Preparation method and application of Japanese encephalitis virus and porcine parvovirus bivalent virus-like particle vaccine

Abstract

The invention relates to the technical field of vaccine preparation, in particular to a preparation method and application of a Japanese encephalitis virus and porcine parvovirus bivalent virus-like particle vaccine. The invention provides a fusion protein of Japanese encephalitis virus and porcine parvovirus. The amino acid sequence of the fusion protein is shown as SEQ ID NO. 1. The fusion protein is obtained through baculovirus system expression, and the EMP-VP2 recombinant fusion protein has good immunoreactivity, can be specifically recognized by an anti-His monoclonal antibody and positive serum of JEV and PPV, also has good immunoreaction to mice and guinea pigs, and can be used for preparing the recombinant EMP-VP2 fusion protein. And JEV and PPV specific humoral immune responses can be activated in mice and guinea pigs respectively. And a solid foundation is laid for prevention and control of JEV and PPV and research and development of bivalent subunit vaccines.

Description

Technical Field

[0001] The present invention relates to the technical field of vaccine preparation, and in particular to a preparation method and application of a Japanese encephalitis virus and porcine parvovirus dual virus-like particle vaccine. Background Art

[0002] Japanese encephalitis (JE) is a mosquito-borne zoonotic infectious disease caused by Japanese encephalitis virus (JEV). Piglets infected with JEV often suffer from encephalitis or even death, sows infected with JEV often show abortion and stillbirth, and boars have unilateral testicular enlargement, causing reproductive disorders, causing losses to the pig industry and threatening human public health. JEV belongs to the Flaviviridae family and the Flavivirus genus. It is an enveloped single-stranded positive-sense RNA virus with a genome length of about 11 kb and only one large open reading frame. It encodes three structural proteins (C, M and E) and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5). The envelope protein (E) is an essential protein that covers the virus particles and is responsible for binding to the host cell receptor and fusing with the host plasma membrane. It is considered to be the most important immunogen and the main protein recognized by virus neutralizing antibodies.

[0003] Porcine parvovirus infection (PPI) is a viral disease caused by porcine parvovirus (PPV). The disease is prevalent worldwide. PPV mainly infects the reproductive organs of pigs and can also cause reproductive disorders in pigs. PPV belongs to the genus Parvovirus and is an icosahedral non-enveloped virus with a diameter of about 25 nm. Its genome is a single-stranded (ss) DNA of about 4 to 6 kb in size, containing two open reading frames (ORFs), encoding two structural proteins VP1 and VP2 and two non-structural proteins NS1 and NS2. The capsid of PPV is a simple symmetrical icosahedron composed of 60 copies of two structural proteins VP1 (5 to 6 copies) and VP2 (54 to 55 copies), with a highly conserved core.

[0004] Virus-like particles (VLPs) are virus-like supramolecular structures self-assembled from the structural proteins of one or more viruses. VLP vaccines have many advantages over whole virus and subunit vaccines. Structurally, VLPs are similar to infectious viruses and have high immunogenicity. In addition, due to the lack of viral nucleic acid, VLPs are non-infectious and very safe. In addition, since VLP immunization does not induce the body to produce antibodies against central or non-structural proteins, this difference between immunized bodies and naturally infected bodies makes VLPs promising as marker vaccines. Studies have shown that there are multiple B cell and T cell epitopes on the E protein of JEV, which is suitable for the development of epitope vaccines. At the same time, the VP2 protein of PPV can also self-assemble into virus-like particles in vitro, which can be used to develop VLP vaccines. In clinical practice, JEV and PPV often suffer from mixed infections, which further aggravates the disease. Therefore, there is an urgent need for a vaccine that can safely and efficiently immunize JEV and PPV at the same time to create better conditions for the prevention and control of JEV and PPV. Summary of the invention

[0005] The purpose of the present invention is to provide a method for preparing a Japanese encephalitis virus and porcine parvovirus bivalent virus-like particle vaccine and its application.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a fusion protein of Japanese encephalitis virus and porcine parvovirus, and the amino acid sequence of the fusion protein is shown in SEQ ID NO.1.

[0008] Preferably, the nucleotide sequence encoding the fusion protein is shown as SEQ ID NO.2.

[0009] Preferably, the primer pair for amplifying the nucleotide sequence is shown as SEQ ID NO.3-4.

[0010] The present invention also provides a method for preparing the fusion protein, comprising the following steps:

[0011] (1) Connecting the nucleotide sequence encoding the fusion protein to the pFastBac Dual vector to construct pFastBacDual-E MP -VP2 recombinant baculovirus expression plasmid;

[0012] (2) The pFastBac Dual-E MP -VP2 recombinant baculovirus expression plasmid was transformed into Escherichia coli, blue-white screening was performed, and positive white colonies were selected for purification and identification to obtain recombinant Bacmid-E MP -VP2 bacmid;

[0013] (3) The recombinant Bacmid-E MP -VP2 bacmid DNA was transfected into insect Sf9 cells until the cells showed pathological changes, and the supernatant was harvested by centrifugation to obtain the recombinant baculovirus rBacmid-E MP -F0 generation virus of VP2;

[0014] (4) continuously expanding and culturing the F0 generation virus to F1 to F3 generations;

[0015] (5) inoculating F1-F3 viruses into insect Sf9 cells, culturing for 70-74 hours, centrifuging, and collecting the precipitate; resuspending the precipitate in a lysis solution, ultrasonically lysing, centrifuging, and collecting the supernatant to obtain crude protein;

[0016] (6) purifying the crude protein by affinity chromatography, collecting the target protein eluted by imidazole eluent, and obtaining a fusion protein;

[0017] The nucleotide sequence encoding the fusion protein is shown in SEQ ID NO.2.

[0018] The present invention also provides a biological material related to the fusion protein, wherein the biological material is any one of the following:

[0019] (a) a nucleic acid molecule encoding the fusion protein;

[0020] (b) an expression cassette comprising the nucleic acid molecule described in (a);

[0021] (c) a recombinant expression vector comprising the nucleic acid molecule in (a) or the expression cassette in (b) and an empty vector; the empty vector is pFastBac Dual;

[0022] (d) a recombinant bacterium, comprising the nucleic acid molecule in (a), the expression cassette in (b) or the recombinant expression vector in (c) and a host bacterium; the host bacterium is Escherichia coli DH10Bac;

[0023] (e) A recombinant cell comprising the nucleic acid molecule in (a), the expression cassette in (b) or the recombinant expression vector in (c) and a host cell.

[0024] The present invention also provides the use of the fusion protein in preparing Japanese encephalitis virus and porcine parvovirus bivalent virus particles or bivalent vaccines.

[0025] The present invention also provides the use of the biological material in preparing Japanese encephalitis virus and porcine parvovirus bivalent virus particles or bivalent vaccines.

[0026] The present invention also provides a Japanese encephalitis virus and porcine parvovirus bivalent virus particle, wherein the Japanese encephalitis virus and porcine parvovirus bivalent virus particle is obtained by self-assembling the fusion protein;

[0027] The fusion protein is the fusion protein or the fusion protein prepared according to the preparation method.

[0028] The present invention also provides a Japanese encephalitis virus and porcine parvovirus combined vaccine, wherein the fusion protein is self-assembled to obtain virus-like particles; the virus-like particles are purified by sucrose solution to obtain the Japanese encephalitis virus and porcine parvovirus combined vaccine;

[0029] The fusion protein is the fusion protein or the fusion protein prepared according to the preparation method.

[0030] Preferably, the initial concentration of the sucrose solution is 10-50 wt %.

[0031] The present invention provides a method for preparing a dual virus-like particle vaccine of Japanese encephalitis virus and porcine parvovirus and its application. The amino acid sequence of the fusion protein of the present invention is shown in SEQ ID NO.1. The fusion protein of the present invention is obtained by expressing the baculovirus system. MP -VP2 recombinant fusion protein, which has good immunoreactivity and can be specifically recognized by anti-His monoclonal antibodies and positive sera of JEV and PPV, and also has good immune response to mice and guinea pigs, and can activate JEV and PPV specific humoral immune response in mice and guinea pigs respectively. MP -VP2 fusion protein has excellent immunogenicity in mice and guinea pigs, laying a solid foundation for the subsequent prevention and control of JEV and PPV and the development of bivalent subunit vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Recombinant plasmid pUC57-E MP - VP2 map;

[0033] Figure 2 For E MP -Gel electrophoresis of VP2 gene amplification (M represents Marker, lane 1 represents the amplification result of the target gene);

[0034] Figure 3 Screening flat panel models for blue-white patches;

[0035] Figure 4 Gel electrophoresis diagram for PCR identification of Bacmid plasmid (A indicates E MP -VP2 specific primer pair amplification results, B represents the pUC / M13 universal primer pair amplification results);

[0036] Figure 5 Comparison of Sf9 cell pathological changes before and after transfection (400×) (A is Sf9 cells not transfected with recombinant Bacmid plasmid, B is Sf9 cells transfected with Bacmid plasmid);

[0037] Figure 6 Identification of E by IFA MP -The expression result of VP2 fusion protein in Sf9 cells;

[0038] Figure 7 Western Blot analysis of E MP -The expression of VP2 fusion protein in Sf9 cells and the immunoreactivity of the protein (A is incubated with anti-His as the primary antibody, B is incubated with JEV positive serum as the primary antibody, and C is incubated with PPV positive serum as the primary antibody);

[0039] Figure 8 For E MP -Results of purification of VP2 fusion protein;

[0040] Fig. 9 For E MP -Electron microscopy analysis results of VP2 virus-like particles;

[0041] Fig.10 For E MP -Results of the titer of JEV-specific antibodies in mouse serum after immunization of mice with VP2;

[0042] Fig.11 For E MP -The results of the determination of the titer of JEV neutralizing antibodies in mouse serum after immunization of mice with VP2;

[0043] Fig.12 For E MP - Results of the determination of JEV-specific antibody titers in guinea pig serum after VP2 immunization of guinea pigs;

[0044] Fig.13 For E MP -Results of determination of HI antibody titer of PPV in guinea pig serum after guinea pigs were immunized with VP2. DETAILED DESCRIPTION

[0045] In the present invention, the amino acid sequence of the fusion protein of Japanese encephalitis virus and porcine parvovirus is shown in SEQ ID NO.1, SEQ ID NO.1: MDKLALKGTTYGMCTEKFSFAKNPADTGHGTVVIELTYSGSDGPCKIPIVSVASLNDMTPVGRLVTVNPFVATSSSNSKVLVEMEPPFGDSYIVVGRGDKQINHHWHKAGSTCYHASVTDIGPGPGSIGKAVHQVFGPGPGMSENVEQHNPINAGTALSATGNESGGGGGGGGGRGAGGVGVSTGSFNNQTEFQYLGEGLVRITTHASRLIHLNMPEHETYKRIHVLNSESGVAGQMVQDDAHTQMVTPWSLIDANAWGVWFNPADWQLISNNMTEINLVSFEQEIFNVVLKTITKSATSPPTKLYNNDLTASLMVALDTNNTLPYTPAAPRSETLGFYPWLPTKPTQYRYYLSCIRNLNPPTYTGQSQQITDSGPGPGENHGNYSGPGPGKFSFAKNPADGPGPGTYSGSDGGPGPGGRGDKQINHHWHKAGPGPGMFYTIENAVPIHLLRTGDEFSTGIYHFDTKPLKLTHSWQTNRSLGLPPKLLTEPTTEGDQYPGTLPAANTRKGYHQTTNNSYTEATAIRPAQVGYNTPYMNFEYSNGGPFLTPIVPTADTQYNDDEPNGAIRFTMGYQHGHLTTSSQEVERYTFNPQSKCGRAPNQQFNQQAPLNLENTNNGTLLPSDPIGGKANMHFMNTLNTYGPLTALNNTAPVFPNGQIWDKELDTDLKPRLHVTAPFVCKNNPPGQLFVKIAPNLTDDFNADSPQQPRIITYSNFWWKGTLTFTAKMRSSNMWNPIRQHTTTAENIGNYIPTNIGGMKMFPEHSQLIPRKLY。

[0046]

[0047] In the present invention, the primer pair for amplifying the nucleotide sequence shown in SEQ ID NO.2 is shown in SEQ ID NO.3-4; SEQ ID NO.3 is the upstream primer pFast-E MP -VP2-F, sequence: GCGCGGAATTCATGTGCTACCACGCTTCTGT; SEQ ID NO.4 is the downstream primer pFast-E MP -VP2-R, the sequence is: AGGCTCTAGACTAATGATGATGATGATGATGGTACAGCTTACGG.

[0048] In the present invention, the specific amplification system for amplifying the nucleotide sequence shown in SEQ ID NO.2 is 2×Phanta PCRMasterMix 25μL, pFast-E MP -VP2-F 2μL, pFast-E MP -VP2-R 2μL, plasmid 2μL, ddH2O to 50μL; the plasmid is pUC57-E MP -VP2 plasmid; pUC57-E MP -VP2 plasmid was synthesized by Shanghai Huajin Biotechnology Co., Ltd.:

[0049] In the present invention, the reaction procedure for amplifying the nucleotide sequence shown in SEQ ID NO.2 is: 98°C for 5 min; 98°C for 30 s, 58°C for 30 s, 72°C for 2 min, 35 cycles; 72°C for 10 min, 4°C∞.

[0050] The solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be understood as limiting the protection scope of the present invention.

[0051] The Escherichia coli DH10Bac described in the examples of the present invention was purchased from Nanjing Fanbang Biotechnology Co., Ltd.

[0052] Example 1

[0053] Analysis and Gene Synthesis of Antigenic Epitopes of Japanese Encephalitis Virus (JEV) and Porcine Parvovirus (PPV)

[0054] Using the Japanese encephalitis virus E protein sequence in the GenBank database (accession number: MH753127.1), the hydrophilic region, transmembrane domain, signal peptide and major antigenic region of the gene were analyzed by DNAStar software to predict the key antigenic epitopes of the E protein. Based on the analysis results, the major antigenic epitope region of the E protein was determined. According to the prediction results of the major antigenic epitope region, four dominant B cell epitopes, one CTL antigen epitope and one Th antigen epitope on the Japanese encephalitis virus envelope E protein were selected. They were concatenated and connected to the 5' end of the PPV encoding VP2 protein gene (accession number: FJ822038.1). The restriction sites EcoR I and Xba I were added to the 5' and 3' ends respectively. Since the multi-epitope protein needs to be expressed in the baculovirus system, the baculovirus preferred codons were selected to optimize the gene, while the amino acid sequence was not changed. It was sent to Shanghai Huajin Biotechnology Co., Ltd. for synthesis and inserted into the pUC57 vector to obtain the recombinant plasmid carrying the JEV and PPV genes, namely pUC57-E. MP -VP2 (sequence as described in SEQ ID NO.5, Figure 1

[0055] Example 2

[0056] Construction of recombinant baculovirus expression plasmid

[0057] According to the recombinant plasmid pUC57-E MP -VP2 gene sequence and pFastBac Dual vector were used to design PCR primers (Table 1), and six consecutive histidine tags (6×His) were added to the 3′ end by the homology arm method to provide a way for affinity chromatography purification using tags in the later stage.

[0058] Table 1 PCR primer pairs

[0059]

[0060] The primer pairs in Table 1 were used to cleave the recombinant plasmid pUC57-E MP -VP2 was amplified, and the obtained target fragment was named E MP -VP2 gene (SEQ ID NO. 2). MP -VP2 gene encodes E MP The amino acid sequence of the -VP2 fusion protein is shown in SEQ ID NO.1.

[0061] The specific amplification system is as follows: 2×Phanta PCR Master Mix 25μL, pFast-EMP-VP2-F2μL, pFast-E MP -VP2-R 2μL, pUC57-E MP -VP22μL, ddH2O to 50μL

[0062] The specific reaction procedure was as follows: 98°C for 5 min; 98°C for 30 s, 58°C for 30 s, 72°C for 2 min, 35 cycles; 72°C for 10 min, 4°C∞.

[0063] After PCR amplification, 1% agarose gel electrophoresis was performed, and the results were as follows: Figure 2 As shown, the target fragments were recovered by gel extraction using EZNA Gel Extraction Kit and the concentrations were determined.

[0064] The pFastBac Dual vector was double-digested with EcoRI and XbaI at 37°C in a water bath for 2 h. After digestion, gel run verification and gel recovery were performed as described above.

[0065] The pFastBac Dual empty vector after restriction digestion was combined with the E MP-VP2 gene fragments were connected. After transformation into DH5α competent cells, single colonies were picked for sequencing analysis. The sequencing results showed that the E MP -The insertion of VP2 gene was correct without any mutation or error. The plasmid with correct sequencing was named pFastBacDual-E MP -VP2, the recombinant baculovirus expression plasmid, was stored in a -20°C refrigerator for subsequent experiments.

[0066] Example 3

[0067] Construction of Recombinant Shuttle Plasmid Bacmid

[0068] pFastBac Dual-E MP -VP2 plasmid was transformed into DH10Bac E. coli competent cells, and the transformation product was evenly spread on the blue-white screening plate, placed in a 37°C constant temperature incubator away from light, and cultured for 24 hours. Blue and white colonies will grow on the blue-white plate.

[0069] Screening was performed using the blue-white method ( Figure 3 ). Pick the white colonies on the plate, and use the universal primers upstream and downstream of the transposition site of the Bacmid (Table 2) and the specific primers of the target gene in Table 1 to perform colony PCR identification on the white colonies to identify positive clones.

[0070] If the positive clone is impure, the white colony needs to be expanded and purified. Select the appropriate colony and add it to 5mL LB medium containing Kan, gentamicin and tetracycline, shake it in a constant temperature shaker at 37℃ and 220rpm for 18h, use an inoculation loop to dip the bacterial solution, streak it on a blue-white screening plate for purification, and place it in a constant temperature incubator at 37℃ away from light for 18h. Perform PCR identification according to the above method.

[0071] After streaking purification twice in this way, the successfully purified white colonies were inoculated into 5 mL LB medium containing Kan, gentamicin and tetracycline, and shaken in a constant temperature shaker at 37°C and 220 rpm for 18 h.

[0072] Table 2 PCR primer sequences

[0073] Primer name Primer sequence (5'-3') Sequence number pUC / M13-F CAGTCACGACGTTGTAAA SEQ ID NO.6 pUC / M13-R CGGATAACAATTTCACACA SEQ ID NO.7

[0074] Use E MP - VP2 specific primers were used for PCR, and the results of agarose gel electrophoresis were as follows Figure 4 -A, an obvious target band appeared at 1770 bp, indicating that E MP -VP2 gene was successfully inserted; PCR was performed using pUC / M13 universal primers, and the agarose gel electrophoresis results were as follows Figure 4 -B, Bacmid-E MP -VP2 successfully amplified the expected 4050bp (1770bp+2280bp) band. These results were consistent with the expected target, thus confirming the recombinant Bacmid-E MP -Successful construction of VP2 bacmid (recombinant shuttle plasmid Bacmid).

[0075] Example 4

[0076] Rescue of recombinant baculovirus

[0077] Select insect Sf9 cells with good growth status, and evenly spread them in a six-well plate when the cells are passaged. Add 2 mL Sf-900 to each well. TM II SFM insect cell culture medium. Place in a 28°C low-temperature cell culture incubator, and start the transfection experiment after the cells adhere to the wall.

[0078] Dilute CellfectinR II Reagent in Grace insect medium without serum, add 6 μL of CellfectinR II Reagent transfection reagent to 100 μL of Grace insect medium without serum, vortex to mix, and place the mixed mixture at room temperature for 30 minutes.

[0079] 2 μg of Bacmid-E MP -VP2 bacmid DNA was diluted in 100 μL serum-free Grace insect medium and mixed gently.

[0080] The diluted Bacmid-E MP -VP2 bacmid DNA was gently mixed with diluted CellfectinR II Reagent transfection reagent and incubated at room temperature for 30 min.

[0081] The culture medium in the six-well plate was discarded, 1 mL of serum-free Grace insect culture medium was added, and the incubated Bacmid-E MP -VP2 bacmid and transfection reagent were slowly added dropwise to Sf9 cells and incubated in a 28°C low-temperature cell culture incubator for 5 h.

[0082] 5 h after transfection, the culture medium was discarded and 2 mL of Sf-900 was added. TM II SFM medium, and the cells were placed in a 28°C low-temperature cell culture incubator for a further 72 h until the cells showed obvious pathological changes.

[0083] After the cells become diseased, the supernatant is harvested by centrifugation, indicating that the recombinant baculovirus has been successfully rescued and is the F0 generation virus, which is stored at -80°C.

[0084] The successfully rescued recombinant baculovirus was named rBacmid-E MP -VP2.

[0085] The rescued F0 generation recombinant baculovirus was used to infect Sf9 insect cells. After 72 hours, when most cells had become diseased ( Figure 5 ), centrifuge at 3000rpm and 4℃ to obtain the supernatant, which is the F1 generation virus. Continue to expand the culture to the F2 generation according to this method, and store it in aliquots at -80℃.

[0086] Example 5

[0087] Expression and identification of recombinant proteins

[0088] 1. Use indirect immunofluorescence (IFA) to detect the expression of recombinant protein. The specific steps are as follows:

[0089] (1) Sf9 cells were plated in 24-well plates and inoculated with 1 MOI of F2 recombinant baculovirus rBacmid-E MP -VP2 in Sf9 cells, and a non-infected group was set up as a blank control;

[0090] (2) Culture in a 28°C incubator for 48 h and discard the culture medium;

[0091] (3) Use 200 μL of 4% paraformaldehyde in each well, fix at room temperature for 45 min, and wash three times with PBS;

[0092] (4) Use 200 μL of 5% BSA blocking solution for each well, block for 30 min at room temperature, and wash three times with PBS;

[0093] (5) Use 200 μL NP40 solution in each well, permeabilize for 15 min at room temperature, and wash three times with PBS;

[0094] (6) Add 100 μL of mouse anti-His primary antibody (1:1000 dilution) to each well and incubate overnight for 16 h;

[0095] (7) Wash with PBS three times, 5 min each time;

[0096] (8) Add 100 μL of FITC-labeled goat anti-mouse secondary antibody (diluted at 1:500) to each well and incubate at room temperature in the dark for 60 min;

[0097] (9) Wash with PBS in dark for 3 times, 5 min each time;

[0098] (10) DAPI staining: DAPI was incubated at room temperature in the dark for 15 min;

[0099] (11) Wash with PBS three times in the dark for 5 min each time. Observe the fluorescence using an inverted fluorescence microscope.

[0100] IFA results are as follows Figure 6 As shown in the figure, compared with the blank control group (MOCK) cells without virus inoculation, obvious green fluorescence signals appeared in the Sf9 cells of the experimental group. This signal was mainly localized in the cytoplasm, and the fluorescence distribution pattern was consistent with the expected protein localization, indicating that the recombinant E MP -VP2 protein (fusion protein) was successfully expressed in Sf9 cells.

[0101] 2. Use Western Blot (WB) to detect the expression of recombinant protein. The specific steps are as follows:

[0102] (1) Sf9 cells were evenly plated in 6-well plates and inoculated with 1 MOI of F2 recombinant baculovirus rBacmid-E MP -VP2 was added to Sf9 cells, and the uninfected group was set as a blank control. After culturing in a 28°C incubator for 72 h, the cells showed obvious pathological changes, and then the cells were harvested by centrifugation at 4°C. The cells were lysed with RIPA (strong) lysis buffer to release proteins, and 5× SDS Loading Buffer was added and boiled for 10 min.

[0103] (2) SDS-PAGE electrophoresis was performed, and the membrane was blocked with 5% skim milk. Anti-His Tag mouse monoclonal antibody, JEV mouse positive serum, and PPV pig positive serum were used as primary antibodies for overnight incubation, and HRP-goat anti-mouse and goat anti-pig IgG were selected as secondary antibodies.

[0104] WB test results Figure 7 It was observed that a clear band at approximately 65 kDa could be detected using the three primary antibodies mentioned above, which was consistent with the E MP -VP2 recombinant fusion protein is consistent with the expected molecular weight. This result shows that E MP The -VP2 fusion protein was effectively expressed in Sf9 cells and could be recognized by specific His Tag antibodies. It also had the ability to react with JEV and PPV positive sera.

[0105] Example 6

[0106] Expression and purification of recombinant proteins

[0107] The Sf9 cells were transferred to a large cell flask. After the cells adhered to the wall, the F2 generation recombinant baculovirus that could express the fusion protein was inoculated into the Sf9 cells at an inoculation volume of 1 MOI. After 72 hours, the cells showed obvious pathological changes. The cells were harvested by centrifugation at 3000 rpm for 10 minutes at 4°C.

[0108] Resuspend the cells in 35 mL of Lysis Buffer (Lysis Buffer recipe see Table 3), and sonicate the cells on ice for 30 min;

[0109] Table 3 Lysis Buffer formula (pH 8.0)

[0110] <![CDATA[50mMNaH2PO4]]> 7.8g 300mM NaCl 17.54g 10mMImidazole 0.68g <![CDATA[ddH2O]]> Make up to 1L

[0111] The ultrasonically disrupted sample was centrifuged at 12000 rpm for 30 min at 4°C, and the supernatant was transferred to a 50 mL centrifuge tube as the protein sample. The protein was then purified by affinity chromatography.

[0112] The nickel column was cleaned with 10 times the volume of the packing column of ddH2O and 1MNaOH and 5 times the volume of the packing column of 0.1MEDTA and 0.1M NiSO4 to regenerate the nickel column packing; and then the nickel column was balanced with 5 times the volume of the packing column of the lysate;

[0113] Combine the treated protein sample with the nickel column filler and collect the flow-through liquid; use 6 times the filler column volume of 40mM and 60mM imidazole washing solutions to wash the impurities in turn, and collect the 40mM and 60mM washing solutions; finally, use 6 times the filler column volume of 300mM imidazole elution solution to elute the target protein, and collect the eluted target protein in separate tubes, 1mL per tube;

[0114] SDS detection: Take the flow-through, 40mM washing buffer, 60mM washing buffer, and 300mM elution buffer to elute the target protein, add 5×SDS Loading Buffer, boil for 10 minutes to prepare protein samples for SDS-PAGE detection.

[0115] The results are as follows Figure 8 As shown in the figure, there are a lot of impurities in the 40mM and 60mM imidazole washing solutions, and only a small amount of target protein, indicating that the low-concentration imidazole solution successfully washes out the impurities, and the high-concentration imidazole solution of 300mM can successfully elute the target protein. The purified protein has a clear single band at about 65kDa, which is consistent with the fusion protein E. MP The above results indicate that Sf9 cells express a large amount of protein and the protein can be highly purified.

[0116] Example 7

[0117] Assembly of virus-like particles

[0118] Fusion protein E MPAfter purification, the refolded protein was dialyzed at 4°C for more than 12 h in PBS at 4°C to allow the refolded recombinant protein E MP -VP2 self-assembles into virus-like particles, which are then purified using a sucrose solution.

[0119] The pellet was taken and used as a sucrose cushion with 20% sucrose, centrifuged at 160000g, 4°C for 3h, the precipitate was resuspended with PBS, spread on a 10-50% sucrose gradient, centrifuged at 160000g, 4°C for 3h, and samples at different gradient interfaces were taken for Western blot identification. The method was the same as before, and the sample with the highest protein content and the purest protein was selected. After dilution with PBS, the sucrose cushion was used again with 20% sucrose for ultracentrifugation to remove the sucrose, centrifuged at 160000g, 4°C for 3h, and the precipitate was resuspended with PBS. After negative staining with phosphotungstic acid, transmission electron microscopy was observed to detect the formation of virus-like particles. The results showed that the virus-like particles with a diameter of 30nm were the Japanese encephalitis virus and porcine parvovirus combined vaccine ( Fig. 9 ), which is consistent with the expected result.

[0120] Example 8

[0121] Determination of the immune efficacy of JEV and PPV combined granular vaccines

[0122] SPF-grade 4-week-old female BALB / c mice were purchased from Shanghai Jihui Experimental Animal Breeding Co., Ltd.

[0123] Four-month-old PPV serum antibody-negative guinea pigs were provided and raised by the Experimental Animal Base of Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences.

[0124] The animals were kept in the experimental environment for 7 days before the experiment was carried out. Thirty 4-week-old SPF mice were randomly divided into 3 groups, 10 in each group. The grouping and immunization dose are shown in Table 4. Two weeks after the first immunization, the same dose was used for booster immunization. Blood was collected from the retro-orbital venous plexus of mice at 0, 7, 14, 21 and 28 days after the first immunization, and serum was separated. Twenty-four 4-month-old guinea pigs (weight 400g) were randomly divided into 3 groups, 8 in each group. The grouping and immunization dose are shown in Table 5; 4 weeks after the first immunization, the same dose was used for booster immunization. Blood was collected from the guinea pig forelimb vein at 0, 14, 28 and 42 days, and serum was separated. The immune efficacy of the isolated mouse and guinea pig sera was measured.

[0125] Table 4 Grouping of mice and immunization dose

[0126]

[0127] Table 5 Grouping and immunization dose of guinea pigs

[0128]

[0129] Example 9

[0130] 1. Determination of JEV-specific humoral immunity level in mouse serum

[0131] In order to study E MP- The effect of VP2 protein on inducing JEV-specific humoral immunity was studied by studying the levels of specific IgG antibodies and neutralizing antibodies in mouse serum. Indirect ELISA analysis was performed on mouse sera collected at 0, 7, 14, 21, and 28 days. The results are shown in Fig.10 As shown, E MP The antibody titers of the -VP2 protein group and the JEV attenuated vaccine group (JEV attenuated vaccine was purchased from Wuhan Keqian Biological Co., Ltd.) increased significantly after immunization, and exceeded 3000 at 28 days, maintaining a high immune response level. There was no significant difference between the two groups, but both were significantly different from the PBS control group.

[0132] The neutralizing antibodies in the mouse sera were tested at 0, 7, 14, 21, and 28 days. The results are as follows Fig.11 . E MP Neutralizing antibodies were detected in the sera of mice in the -VP2 protein group and the JEV attenuated vaccine group, and both gradually increased. Until the 28th day, the neutralizing antibodies in the sera of the two immunization groups were able to maintain a high level, MP -VP2 protein group was significantly lower than JEV attenuated vaccine group. MP -VP2 protein has the potential to induce the production of JEV neutralizing antibodies.

[0133] 2. PPV-specific antibody and HI antibody levels in guinea pig serum

[0134] In order to study E MP The effect of VP2 protein on inducing PPV-specific humoral immunity was evaluated by evaluating guinea pig serum-specific IgG. After each vaccine was administered to guinea pigs, sera were collected at 0, 14, 28, and 42 days for indirect ELISA analysis. Fig.12 As shown. In 14d, E MP -VP2 protein group and PPV inactivated vaccine group (PPV inactivated vaccine purchased from Wuhan Keqian Biological Co., Ltd.) guinea pig serum PPV-specific antibody titer began to increase significantly, compared with the PBS control group with statistical significance. 28d and 42d, the antibody titer of the two immunization groups continued to increase, and E MP The antibody titer of the -VP2 protein group was significantly higher than that of the PPV inactivated vaccine group at 28 days, indicating that it may have stronger immunogenicity in inducing PPV-specific humoral immune response. At 42 days, the antibody titers of the two immune groups reached above 1:3000.

[0135] In addition, the level of PPV-HI antibody in guinea pig serum was tested. Fig.13 As shown, at 14d, E MP The titer of PPV HI antibody in the guinea pig serum in the VP2 protein group and the PPV inactivated vaccine group began to increase significantly. MP -The antibody titer of VP2 protein group and PPV inactivated vaccine group was greater than 26, reaching the qualified standard of PPV vaccine. MP The HI antibody titer of the VP2 protein group was significantly higher than that of the PPV inactivated vaccine group, indicating that MP -VP2 protein may be more immunogenic in inducing PPV-specific immune responses.

[0136] As can be seen from the above examples, the present invention provides a method for preparing a dual virus-like particle vaccine of Japanese encephalitis virus and porcine parvovirus and its application. The amino acid sequence of the fusion protein of the present invention is shown in SEQ ID NO.1. The fusion protein of the present invention is expressed by a baculovirus system. MP -VP2 recombinant fusion protein has good immunoreactivity and can be specifically recognized by anti-His monoclonal antibody and positive sera of JEV and PPV. It also has good immunoreactivity to mice and guinea pigs and can activate JEV and PPV specific humoral immune responses in mice and guinea pigs, respectively. MP -VP2 fusion protein has excellent immunogenicity in mice and guinea pigs, laying a solid foundation for the subsequent prevention and control of JEV and PPV and the development of bivalent subunit vaccines.

[0137] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A fusion protein of Japanese encephalitis virus and porcine parvovirus, characterized in that: The amino acid sequence of the fusion protein is shown in SEQ ID NO.

1.

2. The fusion protein according to claim 1, characterized in that The nucleotide sequence encoding the fusion protein is shown in SEQ ID NO.

2.

3. The fusion protein according to claim 2, characterized in that The primer pair for amplifying the nucleotide sequence of claim 2 is shown in SEQ ID NOs. 3 to 4.

4. The method for preparing the fusion protein according to any one of claims 1 to 3, characterized in that: The steps include: (1) Connecting the nucleotide sequence encoding the fusion protein to the pFastBac Dual vector to construct pFastBacDual-E MP -VP2 recombinant baculovirus expression plasmid; (2) The pFastBac Dual-E MP -VP2 recombinant baculovirus expression plasmid was transformed into Escherichia coli, blue-white screening was performed, and positive white colonies were selected for purification and identification to obtain recombinant Bacmid-E MP -VP2 bacmid; (3) The recombinant Bacmid-E MP -VP2 bacmid DNA was transfected into insect Sf9 cells until the cells showed pathological changes, and the supernatant was harvested by centrifugation to obtain the recombinant baculovirus rBacmid-E MP -F0 generation virus of VP2; (4) continuously expanding and culturing the F0 generation virus to F1 to F3 generations; (5) inoculating F1-F3 viruses into insect Sf9 cells, culturing for 70-74 hours, centrifuging, and collecting the precipitate; resuspending the precipitate in a lysis solution, ultrasonically lysing, centrifuging, and collecting the supernatant to obtain crude protein; (6) purifying the crude protein by affinity chromatography, collecting the target protein eluted by imidazole eluent, and obtaining a fusion protein; The nucleotide sequence encoding the fusion protein is shown in SEQ ID NO.

2.

5. A biomaterial related to the fusion protein according to any one of claims 1 to 3, characterized in that: The biological material is any one of the following: (a) a nucleic acid molecule encoding the fusion protein according to any one of claims 1 to 3; (b) an expression cassette comprising the nucleic acid molecule described in (a); (c) a recombinant expression vector comprising the nucleic acid molecule in (a) or the expression cassette in (b) and an empty vector; the empty vector is pFastBac Dual; (d) a recombinant bacterium, comprising the nucleic acid molecule in (a), the expression cassette in (b) or the recombinant expression vector in (c) and a host bacterium; the host bacterium is Escherichia coli DH10Bac; (e) A recombinant cell comprising the nucleic acid molecule in (a), the expression cassette in (b) or the recombinant expression vector in (c) and a host cell.

6. Use of the fusion protein according to any one of claims 1 to 3 in the preparation of Japanese encephalitis virus and porcine parvovirus bivalent virus particles or bivalent vaccines.

7. Use of the biological material according to claim 5 in the preparation of Japanese encephalitis virus and porcine parvovirus bivalent virus particles or bivalent vaccines.

8. A Japanese encephalitis virus and porcine parvovirus bivalent virus particle, characterized in that: The fusion protein is self-assembled to obtain Japanese encephalitis virus and porcine parvovirus bipartite virus particles; The fusion protein is the fusion protein according to any one of claims 1 to 3 or the fusion protein prepared according to the preparation method according to claim 4.

9. A Japanese encephalitis virus and porcine parvovirus combined vaccine, characterized in that: The fusion protein is self-assembled to obtain virus-like particles; the virus-like particles are purified by sucrose solution to obtain a Japanese encephalitis virus and porcine parvovirus combined vaccine; The fusion protein is the fusion protein according to any one of claims 1 to 3 or the fusion protein prepared according to the preparation method according to claim 4.

10. The Japanese encephalitis virus and porcine parvovirus combined vaccine according to claim 9, characterized in that: The initial concentration of the sucrose solution is 10-50 wt %.

Images