0002] Wood is the most abundant biomass produced by terrestrial plants. It is mainly used in papermaking, textiles and construction, and plays an important role in production and life. Wood is secondary xylem, which comes from the vascular cambium. In dicotyledons and gymnosperms, the vascular cambium can promote the thickening of stems and roots, and the proliferation and differentiation of vascular stem cells produce secondary xylem and secondary phloem, which transport water and photosynthetic products respectively, and support the upright growth of plants. my country is not only the world's largest consumer of wood resources, but also the largest importer of wood. In order to respond to the national resource strategy to improve the utilization rate of biological resources, it is urgent to increase wood biomass. Populus tomentosa is one of the most widely planted forestry tree species in my country and an important source of wood supply. Cultivating its fast-growing wood varieties has important application value.

[0003] Wood is the secondary xylem of forest trees. It originates from the secondary development of the tree stem vascular system. The xylem precursor cells generated by the division of the vascular cambium cells undergo a series of processes such as cell differentiation, expansion and elongation, secondary wall deposition, and cell apoptosis, and finally form wood. In this process, the secondary development of stem vascular system is affected by many factors, such as internal factors such as transcription factors and hormones, and external environmental factors such as temperature and light. In recent years, some studies have been reported on the molecular mechanism of stem vascular secondary development, but they are still incomplete. Further exploring the regulatory genes that can increase the growth rate of xylem cells of Populus tomentosa, and regulating the expression level of endogenous genes through molecular biology and genetic techniques to obtain fast-growing wood Populus tomentosa germplasm are currently urgent issues to be solved in this field.

[0004] KNOX family transcription factors have been reported in plant species such as Arabidopsis and rice, and are mainly involved in the regulation of secondary wall synthesis, but their function in vascular development has not yet been resolved. In poplar, it is still unclear whether this family has other biological functions, especially whether it is involved in the regulation of vascular cambium and wood formation. In our previous study, through the systematic identification and analysis of the KNOX family of Populus tomentosa, we found that the family members PtoKNATa / b / c are unique to some woody plants, but not in the model plant Arabidopsis and the crop rice. Among them, PtoKNATa is highly expressed in the stem vascular tissue of poplar, especially in the vascular cambium related to wood formation. However, the role of PtoKNATa in poplar wood development has not been reported. Whether PtoKNATa is involved in the specific regulation of vascular cambium division activity and secondary xylem formation, and its effects on poplar wood yield, wood quality and mechanical properties remain to be explored. Summary of the invention

[0005] In view of this, one of the objects of the present invention is to provide an application of the PtoKNATa gene in regulating the development of poplar xylem and wood formation; a second object of the present invention is to provide a method for constructing and obtaining fast-growing Populus tomentosa germplasm with increased plant height and thickened trunk diameter.

[0006] In order to achieve the above object, the present invention provides the following technical solutions: Application of PtoKNATa gene in regulating xylem development and wood formation in poplar By knocking out the PtoKNATa gene in Populus tomentosa, the division activity of the vascular cambium of the poplar is promoted, and the production rate of xylem cells of Populus tomentosa is increased, thereby obtaining fast-growing Populus tomentosa germplasm with increased plant height and thickened trunk diameter; the amino acid sequence of the PtoKNATa gene is shown in SEQ ID No.1.

[0007] In some embodiments of the present invention, the nucleotide sequence of the PtoKNATa gene is shown as SEQ ID No.2.

[0008] A method for constructing fast-growing Populus tomentosa germplasm with increased plant height and thickened trunk diameter, comprising the following steps: 1) Based on the endogenous PtoKNATa gene sequence of Populus tomentosa, the CRISPR / Cas9 target was designed, and a CRISPR / Cas9 plant vector for mutating the endogenous PtoKNATa gene was constructed to obtain the PtoKNATa-ko knockout vector; 2) Transform Agrobacterium, and introduce the PtoKNATa-ko knockout vector constructed in step 1) into the leaves of wild-type Populus tomentosa by Agrobacterium-mediated leaf disc transformation; 3) Through the process of co-cultivation, selective cultivation, obtaining clustered buds, obtaining rooted transgenic plants and positive plant identification, we finally obtained a fast-growing Populus tomentosa strain with increased plant height and thicker trunk diameter.

[0009] In some embodiments of the present invention, in step 1), the nucleotide sequence of the PtoKNATa gene is shown as SEQ ID No.2.

[0010] In some embodiments of the present invention, in step 1), the target of the CRISPR / Cas9 is a double-stranded sequence shown in SEQ ID No. 3-4, SEQ ID No. 5-6, and SEQ ID No. 7-9.

[0011] In some embodiments of the present invention, in step 1), the CRISPR / Cas9 plant vector is pYLCRISPR / Cas9-DH.

[0012] In some embodiments of the present invention, in step 1), the PtoKNATa-ko knockout vector is obtained by constructing the target sequences shown in SEQ ID No. 3~4, SEQ ID No. 5~6, and SEQ ID No. 7~8 into the BsaI restriction sites of pYLsgRNA-AtU6-1, pYLsgRNA-AtU6-29, and pYLsgRNA-AtU3b vectors, respectively, and then inserting the amplified AtU6-1-T1-gRNA, AtU6-29-T2-gRNA, and AtU3b-T3-gRNA fragments into the BsaI restriction sites of the pYL-CRISPR / Cas9-DH vector in sequence.

[0013] In some embodiments of the present invention, in step 2), the Agrobacterium is GV3101.

[0014] The beneficial effect of the present invention is that the PtoKNATa-ko vector constructed and screened can effectively increase the rate of xylem cell production and the rapid growth of wood in Populus tomentosa after transforming Populus tomentosa plants, providing a method and germplasm basis for the breeding of excellent forest varieties, which is beneficial to increasing the timber yield and economic benefits of economic forests, and also provides materials for creating protective forests and urban and rural greening. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration: Figure 1 The method for constructing the CRISPR / Cas9 knockout vector for PtoKNATa-ko.

[0016] Figure 2To identify the PtoKNATa-ko mutant plants of Populus tomentosa.

[0017] Figure 3 Observation of the growth phenotype of PtoKNATa-ko mutant plants of Populus tomentosa; A. Photos of 3-month-old wild-type and PtoKNATa-ko mutant plants of Populus tomentosa; B. Plant height statistics of wild-type and mutant plants; C. Statistics of the 10th internode diameter of the stem of wild-type and transgenic plants; "**" indicates p<0.01; "***" indicates p<0.001.

[0018] Figure 4 Observation of secondary xylem development phenotype of Populus tomentosa PtoKNATa-ko transgenic strain; A. Transverse section imaging of vascular cambium (internode 8); B. Transverse section imaging of xylem (internode 8); C. Statistic of cell layers in vascular cambium; D. Statistic of cell layers in xylem; “**” indicates p<0.01; “***” indicates p<0.001. DETAILED DESCRIPTION

[0019] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0020] Example 1: Cloning of Populus tomentosa PtoKNATa gene Through the homology of the amino acid sequence of the KNOX domain, the amino acid sequence (as shown in SEQ ID No.1) and the CDS sequence (as shown in SEQ ID No.2) of the PtoKNATa (Populus_tomentosa65580) transcription factor were identified in the genome of Populus tomentosa.

[0021] Example 2, knockout and identification of PtoKNATa gene 1. Preparation of target adapter primers The gene knockout vector used in this study was pYLCRISPR / Cas9-DH. Adapter preparation: As shown in the PtoKNATa gene sequence of Populus tomentosa (SEQ ID No. 2), primers that can specifically knock out the PtoKNATa target were designed using the relevant knockout target design website to add adapters, and primers were synthesized by Shenzhen BGI. The specific primer sequences are as follows: T1-F: 5'-GTCACAATTTCTTGTTCACCAAA-3' (SEQ ID No. 3); T1-R: 5'- AAACTTTGGTGAACAAGAAATTG -3' (SEQ ID No. 4); T2-F:5'-ATTGAAATGGTTTTCTCTTGA-3' (SEQ ID No. 5); T2-R: 5'-AAACTCAAGAAGAGAAAACCATTT-3' (SEQ ID No. 6); T3-F: 5'-ATTGACCTAGTTTCTGCATACGT -3' (SEQ ID No. 7); T3-R: 5'-AAACACGTATGCAGAAACTAGGT-3' (SEQ ID No. 8); The concentration of the target adapter primer was diluted to 1 μM and annealed by PCR reaction. The reaction system is shown in Table 1: Table 1. PCR system Reagent Amount T1 / T2 / T3-F 5 μL T1 / T2 / T3-R 5 μL ddH2O 10 μL 2. Construction of sgRNA expression cassette First cleavage and ligation method: Use BsaI restriction endonuclease and T4 DNA ligase to connect the target to the BsaI restriction site of the small vector containing the gRNA expression cassette as shown in Figure 1 through a variable temperature cycler (or PCR instrument). The construction process adopts the Golden Gate cloning (Engler et al., 2008; 2009) strategy. The T1 target annealing product is connected to pYLsgRNA-AtU6-1 to obtain pYLsgRNA-AtU6-1-T1, the T2 target annealing product is connected to pYLsgRNA-AtU6-29 to obtain pYLsgRNA-AtU6-29-T2, and the T3 target annealing product is connected to pYLsgRNA-AtU3b to obtain pYLsgRNA-AtU3b-T3. The reaction system is shown in Table 2, and the reaction conditions are: 37℃ 5 min, 20℃ 5 min, and 5 cycles of reaction.

[0022] Table 2. PCR system Reagent Amount Annealing product 1 μL pYLgRNA-AtU6-1 / AtU6-29 / AtU3b Plasmid 1μL BnS 1 μL T4 ligase 1 μL Cutsmart buffer 1μL T4 buffer 1 μL ddH2O 4μL First round of PCR amplification: Take the above ligation product as a template and use the universal primer UF / gRNA-R to perform PCR amplification on the gRNA expression cassette containing the PtoKNATa specific target. The amplification system is shown in Table 3. The sequence of the primer UF / gRNA-R pair is as follows: Primer UF: 5′-CTCCGTTTTACCTGTGGAATCG-3′ (SEQ ID No. 9); Primer gRNA-R: 5′-CGGAGGAAAATTCCATCCAC-3′ (SEQ ID No. 10); Reaction procedure: 98°C 1 min 10 cycles, 98°C pre-denaturation 15 s, 55°C annealing 15 s, 68°C extension 10 s, 17-20 cycles: 94°C pre-denaturation 15 s, 60°C annealing 15 s, 68°C extension 10 s. After the reaction, 3 μL was taken for electrophoresis inspection to obtain the product AtU6-1-T1-gRNA, AtU6-29-T2-gRNA, and AtU3b-T3-gRNA fragments.

[0023] Table 3. PCR system Reagent Amount Connect products 1 μL UF 0.25 μL gRNA-R 0.25 μL Primerstar 5 μL ddH2O 3.5 μL 3. Assemble sgRNA expression cassette into pYLCRISPR / Cas9-DH vector Second round of PCR amplification: Select the PCR product in step 2 as the template and use primers with adapters.

[0024] The second round of PCR amplification, the amplification system is shown in Table 4. Reaction procedure: 98℃ pre-denaturation for 3min; 98℃ denaturation for 10s, 60℃ extension for 15s, 68℃ post-extension for 30s (35 cycles); 16℃ storage. Further, the successfully amplified PCR products were subjected to gel electrophoresis and gel recovery. The sequence of primer pair B1' / B2' / B3'-F / B2 / B3 / BL-R is as follows: B1'-F: 5'-TTCAGAggtctcTctcgACTAGTGGAATCGGCAGCAAAGG-3' (SEQ ID No. 11); B2-R: 5'-AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCTC-3' (SEQ ID No. 12); B2'-F: 5'-TTCAGAggtctcTctgaCACTGGAATCGGCAGCAAAGG-3' (SEQ IDNo. ​​13); B3-R: 5'-AGCGTGggtctcGtcttGGTCCATCCACTCCAAGCTC-3' (SEQ ID NO. 14); B3'-F: 5'-TTCAGAggtctcTaagaCACTGGAATCGGCAGCAAAGG-3' (SEQ IDNo. ​​15); BL-R: 5'-AGCGTGggtctcGaccgACGCGTCCATCCACTCCAAGCTC-3' (SEQ ID No. 16).

[0025] Table 4. PCR system Reagent Amount PCR products 0.2 μL B1' / B2' / B3'-F 0.25 μL B2 / B3 / BL-R 0.25 μL Primerstar 5 μL ddH2O 4.3 μL Second cutting and ligation: Select the above gel recovery products and pYLCRISPR / Cas9-DH, use BsaI restriction endonuclease and T4 DNA ligase, and connect the sgRNA expression cassette containing the PtoKNATa target site to the pYLCRISPR / Cas9-DH expression vector through a variable temperature cycler (or PCR instrument) (see Ma, XL et al. A robust CRISPR / Cas9system for convenient, high-efficiency multiplex genome editing in monocotand dicot plants. Mol Plant 24, pii: S1674-2052 (15) 00204-X (2015).). After identification, the recombinant vector was obtained and named PtoKNATa-ko ( Figure 1 ).

[0026] Example 3: Agrobacterium tumefaciens-mediated genetic transformation of Populus tomentosa with PtoKNATa-ko The material used for poplar genetic transformation in this study was wild-type Populus tomentosa, and the Agrobacterium-mediated leaf disc infection method was used for Populus tomentosa genetic transformation.

[0027] 1) Pseudomonas aeruginosa transformation The above PtoKNATa-ko was introduced into the Agrobacterium GV3101 strain by heat shock method (37°C, 5 min + liquid nitrogen, 2 min; repeated three times), and the transformation positive clones were screened by Kan resistance; and the Agrobacterium GV3101 colonies containing the recombinant plasmid were identified by colony PCR method. The strain was preserved.

[0028] 2) Cultivation of Agrobacterium The Agrobacterium GV3101 strain containing the recombinant plasmid was streaked on YEP solid medium (containing 20 mg / ml Rif and 50 mg / ml Kan) and inverted at 28°C for culture; a single clone was selected and inoculated into YEP liquid medium containing the corresponding antibiotics and cultured at 28°C with shaking until the logarithmic growth OD600 was 0.6-0.8; then the activated Agrobacterium was inoculated into the same 50 ml YEP liquid medium at a ratio of 1:100~1:50 and cultured at 28°C until the OD 600The pH value is 0.6-0.8. Add the diactive Agrobacterium culture liquid into a 50ml centrifuge tube. Centrifuge at 4°C, 4000rpm for 10min. Collect the bacterial precipitate. Add 10ml WPM resuspension (WPM powder + 2.14g + 30g sucrose + 100μmol AS). Mix well with a pipette. Add 20-30ml WPM resuspension. Transfer into a round-mouth bottle and culture at 28°C, 200rpm for 40min-1h.

[0029] 3) Agrobacterium-mediated leaf disc infection Take the sterile leaves of the tissue culture seedlings and cut them into 0.5×0.5 cm pieces on the clean bench. 2 Place leaf discs of different sizes into the resuspended Agrobacterium solution and infect for 10 minutes. Gently shake the solution every 2 to 3 minutes to ensure that the leaf discs are fully infected.

[0030] 4) Co-cultivation of Populus tomentosa Pick out the infected leaf disc with sterilized tweezers, place it on sterilized filter paper, absorb the bacterial solution, spread the leaf disc flat on WPM co-cultivation medium (WPM powder + 2.14 g + 30 g sucrose + 100 μmol AS + 1.0 mg NAA + 2.0 mg ZT), and culture it in the dark at 25°C for 2 days.

[0031] 5) Selective cultivation of Populus tomentosa After 2 days of co-cultivation, the transformed explants were transferred to a selective medium for inducing callus (WPM powder + 2.14 g + 30 g sucrose + 9 mg Hyg + 1.0 mg NAA + 2.0 mg ZT + 400 mg Cef) and cultured at 25°C in the dark for 3 to 5 weeks, during which time the selective medium was replaced every 5 days.

[0032] 6) Populus tomentosa induced bud culture When white loose callus tissue appears around the leaf margin, move the callus tissue to WPM budding medium (WPM powder + 2.14 g + 30 g sucrose + 9 mg Hyg + 0.1 mg NAA + 2.0 mg ZT + 400 mg Cef) on the clean bench and culture at 25°C under light for about 4 to 5 weeks, replacing new WPM budding medium every 10 days.

[0033] 7) Rooting culture of Populus tomentosa When the adventitious buds grew to about 5 cm, they were transferred to WPM rooting medium (WPM + 30 g sucrose + 9 mg Hyg + 0.1 mg NAA + 400 mg Cef) containing corresponding antibiotics to induce rooting.

[0034] 8) Transplantation of Populus tomentosa When the root system of the seedlings is relatively developed, take out the seedlings, rinse off the agar on the roots, transplant them into the greenhouse for cultivation, and cover them with plastic wrap to keep warm and moist. Remove the film after one week of growth.

[0035] YEP medium: 10 g yeast extract, 10 g peptone, 5 g NaCl, pH 7.0, sterilized at 121°C for 20 minutes. For solid medium, add 10-12 g agar powder before sterilization.

[0036] LB medium: 5 g yeast extract, 10 g peptone, 10 g NaCl, pH = 7.0, sterilized at 121 °C for 20 min. For solid medium, add 10-12 g agar powder before sterilization.

[0037] Example 4: Screening and identification of mutant Populus tomentosa strains with PtoKNATa gene knockout 1. Identification of PtoKNATa-ko transgenic positive plants The transgenic plants obtained after tissue culture need to extract the genomic DNA of each plant for positive identification to confirm whether the vector has been successfully transferred into the poplar plant.

[0038] The CTAB method for extracting poplar genomic DNA is as follows: 1) Take a 10 mL centrifuge tube, add 3 mL CTAB and 90 μL β-mercaptoethanol, and preheat in a 65°C water bath; 2) Take about 0.6 g of fresh leaves of Populus tomentosa, grind them into powder in liquid nitrogen, transfer them into the above CTAB extract, and vortex to mix, or place the leaves in a 2 mL centrifuge tube, add CTAB extract and small steel balls (3 pieces), and then crush them with a tissue disruptor; 3) Preheat in a 65°C water bath for 45 min, shaking (vigorously) three times to mix; 4) After the time is up, take it out and cool it for 5 minutes, then centrifuge it at 12000 rpm for 10 minutes; 5) Carefully pipette the supernatant into another clean 1.5 mL centrifuge tube, let stand at room temperature for 5 min, then add an equal volume of chloroform:isoform alcohol (24:1), invert vigorously to mix, then place flat to emulsify for 10 min, then centrifuge at 18°C, 12,000 rpm for 10 min; 6) Repeat step 5 once to better remove the protein; 7) Pipette the supernatant into another clean 10 mL centrifuge tube, add an equal volume of -20°C pre-cooled isopropanol, invert and mix until a white flocculent precipitate is visible, and centrifuge at 12,000 rpm for 10 min; 8) Rinse twice with 500 μL 75% (V / V) ethanol, rinse once with 500 μL anhydrous ethanol, drain the ethanol with a pipette, and dry the precipitate in a 37°C oven until transparent; 9) Dissolve the precipitate with 50-100 μL of sterile water containing RNaseA to obtain the genomic DNA of Populus tomentosa.

[0039] Next, the genomic DNA of each strain was used as a template, the wild type was used as a control, and UF and gRNA-R were used as primers to PCR amplify the specific fragment of the recombinant plasmid. The amplified product was detected by agarose gel electrophoresis to observe the presence or absence of the corresponding position band. The results showed that multiple regenerated strains contained the exogenously introduced target gene fragment, proving that the PtoKNATa-ko transgenic Populus tomentosa strain was successfully obtained through genetic transformation.

[0040] Primer UF: 5'-CTCCGTTTTACCTGTGGAATCG-3' (SEQ ID NO. 9) Primer gRNA-R: 5'-CGGAGGAAAATTCCATCCAC-3' (SEQ ID NO.10) 2. Identification of PtoKNATa gene knockout mutant strains In order to identify mutant strains with PtoKNATa gene knockout, we plan to amplify the endogenous PtoKNATa gene sequence from the transgenic positive strains by quantitative PCR, clone it into the T vector and sequence it. The sequencing results will be compared with the gene sequence from the wild type to find the editing of the PtoKNATa gene sequence by Cas9 and analyze whether the sequence change leads to the loss of endogenous PtoKNATa gene function ( Figure 2 ).

[0041] The primers for amplifying endogenous genes are as follows: Upstream primer F- PtoKNATa: 5′-ATGGAGGGATTTTATAGGT-3′ (SEQ ID No. 17); Downstream primer R-PtoKNATa: 5′-TCATGTCCCGATGTCATCACC-3′ (SEQ ID No. 18).

[0042] Case study 5: Analysis of wood development regulation function of the Populus tomentosa PtoKNATa-ko mutant line In order to explore the regulation of the PtoKNATa-ko mutation on the secondary vascular development of poplars, two strains (L1 and L2) with endogenous PtoKNATa gene function loss obtained in Example 4 above were selected for subsequent experiments. In order to clarify the function of PtoKNATa in the secondary development of stem vascular, the selected mutant plants were cultured for about 3 months and then sectioned. The development of the plant cambium and xylem was observed after staining with toluidine blue dye, and the relevant indicators were analyzed using Image J software. The results are shown in Figure 2. Figure 3 and Figure 4 shown.

[0043] The present invention finds the KNOX family transcription factor PtoKNATa which is highly expressed in the stem vascular tissue from Populus tomentosa, and uses a genetic engineering method to construct a CRISPR / Cas9 knockout vector (PtoKNATa-ko, Figure 1 ). By genetically transforming Populus tomentosa and screening for transgenic knockout strains. Through sequencing and identification, two Populus tomentosa mutant strains with knockout endogenous PtoKNATa gene function, PtoKNATa-ko-L1 and PtoKNATa-ko-L2, were obtained ( Figure 2 ). Further analysis of the wood development of the overexpression strains showed that the plant height of the three-month-old PtoKNATa-ko mutant white poplar strain increased by 16.3% and 17.5% compared with the wild type ( Figure 3 , B), the stem diameters increased by 10.8% and 17.6% (at the 10th internode, Figure 3 , C); the differences were highly significant (p<0.01). The anatomical analysis of the stems revealed that the cambium division activity of the PtoKNATa-ko mutant was significantly increased: the number of cambium cell layers in PtoKNATa-ko-L1 and PtoKNATa-ko-L2 plants increased by 25.5% and 14.7%, respectively, compared with the wild type ( Figure 4 , A and C); At the same time, the number of xylem cell layers in the PtoKNATa mutant white poplar was significantly increased compared with that in the wild-type plants, increasing by 10.2% and 5.5%, respectively ( Figure 4 , B and D). Using CRISPR / Cas9 technology, a mutant strain of Populus tomentosa with a functional loss of the endogenous PtoKNATa gene was obtained, producing poplar germplasm that promotes wood formation, providing excellent raw materials for industrial production such as paper production.

[0044] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. Application of the PtoKNATa gene in regulating the xylem development and wood formation of poplars, characterized in that: By knocking out the PtoKNATa gene in Populus tomentosa, the division activity of the vascular cambium of the poplar is promoted, and the production rate of xylem cells of Populus tomentosa is increased, thereby obtaining fast-growing Populus tomentosa germplasm with increased plant height and thickened trunk diameter; the amino acid sequence of the PtoKNATa gene is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the PtoKNATa gene is shown in SEQ ID No.

2.

3. A method for constructing fast-growing Populus tomentosa germplasm with increased plant height and trunk diameter, characterized in that: The steps include: 1) Based on the endogenous PtoKNATa gene sequence of Populus tomentosa, the CRISPR / Cas9 target was designed, and a CRISPR / Cas9 plant vector for mutating the endogenous PtoKNATa gene was constructed to obtain the PtoKNATa-ko knockout vector; 2) Transform Agrobacterium, and introduce the PtoKNATa-ko knockout vector constructed in step 1) into the leaves of wild-type Populus tomentosa by Agrobacterium-mediated leaf disc transformation; 3) Through the process of co-cultivation, selective cultivation, obtaining clustered buds, obtaining rooted transgenic plants and positive plant identification, we finally obtained a fast-growing Populus tomentosa strain with increased plant height and thicker trunk diameter.

4. The method according to claim 3, characterized in that: In step 1), the nucleotide sequence of the PtoKNATa gene is shown as SEQ ID No.

2.

5. The method according to claim 3, characterized in that: In step 1), the target of the CRISPR / Cas9 is the double-stranded sequence shown in SEQ ID No.3~4, SEQ ID No.5~6, and SEQ ID No.7~9.

6. The method according to claim 3, characterized in that: In step 1), the CRISPR / Cas9 plant vector is pYLCRISPR / Cas9-DH.

7. The method according to claim 3, characterized in that: In step 1), the PtoKNATa-ko knockout vector is obtained by constructing the target sequences shown in SEQ ID No.3~4, SEQ ID No.5~6, and SEQ ID No.7~8 into the BsaI restriction sites of pYLsgRNA-AtU6-1, pYLsgRNA-AtU6-29, and pYLsgRNA-AtU3b vectors, respectively, and then inserting the amplified AtU6-1-T1-gRNA, AtU6-29-T2-gRNA, and AtU3b-T3-gRNA fragments into the BsaI restriction sites of the pYL-CRISPR / Cas9-DH vector in sequence.

8. The method according to claim 3, characterized in that: In step 2), the Agrobacterium is GV3101.

Images