Fluorescent probe for synchronously detecting PTK7, GPC3 and MUC1 as well as preparation method and application of fluorescent probe

Abstract

The invention provides a fluorescent probe for synchronously detecting PTK7, GPC3 and MUC1 as well as a preparation method and application of the fluorescent probe, a single-excitation three-emission synchronous detection fluorescent probe is successfully constructed based on Fe3O4 MNPs, CDs, QDs and HCR, synchronous detection of PTK7, GPC3 and MUC1 is realized by simultaneously emitting fluorescence signals with three colors by utilizing a single excitation wavelength, the detection limits of PTK7, GPC3 and MUC1 under the optimal detection condition are 6 pM, 53 pM and 29 pM respectively, and the detection limit of PTK7, GPC3 and MUC1 is greatly reduced. And methodological verification results meet the detection requirements of biological samples, and the method can be used for actual sample detection.

Description

Technical Field

[0001] The invention belongs to the field of fluorescent probe technology detection, and specifically relates to a fluorescent probe for synchronously detecting PTK7, GPC3 and MUC1, and a preparation method and application thereof. Background Art

[0002] The "China Cancer Statistics" published in the "Journal of the National Cancer Center" summarizes the latest situation of cancer incidence and mortality in China as of 2016. Among them, the overall incidence of liver cancer ranks fourth and the mortality rate ranks second. Breast cancer ranks first in the incidence of malignant tumors in women in my country and has a high mortality rate. One of the main reasons for the high mortality rate is the difficulty in early diagnosis of liver cancer and breast cancer. The existing diagnostic methods for liver cancer and breast cancer include physical examination, cancer marker detection, imaging examination, pathological examination and metabolomics. Among them, improving the efficiency of early detection by detecting tumor markers is one of the hot topics of current research. Liver cancer markers mainly include alpha-fetoprotein (AFP), glycan 3 (GPC3), mucin (MUC1), miRNA-122, miRNA-223, etc. GPC3 is a highly specific hepatocellular carcinoma tumor-associated antigen (TAA). It is anchored to the cell surface through phosphatidylinositol (GPI). Its expression is significantly upregulated in liver cancer. It is considered to be a liver cancer biomarker superior to alpha-fetoprotein and has been used for hepatocellular carcinoma screening. Breast cancer markers include carcinoembryonic antigen (CEA), MUC1, protein tyrosine kinase 7 (PTK7), let-7a, miRNA-21, etc. PTK7, also known as colon cancer kinase, is a member of the receptor tyrosine kinase (RTK) family. PTK7 affects multiple cellular processes, such as migration and planar cell polarity (PCP), and plays a role in the canonical Wnt pathway, the atypical Wnt pathway, and the PCP signaling pathway. MUC1 is a highly glycosylated transmembrane mucin that is widely distributed and abnormally expressed on the surface of cancer cells. It plays an important role in maintaining epithelial integrity and tumor occurrence and metastasis, and can be used as an important tumor biological marker. Cancer is usually associated with multiple tumor markers, and the indicative significance of a single cancer marker varies. Therefore, the simultaneous detection of multiple tumor markers and the co-localization imaging of tumor cells are of great significance for the early diagnosis and specific detection of cancer.

[0003] So far, there are multiple tumor marker detection methods, including electrochemical method (ECL), enzyme-linked immunosorbent assay (ELISA), surface enhanced Raman scattering (SERS), colorimetric analysis, fluorescence analysis, etc. Among them, the fluorescence method has the advantages of high sensitivity, good stability, high accuracy, and simple operation, and has received widespread attention. Aptamer, as a recognition element, does not directly generate detection signals, so researchers combine aptamers with organic small molecule fluorescent dyes, carbon dots (CDs), quantum dots (QDs) or other materials that can generate fluorescent signals to form composite fluorescent probes. Traditional fluorescent dyes have a small Stokes shift, so most of the fluorescent probes established previously need to selectively excite fluorophores to emit fluorescent signals to detect multiple targets by adjusting the excitation wavelength, which is not a true "synchronous detection". The measurement spectrum of a single-excitation multi-emission fluorescent probe should show three or more emission peaks in the range of 400-760nm, and the peaks should overlap less and not interfere with each other. This requires the fluorescent labeling material to have the characteristics of a long Stokes red shift and a narrow half-width of the emission peak.

[0004] Compared with traditional organic fluorescent dyes, fluorescent nanomaterials (CDs, QDs, noble metal nanoclusters, etc.) have the characteristics of wide excitation spectrum, narrow and symmetrical emission peak half-width, and tunable spectrum. They can replace traditional fluorescent substances and are widely used in biosensing and bioimaging. Wang et al. used gold clusters with different fluorescence emissions (fluorescence emission wavelengths of 515nm and 620nm, respectively) to label MUC1 aptamers and miRNA-21 complementary chains to construct fluorescent probes for detecting two types of tumor markers, realizing synchronous in situ imaging of tumor cells. Liu et al. used a non-enzymatic palindromic DNA assembly technology (NEPA) to assemble a three-dimensional nanoscale DNA spherical structure with low mobility through three free hairpin DNAs for in situ imaging of intracellular miRNA-21. Selecting suitable fluorescent nanomaterials is expected to construct a single-excitation multi-emission fluorescent probe for synchronous determination of three cancer markers, thereby improving the accuracy of determination and enhancing the auxiliary diagnostic value of tumor markers.

[0005] In the early stages of cancer, tumor markers have low abundance in the body and are difficult to detect, so amplification technology is needed to improve detection sensitivity. In 2004, Dirks and Pierce first introduced the concept of hybridization chain reaction (HCR), which is a constant temperature, enzyme-free signal amplification technology that usually includes a trigger chain that recognizes the target signal and two hairpin DNAs with complementary base pairing. Combining fluorescence with HCR to improve the detection sensitivity of tumor markers has been widely used. In addition, ferrosoferric oxide nanoparticles (Fe3O4 MNPs) are non-toxic, easily degradable, and have good magnetic and biocompatibility in the body. They are often used as magnetic separators to separate targets from complex matrices, thereby improving detection accuracy. Summary of the invention

[0006] The purpose of the present invention is to provide a method for preparing a fluorescent probe for synchronously detecting PTK7, GPC3 and MUC1 on the basis of the prior art.

[0007] The second object of the present invention is to provide a fluorescent probe obtained by the above preparation method for synchronous detection of PTK7, GPC3 and MUC1.

[0008] The third object of the present invention is to provide the above fluorescent probe for synchronous detection of PTK7, GPC3 and MUC1 as an application for detecting PTK7, GPC3 and / or MUC1.

[0009] The technical solution of the present invention is as follows: A method for preparing a fluorescent probe for synchronously detecting PTK7, GPC3 and MUC1 comprises the following steps: (1) adding an aqueous ammonia solution to a mixed aqueous solution of FeCl2·4H2O and FeCl3·6H2O, and performing a chemical reaction at 50-70°C to obtain ferrosoferric oxide nanoparticles (Fe3O4 MNPs); mixing the obtained ferrosoferric oxide nanoparticles (Fe3O4 MNPs) with an aqueous solution of citric acid to obtain carboxylated ferrosoferric oxide nanoparticles (carboxylated Fe3O4 MNPs); (2) The carboxylated ferroferric oxide nanoparticles obtained in step (1) are activated under the action of EDC / NHS, and the activated mixed solution is cross-linked with pre-treated PTK7-Apt Trigger (PAT), GPC3-Apt Trigger (GAT) and MUC1-Apt Trigger (MAT) to prepare Fe3O4-PAT complex (Fe3O4-PTK7Apt Trigger), Fe3O4-GAT complex (Fe3O4-GPC3 Apt Trigger) and Fe3O4-MAT complex (Fe3O4-MUC1Apt Trigger) in sequence; wherein the treatment process of the pre-treated PTK7-Apt Trigger (PAT), GPC3-Apt Trigger (GAT) and MUC1-Apt Trigger (MAT) is as follows: PTK7-Apt Trigger (PAT), GPC3-Apt Trigger (GAT) and MUC1-Apt Trigger (MAT) are cross-linked with the pre-treated PTK7-Apt Trigger (PAT), GPC3-Apt Trigger (GAT) and MUC1-Apt Trigger (MAT) respectively. Trigger (MAT) dry powders were centrifuged and dissolved in PBS buffer solution, heated at 90-100°C for 3-8 min, and then cooled on ice for 1-5 min to obtain pretreated PTK7-Apt Trigger (PAT), GPC3-Apt Trigger (GAT), and MUC1-Apt Trigger (MAT) in turn; (3) activating the blue carbon dots (bCDs) under the action of EDC / NHS, and then cross-linking the activated mixture with the pretreated PTK7-H2 (PH2) to prepare a bCDs-PH2 complex; wherein the treatment process of the pretreated PTK7-H2 (PH2) is as follows: after centrifuging the PTK7-H2 (PH2), dissolving it in a PBS buffer solution, first heating it at 90-100°C for 3-8 minutes, and then cooling it on ice for 1-5 minutes to obtain the pretreated PTK7-H2 (PH2); (4) Activating green fluorescent CdSe / ZnS quantum dots (gQDs) under the action of EDC / NHS, and then cross-linking the activated mixed solution with the pretreated GPC3-H2 (GH2) to prepare a gQDs-GH2 complex; wherein the treatment process of the pretreated GPC3-H2 (GH2) is as follows: GPC3-H2 (GH2) is centrifuged, dissolved in PBS buffer solution, first heated at 90-100°C for 3-8 minutes, and then cooled on ice for 1-5 minutes to obtain the pretreated GPC3-H2 (GH2); (5) Activating red fluorescent CdSe / ZnS quantum dots (rQDs) under the action of EDC / NHS, and then cross-linking with pretreated MUC1-H2 (MH2) to prepare rQDs-MH2 complex; wherein the treatment process of the pretreated MUC1-H2 (MH2) is as follows: MUC1-H2 (MH2) is centrifuged, dissolved in PBS buffer solution, heated at 90-100°C for 3-8 minutes, and then cooled on ice for 1-5 minutes to obtain pretreated MUC1-H2 (MH2); (6) The Fe3O4-PAT complex, Fe3O4-GAT complex and Fe3O4-MAT complex prepared in step (2), the bCDs-PH2 complex prepared in step (4), the gQDs-GH2 complex prepared in step (6), the rQDs-MH2 complex prepared in step (8), PTK7-H1 (PH1), GPC3-H1 (GH1) and MUC1-H1 (MH1) are mixed uniformly to prepare a fluorescent probe; wherein, The sequence of PTK7-Apt Trigger (PAT) is as follows: NH2-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTAGGCGGCGGCGCAGC; The sequence of PTK7-H1 (PH1) is as follows: CGGCGGCGCAGCATCGCCGCTGCGCCGCCGCCTAAA; The sequence of PTK7-H2 (PH2) is as follows: GGCGATGCTGCGCCGCCGTTTAGGCGGCGGCGCAGC-NH2; The sequence of GPC3-Apt Trigger (GAT) is as follows: NH2-TAACGCTGACCTTAGCTGCATCGCTTACATGTTCCAAGTATTGCAGCTAAGG; The sequence of GPC3-H1 (GH1) is as follows: CAAGTATTGCAGCTAAGGCCAATTCCTTAGCTGCAATACTTGGAACAT; The sequence of GPC3-H2 (GH2) is as follows: AATTGGCCTTAGCTGCAATACTTGATGTTCCAAGTATTGCAGCTAAGG-NH2; The sequence of MUC1-Apt Trigger (MAT) is as follows: NH2-GCAGTTGATCCTTTGGATACCCTGGGGATCAACTGCACTAGGATTCTGTG; The sequence of MUC1-H1 (MH1) is as follows: CTGCACTAGGATTCTGTGGGTTAACACAGAATCCTAGTGCAGTTGATC; The sequence of MUC1-H2 (MH2) is as follows: TTAACCCACAGAATCCTAGTGCAGGATCAACTGCACTAGGATTCTGTG-NH2.

[0010] The sequences of the above chemical substances are specifically shown in Table 1 below.

[0011] The present invention selects Fe3O4 MNPs with good magnetic properties as the magnetic separation agent, and selects bCDs, gQDs and rQDs as the output fluorescence signals. The same excitation wavelength can be used to simultaneously monitor the three fluorescence signals without spectral overlap. The synchronous detection of PTK7, GPC3 and MUC1 is achieved according to the changes in the fluorescence intensity at the emission wavelengths of carbon dots and quantum dots.

[0012] The fluorescent probe provided by the present invention is used for the detection of PTK7, GPC3 and MUC1, has a good response range and detection limit, and has good anti-interference ability. The intra-day and inter-day precision and accuracy meet the requirements for biological sample detection. The serum samples are detected by the standard addition method, and the spiked recovery rate and RSD meet the requirements for biological sample detection.

[0013] In the present invention, in step (1), the reaction temperature is 50-70° C., preferably 60° C. The mass ratio of FeCl2·4H2O to FeCl3·6H2O is 1.0-1.3:2.7, preferably 1.13:2.7; the mass ratio of citric acid to ferrosoferric oxide nanoparticles is 4-6:0.2, preferably 5:0.2.

[0014] For the present invention, in a preferred embodiment, in step (2), the treatment process of the pretreated PTK7-Apt Trigger, GPC3-Apt Trigger and MUC1-Apt Trigger is as follows: the PTK7-Apt Trigger, GPC3-Apt Trigger and MUC1-Apt Trigger dry powders are centrifuged respectively, dissolved in PBS buffer solution, first heated at 95°C for 5 min, and then cooled on ice for 4 min, to obtain the pretreated PTK7-Apt Trigger, GPC3-Apt Trigger and MUC1-Apt Trigger in turn.

[0015] In the present invention, in step (2), the mass ratio of carboxylated ferrosoferric oxide nanoparticles, EDC and NHS is 0.2:15-20:20-25, preferably 0.2:19:22.

[0016] In step (2), the mass ratio of carboxylated ferrosoferric oxide nanoparticles to PTK7-Apt Trigger is 0.2:0.175-0.195; preferably 0.2:0.184; the mass ratio of carboxylated ferrosoferric oxide nanoparticles to GPC3-Apt Trigger is 0.2:0.145-0.165; preferably 0.2:0.156; the mass ratio of carboxylated ferrosoferric oxide nanoparticles to MUC1-Apt Trigger is 0.2:0.155-0.175; preferably 0.2:0.163.

[0017] In step (3), the mass ratio of blue carbon dots, EDC and NHS is 0.2:15-20:20-25, preferably 0.2:19:22; the mass ratio of blue carbon dots to PTK7-H2 is 0.2:0.1-0.2, preferably 0.2:0.113.

[0018] For the present invention, in step (4), the mass ratio of green fluorescent CdSe / ZnS quantum dots, EDC and NHS is 0.2:15-20:20-25, preferably 0.2:19:22. The mass ratio of green fluorescent CdSe / ZnS quantum dots to GPC3-H2 is 0.2:0.14-0.16; preferably 0.2:0.150.

[0019] For the present invention, in step (5), the mass ratio of red fluorescent CdSe / ZnS quantum dots, EDC and NHS is 0.2:15-20:20-25, preferably 0.2:19:22; the mass ratio of red fluorescent CdSe / ZnS quantum dots to MUC1-H2 is 0.2:0.145-0.165, preferably 0.2:0.156.

[0020] For the present invention, in step (6), the concentration ratio of the Fe3O4-PAT complex to the PTK7-H1 and bCDs-PH2 complex is 1:2:2; the concentration ratio of the Fe3O4-GAT complex to the GPC3-H1 and gQDs-GH2 complex is 1:2:2; the concentration ratio of the Fe3O4-MAT complex to the MUC1-H1 and rQDs-MH2 complex is 1:2:2.

[0021] The present invention also includes a fluorescent probe for synchronous detection of PTK7, GPC3 and MUC1 prepared by the above method, which realizes the synchronous detection of PTK7, GPC3 and MUC1. Under the optimal detection conditions, the detection limits of PTK7, GPC3 and MUC1 are 6 pM, 53 pM and 29 pM, respectively. It can be used for detecting PTK7, GPC3 and / or MUC1, can target and identify liver cancer cells and breast cancer cells, and provide a basis for cancer diagnosis.

[0022] Adopt the technical scheme of the present invention, the advantages are as follows: The present invention successfully constructed a single-excitation three-emission synchronous detection fluorescent probe based on Fe3O4 MNPs, CDs, QDs and HCR. The synchronous detection of PTK7, GPC3 and MUC1 was achieved by simultaneously emitting three colors of fluorescence signals using a single excitation wavelength. Under the optimal detection conditions, the detection limits of PTK7, GPC3 and MUC1 were 6 pM, 53 pM and 29 pM, respectively, which are superior to the existing detection methods. The methodological verification results met the detection requirements of biological samples and can be used for actual sample detection.

[0023] The cell imaging results show that the fluorescent probe can target and identify liver cancer cells and breast cancer cells, providing a basis for cancer diagnosis. The fluorescent probe can be used for the simultaneous analysis of PTK7, GPC3 and MUC1 in serum samples of liver cancer and breast cancer patients.

[0024] The fluorescent probe provided by the present invention provides a basis for the early diagnosis of liver cancer and breast cancer, and also provides a reference for the design and development of single-excitation multi-emission fluorescent probes for the simultaneous detection of multiple tumor markers. It also provides a detection template for seeking suitable combined detection of tumor markers, and screens out better tumor markers by changing the aptamer, which has broad potential in assisting clinical diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 is the TEM image of Fe3O4 MNPs, bCDs, gQDs and rQDs; Figure 1 A is the TEM image of Fe3O4 MNPs; Figure 1 B is the TEM image of bCDs; Figure 1C is the TEM image of gQDs; Figure 1 D is the TEM image of rQDs; Figure 2 The hysteresis loop of Fe3O4 MNPs and the image under sunlight after separation by magnet and shaking; Figure 2 Figure A is the hysteresis loop of Fe3O4 MNPs; Figure 2 B is the sunlight image of Fe3O4 MNPs after separation by magnet and shaking; Figure 3 is the UV absorption and fluorescence emission diagram, where Figure 3 A is bCDs, the higher curves in the peaks and valleys represent the fluorescence emission graph, and the lower curves represent the UV absorption; Figure 3 B is gQDs, the higher curves in the peaks and valleys represent the fluorescence emission graph, and the lower curves represent the UV absorption; Figure 3 C is rQDs, the higher curves represent the fluorescence emission graph, and the lower curves represent the UV absorption graph; the insets are the images taken under sunlight and UV light from left to right; Figure 4 The invention relates to a preparation process of a fluorescent probe for synchronously detecting PTK7, GPC3 and MUC1 and a method for detecting tumor markers; Figure 5 is a fluorescence image; Figure 5 A is the fluorescence image of bCDs, gQDs, rQDs and the mixture of the three. At 550nm, from low to high, it represents rQDs, bCDs, the mixture of the three and gQDs; Figure 5 B is the fluorescence image of bCDs-PH2, gQDs-GH2, rQDs-MH2 and the mixture of the three. At 510 nm, from low to high, it represents rQDs-MH2, gQDs-GH2, bCDs-PH2 and the mixture of the three; Figure 6 It is the agarose gel electrophoresis and atomic force microscopy images of the target protein triggering the hybridization chain reaction; among them, Figure 6 A is an agarose gel electrophoresis diagram of PTK7-triggered hybridization chain reaction; Figure 6 B is an atomic force microscopy image of PTK7-triggered hybridization chain reaction; Figure 6 C is an agarose gel electrophoresis image of GPC3-triggered hybridization chain reaction; Figure 6 D is an atomic force microscopy image of the hybridization chain reaction triggered by GPC3; Figure 6 E is the agarose gel electrophoresis image of MUC1-triggered hybridization chain reaction; Figure 6 F is an atomic force microscopy image of the hybridization chain reaction triggered by MUC1; Figure 7 is a fluorescence image; Figure 7 A is the fluorescence graph after adding different concentrations of PTK7. At 450 nm, from low to high, it represents Blank, 0.02nM PTK7, 0.2nM PTK7 and 1nM PTK7; Figure 7 B is the fluorescence graph after adding different concentrations of GPC3, at 550 nm, from low to high, representing Blank, 0.1 nM GPC3, 1 nM GPC3 and 5 nM GPC3; Figure 7 C is the fluorescence graph of adding different concentrations of MUC1, at 650 nm, from low to high, representing Blank, 0.2 nM MUC1, 1 nM MUC1, and 5 nM MUC1; Figure 7 D is the fluorescence graph of adding different concentrations of PTK7, GPC3 and MUC1 at the same time. At 450nm, from low to high, it represents Blank, 0.02nM PTK7+0.1nM GPC3+0.2nM MUC1, 0.2nM PTK7+1nM GPC3+1nM MUC1 and 1nM PTK7+5nM GPC3+5nM MUC1; Figure 8 is the ultraviolet-visible light spectrum; Figure 8 A is the UV-visible spectra of Fe3O4 MNPs, PTK7 Apt Trigger and Fe3O4-PTK7 Apt Trigger. At 400 nm, from low to high, they represent PTK7 AptTrigger, Fe3O4 MNPs and Fe3O4-PTK7 Apt Trigger; Figure 8 B is the UV-visible spectra of bCDs, PH2 and bCDs-PH2, at 350 nm, from low to high, representing PH2, bCDs-PH2 and bCDs; Figure 8 C is the UV-visible spectra of Fe3O4 MNPs, GPC3Apt Trigger and Fe3O4-GPC3 Apt Trigger. At 400 nm, from low to high, they represent GPC3 Apt Trigger, Fe3O4 MNPs and Fe3O4-GPC3 Apt Trigger; Figure 8 D is the UV-visible spectra of gQDs, GH2, and gQDs-GH2. At 0 nm, from low to high, they represent gQDs-GH2, GH2, and gQDs; Figure 8E is the UV-visible spectra of Fe3O4MNPs, MUC1 Apt Trigger and Fe3O4-MUC1 Apt Trigger. At 400nm, from low to high, they represent MUC1 Apt Trigger, Fe3O4-MUC1 Apt Trigger and Fe3O4 MNPs; Figure 8 F is the UV-visible spectra of rQDs, MH2, and rQDs-MH2, at 400 nm, representing MH2, rQDs, and rQDs-MH2 from low to high; Fig. 9 are the hysteresis loops of Fe3O4 MNPs and Fe3O4-DNA, among which the curves of Fe3O4 MNPs and Fe3O4-DNA are basically overlapped; Fig.10 is the reaction concentration optimization diagram, where Fig.10 A is the Fe3O4-PTK7 Apt Trigger reaction concentration optimization diagram, the concentration of PH1 is 200 nM, the volume of PH2 is 40 μL, Fig.10 B is the reaction concentration optimization diagram of PAT, PH1 and PH2, Lane 1: 100 nM PTK7 + 1 μM PAT + 1 μM PH1 + 1 μM PH2; Lane 2: 100 nM PTK7 + 1 μM PAT + 2 μM PH1 + 2 μM PH2; Lane 3: 100 nM PTK7 + 1 μM PAT + 5 μM PH1 + 5 μM PH2; Lane 4: 100nM PTK7 + 1 μM PAT + 10 μM PH1 + 10 μM PH2; Fig.10 C is the HCR reaction time optimization diagram; Fig.11 is the reaction concentration optimization diagram, where Fig.11 A is the concentration optimization diagram of Fe3O4-GPC3 Apt Trigger reaction, the concentration of GH1 is 200 nM, and the volume of GH2 is 40 μL; Fig.11B is the reaction concentration optimization diagram of GAT, GH1 and GH2, Lane 1: 100 nM GPC3 + ​​1 μM GAT + 1 μM GH1 + 1 μM GH2; Lane 2: 100 nM GPC3 + ​​1 μM GAT + 2 μM GH1 + 2 μM GH2; Lane 3: 100 nM GPC3 + ​​1 μM GAT + 5 μM GH1 + 5 μM GH2; Lane 4: 100nM GPC3 + ​​1 μM GAT + 10 μM GH1 + 10 μM GH2; Fig.11 C is the HCR reaction time optimization diagram; Fig.12 is the reaction concentration optimization diagram, where Fig.12 A is the concentration optimization diagram of Fe3O4-MUC1 Apt Trigger reaction, the concentration of MH1 is 200 nM, the volume of MH2 is 40 μL, Fig.12 B is the reaction concentration optimization diagram of MAT, MH1 and MH2, Lane 1: 100 nM MUC1 + 1 μM MAT + 1 μM MH1 + 1 μM MH2; Lane 2: 100 nM MUC1 + 1 μM MAT + 2 μM MH1 + 2 μM MH2; Lane 3: 100 nM MUC1 + 1 μM MAT + 5 μM MH1 + 5 μM MH2; Lane 4: 100nM MUC1 + 1 μM MAT + 10 μM MH1 + 10 μM MH2; Fig.12 C is the HCR reaction time optimization diagram; Fig.13 is the FL change diagram of PTK7; among them, Fig.13 A is the FL change diagram after adding different concentrations of PTK7. At 450 nm, from low to high, it represents 0.02 nM, 0.05 nM, 0.1 nM, 0.2 nM, 0.5 nM, 1.0 nM, 2.0 nM and 5.0 nM; Fig.13 B is the fluorescence intensity I 450 Linear fitting curve with Lg[PTK7]; Fig.14 is the FL change diagram of GPC3; among them, Fig.14 A is the FL change diagram after adding different concentrations of GPC3. At 550 nm, from low to high, it represents 0.1 nM, 0.2 nM, 0.5 nM, 1.0 nM, 2.0 nM, 5.0 nM, 10 nM and 20 nM; Fig.14 B is the fluorescence intensity I 450 Linear fitting curve with Lg[GPC3]; Fig.15 is the FL change diagram of MUC1; Fig.15 A is the FL change diagram after adding different concentrations of MUC1, at 650 nm, from low to high, representing 0.05 nM, 0.1 nM, 0.2 nM, 0.5 nM, 1.0 nM, 2.0 nM, 5.0 nM and 10 nM; Fig.15 B is the fluorescence intensity I 450 Linear fitting curve with Lg[MUC1]; Fig.16 is the FL change diagram of PTK7, GPC3 and; among them, Fig.16 A is the FL change diagram after adding different concentrations of PTK7, GPC3 and MUC1; Fig.16 B is the fluorescence intensity I 450 Linear fitting curve with Lg[PTK7]; Fig.16 C is the fluorescence intensity I 540 Linear fitting curve with Lg[GPC3]; Fig.16 D is the fluorescence intensity I 640 Linear fitting curve with Lg[MUC1]; Fig.17 It is the selectivity of the single-excitation triple-emission fluorescent probe for the target protein and interfering ions, microRNA, and protein (where the concentration of PTK7 is 0.2 nM, the concentration of GPC3 is 1.0 nM, the concentration of MUC1 is 0.5 nM, the concentration of interfering ions and proteins is 10 mM, and the concentration of interfering RNA is 10 nM); Fig.18 is the target protein content in serum; Fig.18 A is the target protein content in the serum of healthy volunteers and breast cancer patients; Fig.18 B is the target protein content in the serum of healthy volunteers and liver cancer patients; Fig.19 is the cell viability after the fluorescent probe was incubated with LO2 cells, HepG2 cells, MCF-7 cells, and MCF-10A cells for 12 h, where the first column represents LO2 cells, the second column represents HepG2 cells, the third column represents MCF-7 cells, and the fourth column represents MCF-10A cells; Fig. 20 These are the confocal images of the fluorescent probes after incubation with LO2 cells, HepG2 cells, MCF-7 cells, and MCF-10A cells for 1 h (scale bar: 30 μm). DETAILED DESCRIPTION

[0026] The present invention can be better understood according to the following examples. However, it is easy for those skilled in the art to understand that the contents described in the examples are only used to illustrate the present invention, and should not and will not limit the present invention described in detail in the claims.

[0027] 1. Implementation methods 1.1 Solution preparation 1.1.1 Preparation of 10 mM PBS buffer solution (pH 7.4) Use an analytical balance to weigh 0.30 g NaCl, 0.02 g NaH2PO4, 0.31 g Na2HPO4·12H2O, and 0.02 g KCl and dissolve them in a certain volume of ultrapure water. Use 1 M HCl to adjust the pH to 7.4, then transfer to a volumetric flask, make up to the mark, and store the buffer solution at room temperature.

[0028] 1.1.2 Preparation of 10 mM PBS buffer solution (pH 6.0) Use an analytical balance to weigh 0.30 g NaCl, 0.02 g NaH2PO4, 0.31 g Na2HPO4·12H2O, and 0.02 g KCl and dissolve them in a certain volume of ultrapure water. Use 1 M HCl to adjust the pH to 6.0, then transfer to a volumetric flask, make up to the mark, and store the buffer solution at room temperature.

[0029] 1.1.3 Preparation of 1 M NaOH solution Weigh 1.60 g of NaOH, dissolve it in 40 mL of ultrapure water, and store it at room temperature.

[0030] 1.1.4 Preparation of HCR reaction buffer Weigh 0.02 g KCl, 0.02 g KH2PO4, 5.37 g Na2HPO4·12H2O, and 0.102 g MgCl2·6H2O, dissolve them in 100 mL ultrapure water, then adjust the pH to 7.4 and store at room temperature.

[0031] 1.2 Preparation of blue carbon dots (bCDs) Weigh 1.2 g CA (citric acid), 600 μL DETA (diethylenetriamine), add ultrapure water to 20 mL, dissolve them by ultrasound and mix them evenly on an oscillator. Transfer the resulting mixed solution to a stainless steel high-pressure reactor lined with polytetrafluoroethylene and react at 200 °C for 4 h. After the reaction solution is cooled to room temperature, it is washed three times with acetone and dried in vacuo at 50 °C for 12 h to obtain a light yellow solid powder, namely blue carbon dots (bCDs), which is ready for use.

[0032] 1.3 CdSe / ZnS quantum dots (540 nm, 640 nm) were purchased from Shanghai Xingzi New Materials Technology Development Co., Ltd.

[0033] 1.4 Preparation of carboxylated Fe3O4 MNPs 1.13 g FeCl2·4H2O and 2.70 g FeCl3·6H2O were weighed and added to a 250 mL three-necked round-bottom flask, and then 100 mL ultrapure water was added. Ultrasonication was performed until the solid was completely dissolved. Under N2 protection, mechanical stirring was performed in a constant temperature water bath at 60°C for 15 min. Then, 14 mL of ammonia aqueous solution was quickly added dropwise until no black precipitate was generated. The reaction temperature and stirring speed were kept constant during the whole process. After stirring for 30 min, the temperature was raised to 80°C and the stirring reaction was continued for h. The product was collected by an external magnetic field, washed with ultrapure water and ethanol for 3 times, and vacuum dried at 45°C for 12 h to obtain dry Fe3O4 MNPs. 5 g citric acid was weighed and dissolved in 50 mL ultrapure water, and then 0.2 g of dry Fe3O4 MNPs was added. Ultrasonication was performed for 20 min, mechanical stirring was performed for 4 h, and the obtained product was washed with ultrapure water and ethanol for three times, and vacuum dried at 45°C to obtain carboxylated Fe3O4 MNPs for use.

[0034] 1.5 Cross-linking of Fe3O4 MNPs and Apt Trigger 0.2 mg Fe3O4 MNPs was dissolved in 1 mL pH 6.0 PBS buffer, 19 mg EDC and 22 mg NHS were added, and the solution was dissolved by ultrasound, and activated by shaking at room temperature for 30 min. At the same time, Apt Trigger (PTK7-AptTrigger, GPC3-Apt Trigger and MUC1-Apt Trigger) was pretreated. The dry powder of Apt Trigger (PTK7-AptTrigger, GPC3-Apt Trigger and MUC1-Apt Trigger) was centrifuged at 4 ℃ 4000 rpm for 1 min, and pH 7.4 PBS buffer was added to dissolve it into a 100 μM solution, first heated at 95℃ for 5 min, then cooled on ice for 4 min, and allowed to stand at room temperature, and the pretreated Apt Trigger (PTK7-Apt Trigger, GPC3-AptTrigger and MUC1-Apt Trigger) was obtained in turn for use. The pH of the activated Fe3O4 MNPs-containing mixed solution was adjusted to 7.4 with 1 M NaOH, and then 10 μL of pretreated Apt Trigger (PTK7-Apt Trigger, GPC3-Apt Trigger and MUC1-Apt Trigger) was added. The mixture was shaken at room temperature overnight for cross-linking reaction, and then magnetically washed three times with pH 7.4 PBS to remove the Apt Trigger not connected to the Fe3O4 MNPs, thereby obtaining the products of Fe3O4 MNPs and aptamer trigger chain (Apt Trigger) cross-linking (i.e., Fe3O4-PAT complex, Fe3O4-GAT complex and Fe3O4-MAT complex). Among them, the mass ratio of carboxylated ferrosoferric oxide nanoparticles to PTK7-Apt Trigger is 0.2:0.184; the mass ratio of carboxylated ferrosoferric oxide nanoparticles to GPC3-Apt Trigger is 0.2:0.156; the mass ratio of carboxylated ferrosoferric oxide nanoparticles to MUC1-Apt Trigger is 0.2:0.163.

[0035] 1.6 Crosslinking of blue carbon dots (bCDs) with PTK7-H2 (PH2), green fluorescent quantum dots (gQDs) with GPC3-H2 (GH2), and red fluorescent quantum dots (rQDs) with GPC3-H2 (GH2) 0.2 mg of blue carbon dots (bCDs) were dissolved in 1 mL of pH 6.0 PBS buffer, 19 mg of EDC and 22 mg of NHS were added, and the mixture was dissolved by ultrasound. The mixture was activated by shaking at room temperature for 30 min. At the same time, PTK7-H2 was pretreated by centrifuging PTK7-H2 at 4000 rpm for 1 min at 4 °C, adding pH 7.4 PBS buffer to dissolve it into a 100 μM solution, heating it at 95 °C for 5 min, cooling it on ice for 4 min, and standing it at room temperature to obtain the pretreated PTK7-H2 (PH2) for later use. The pH of the activated mixture containing blue carbon dots (bCDs) was adjusted to 7.4 with 1 M NaOH, and 10 μL of 100 μM pretreated PTK7-H2 was added. The mixture was shaken at room temperature overnight to perform a cross-linking reaction to obtain a bCDs-PH2 complex, which was dialyzed for 12 h using a dialysis bag to remove excess EDC, NHS and PTK7-H2 (PH2). Among them, the mass ratio of blue carbon dots, EDC and NHS is 0.2:19:22, and the mass ratio of blue carbon dots to PTK7-H2 is 0.2:0.113.

[0036] For the present invention, green / red CdSe / ZnS quantum dots (540nm, 640nm) were purchased from Shanghai Xingzi New Materials Technology Development Co., Ltd. The cross-linking reaction method of gQDs and GH2 was the same as the cross-linking method of bCDs and PH2, and the gQDs-GH2 complex, wherein the mass ratio of green fluorescent CdSe / ZnS quantum dots, EDC and NHS was 0.2:19:22, and the mass ratio of green fluorescent CdSe / ZnS quantum dots to GPC3-H2 was 0.2:0.150; the cross-linking reaction method of rQDs and MH2 was the same as the bCDs-PH2 cross-linking method, and the rQDs-MH2 complex was obtained, wherein the mass ratio of red fluorescent CdSe / ZnS quantum dots, EDC and NHS was 0.2:19:22, and the mass ratio of red fluorescent CdSe / ZnS quantum dots to MUC1-H2 was 0.2:0.156.

[0037] 1.7 Preparation of fluorescent probes The prepared Fe3O4-PAT complex, Fe3O4-GAT complex, Fe3O4-MAT complex, bCDs-PH2 complex, bCDs-PH2 complex and rQDs-MH2 complex, as well as PTK7-H1, GPC3-H1 and MUC1-H1 were mixed evenly to prepare fluorescent probes; wherein, the concentration ratio of the Fe3O4-PAT complex to the PTK7-H1 and bCDs-PH2 complex was 1:2:2; the concentration ratio of the Fe3O4-GAT complex to the GPC3-H1 and gQDs-GH2 complex was 1:2:2; the concentration ratio of the Fe3O4-MAT complex to the MUC1-H1 and rQDs-MH2 complex was 1:2:2.

[0038] 1.8 Hybridization Chain Reaction (HCR) Before the reaction, the DNA powder was centrifuged at 4000 rpm for 1 min, and pH 7.4 PBS buffer was added to dissolve it into a 100 μM solution, which was first heated at 95°C for 5 min and then cooled on ice for 4 min. Subsequently, the target proteins (PTK7, GPC3 and MUC1), Apt Trigger (PTK7-Apt Trigger, GPC3-Apt Trigger and MUC1-AptTrigger), H1 (PTK7-H1, GPC3-H1 and MUC1-H1) and H2 (PTK7-H2, GPC3-H2 and MUC1-H2) were mixed evenly in reaction buffer (2.67 mM KCl, 1.47 mM KH2PO4, 150 mM NaCl, 8.1 mM Na2PHO4·12H2O, 5 mM MgCl2·6H2O, pH 7.4) and reacted at 37 °C and 200 rpm for 1 h.

[0039] 1.9 Agarose gel electrophoresis (AGE) experiment Weigh 1 g of agarose and add it to a beaker containing 50 mL of 0.5×TBE electrophoresis buffer, add 1 mL of ultrapure water, heat it to boiling in a microwave oven, wait for the agarose solution to cool to about 60°C, add 5 μL of Gel-Red nucleic acid dye, mix well, pour the agarose solution into the gel caster, insert the sample grid, wait for the gel to cool, take out the sample grid, place the prepared 2% agarose gel in the horizontal electrophoresis tank, add 0.5×TBE until the gel is completely covered. Add 2 μL of 6×DNA Loading Buffer to each 10 μL DNA sample, mix well, add 10 μL of reaction solution to each sample well, run at 80 V for 80 min, and place the gel in UVITEC for imaging after the end.

[0040] 1.10 Characterization of Hybridization Chain Reaction by Atomic Force Microscopy (AFM) The final concentration of the DNA sample used for atomic force microscopy was 200 nM. The HCR reaction steps were the same as 2.6. After the HCR reaction, 10 μL of the sample was added dropwise to the newly peeled mica sheet. After the sample was naturally air-dried, it was imaged on a BRUKER atomic force microscope.

[0041] 1.11 PTK7 detection 10 μL PTK7 of different concentrations (the final concentration of PTK7 was 0.02, 0.05, 0.1, 0.2, 0.5, 1.0, 2.0, 5.0 nM) was incubated with 60 μL Fe3O4-PAT, 60 μL Fe3O4-GAT and 60 μL Fe3O4-MAT at 37 °C for 30 min, and then 10 μL 12 μM PH1, 120 μL bCDs-PH2, 10 μL 12 μM GH1, 120 μL gQDs-GH2, 10 μL 12 μM MH1 and 120 μL rQDs-MH2 were added to the reaction system, and the reaction buffer was supplemented to 600 μL, and incubated at 37 °C, 200 rpm for 1 h. After the reaction, the excess unreacted DNA chain was removed by magnetic separation and washed three times with PBS. After magnetic separation, the fluorescence intensity of the supernatant was measured under 360 nm excitation, and the fluorescence intensity of the probe (I 450 A standard curve was drawn against the PTK7 concentration.

[0042] 1.12 GPC3 detection The detection method is the same as 1.10. Add 10 μL of GPC3 to make the final concentration of GPC3 0, 0.1, 0.2, 0.5, 1, 2, 5, 10, 20 nM, and calculate the fluorescence intensity of the probe (I 540 A standard curve was drawn against the GPC3 concentration.

[0043] 1.13 MUC1 detection The detection method is the same as 1.10. Add 10 μL of different concentrations of MUC1 to make the final concentration of MUC1 0, 0.05, 0.1, 0.2, 0.5, 1, 2, 5, 10 nM, and according to the probe fluorescence intensity value (I 640 A standard curve was drawn against the MUC1 concentration.

[0044] 1.14 Simultaneous detection of PTK7, GPC3 and MUC1 The detection method is the same as 1.10. Add 10 μL PTK7, 10 μL GPC3 and 10 μL MUC1 to make the final concentration of PTK7 0, 0.02, 0.05, 0.1, 0.2, 0.5, 1, 2, 5 nM, the final concentration of GPC3 0, 0.1, 0.2, 0.5, 1, 2, 5, 10, 20 nM, and the final concentration of MUC1 0, 0.05, 0.1, 0.2, 0.5, 1, 2, 5, 10 nM. And according to the fluorescence intensity value of the probe (I 450 ,I 540 ,I 640 ) were used to plot standard curves against the concentrations of PTK7, GPC3 and MUC1.

[0045] 1.15 Detection of PTK7, GPC3 and MUC1 in serum Serum samples of liver cancer and breast cancer were obtained from the Affiliated Tumor Hospital of Xuzhou Medical University. The levels of PTK7, GPC3 and MUC1 in serum were detected by standard addition method. 12.5 μL PTK7, GPC3 and MUC1 were added to 25 μL liver cancer serum, respectively, to make the final concentration of PTK7 0, 0.02, 0.04, 0.06 nM, the final concentration of GPC3 0, 0.7, 1.4, 2.1 nM, and the final concentration of MUC1 0, 10, 20, 30 nM; 12.5 μL PTK7, GPC3 and MUC1 were added to 25 μL breast cancer serum, respectively, to make the final concentration of PTK7 0, 0.5, 1.0, 1.5 nM, the final concentration of GPC3 0, 0.1, 0.2 and 0.3 nM, and the final concentration of MUC1 0, 3, 6, 9 nM. Then, the serum added with standard solution was operated according to "2.11 Simultaneous detection of PTK7, GPC3 and MUC1" to determine the contents of PTK7, GPC3 and MUC1 in serum samples.

[0046] 1.16 Cell culture The following four cell lines were used in the experiment: human hepatoma cells (HepG2), normal human liver cells (LO2), breast cancer cells (MCF-7), and normal human breast epithelial cells (MCF-10A). The culture medium used for HepG2 cells, LO2 cells, and MCF-7 cells was an incomplete DMEM medium containing 10% fetal bovine serum, penicillin (100 U / mL), and streptomycin (100 μg / mL), and the culture medium used for MCF-10A cells was a special culture medium for MCF-10A cells. The culture environment was a cell culture incubator at 37°C containing 5% CO2.

[0047] Cell recovery: Take the frozen cells out of the -80 ℃ refrigerator and quickly put them in a 37 ℃ water bath to dissolve. After spraying 75% alcohol for disinfection and sterilization, put the cell cryopreservation tube into the cell clean bench for cell recovery. Use a 3 mL Pasteur pipette to add the above dissolved cell suspension to a sterile centrifuge tube containing 5 mL of complete culture medium, blow and mix evenly, and then centrifuge at 1300 rpm for 3 min. After centrifugation, discard the supernatant, add 1 mL of complete culture medium to resuspend the cell pellet, and blow and mix evenly with a Pasteur pipette, then suck it into a cell culture bottle containing 4 mL of complete culture medium, shake it gently and put it into the cell culture incubator for culture. Observe the cell growth and change the medium on the next day. After two to three days of cell culture, observe the cell growth under a microscope to determine whether cell subculture is needed. When the cells grow to cover the bottom of the culture bottle (80% or more), they can be subcultured.

[0048] Passaging process: first put a 15 mL centrifuge tube, Pasteur pipette, cotton ball, alcohol lamp, and sealing film into the clean bench and sterilize with UV for 30 min. At the same time, put DMEM complete culture medium, saline, and trypsin digestion solution containing EDTA from the 4 ℃ refrigerator to a 37 ℃ water bath to reheat. After 30 min, turn off the ultraviolet light of the clean bench, turn on the fan and fluorescent lamp, take out the cell culture bottle from the cell culture incubator, spray the cell culture bottle with 75% alcohol and bring it into the clean bench, pour out the old culture medium in the cell culture bottle, rinse it twice with saline to wash away the floating dead cells and residual complete culture medium, then add 1.5 mL of trypsin digestion solution containing EDTA, put it into the cell culture incubator for digestion for 2 min, take it out and observe whether the cells are digested under a microscope, gently tap the cell culture bottle, and a large number of cells flow, indicating that they have been digested. Subsequently, 4 mL of complete culture medium was added to terminate the digestion, and the bottom of the cell culture flask was gently blown with a Pasteur pipette to make the attached cells fall off from the bottom of the culture flask. Then, the cells were transferred to a 15 mL centrifuge tube and sealed with a sealing film. Centrifuged at 1300 rpm for 3 min, the supernatant was removed after centrifugation, and 2 mL of complete culture medium was added to resuspend. The cells were blown evenly with a Pasteur pipette, and an appropriate amount of the cell resuspension was added to the cell culture flask containing 4 mL of complete culture medium. After gently shaking, the cells were placed in a cell culture incubator for culture.

[0049] 1.17 Cell safety experiments The cytotoxicity of the fluorescent probe was determined using the CCK-8 method. HepG2 cells were subcultured and plated in 96-well plates. The density of each well was 1×10 5100 μL cell suspension solution with a concentration of 100 μL / mL was added to the cell culture incubator and incubated overnight to allow the cells to adhere to the wall. The next day, the 96-well plate was taken out of the incubator, the old culture medium was discarded in the clean bench, the cells were washed with saline, and 100 μL blank culture medium containing fluorescent probe was added to the 96-well plate, and the cells were incubated in the incubator for 12 h. The blank culture medium containing the probe was then aspirated with a pipette, and the cells were washed twice with saline to remove excess probes to avoid errors in absorbance readings. A mixed solution of 10 μL CCK-8 solution and 90 μL blank culture medium was added to each well, and the incubation continued for 90 min. Finally, the wavelength was set to 450 nm, and the absorbance of each well was measured on an ELISA reader.

[0050] The operation steps for MCF-10A, MCF-7 and LO2 cells are the same as those for HepG2 cells.

[0051] 1.18 Imaging of HepG2, LO2, MCF-7, and MCF-10A cells HepG2 cells, LO2 cells, MCF-7 cells and MCF-10A cells were subcultured and plated on 35 mm confocal dishes. 1 mL of 2×10 4 The cells were suspended in 5% CO2 / mL cell suspension and incubated in a 37 ℃, 5% CO2 incubator overnight to allow the cells to adhere to the wall. The culture medium in each culture dish was removed with a pipette, and 1 mL of fluorescent probe dissolved in the culture medium was added to each culture dish. The cells were incubated with HepG2, LO2, MCF-7 and MCF-10A cells for 1 h, respectively. The culture medium in the confocal culture dish was discarded, and the cells were gently washed three times with saline. 1 mL of 4% paraformaldehyde was added to fix the cells for 10 min, and the cells were washed three times with saline. Then 1 mL of saline was added to maintain the cell morphology. Finally, the fluorescence distribution on the cell surface was observed using a laser confocal microscope (CLSM).

[0052] Verification 2 Characterization of Nanomaterials 2.1 Micromorphology of Fe3O4 MNPs, bCDs, gQDs, and rQDs In order to prove the successful synthesis of Fe3O4 MNPs and bCDs, TEM was used to characterize the above nanomaterials. Figure 1 A is the TEM image of Fe3O4MNPs, which shows that Fe3O4MNPs are nearly spherical with a particle size of about 13 nm. Figure 1 B is the TEM image of bCDs. The bCDs are spherical and evenly dispersed, with a particle size of about 3 nm, proving the successful synthesis of bCDs. Figure 1 C is the TEM image of gQDs, from which it can be seen that the gQDs are nearly spherical, evenly dispersed, and have a particle size of about 8 nm. Figure 1 D is the TEM image of rQDs, from which it can be seen that the rQDs are nearly spherical, evenly dispersed, and have a particle size of about 10 nm.

[0053] 2.2 Magnetic characterization of Fe3O4 MNPs The magnetic properties of the as-prepared Fe3O4 MNPs were investigated by vibrating magnetometer (VSM) at room temperature with a magnetic field scanning range from −2T to +2T. Figure 2 A shows that the hysteresis loop is an S-shaped curve and the saturation magnetization of Fe3O4 MNPs is 66.08 emu / g, indicating that the prepared Fe3O4 MNPs have good paramagnetism and can respond quickly to the external magnetic field; Figure 2 B is the sunlight image of Fe3O4 MNPs after magnetic separation and shaking. The solution became clear 30 seconds after magnetic separation. The magnetic separation speed was fast and the separation time was short, indicating that Fe3O4 MNPs had good magnetic properties and would not affect the detection process. After shaking, they were evenly dispersed again, indicating that Fe3O4 MNPs had good dispersibility in aqueous solution.

[0054] 2.3 Spectral properties of bCDs, gQDs, and rQDs The UV and fluorescence properties of bCDs, gQDs and rQDs were characterized. Figure 3 A is the UV-visible spectrum and fluorescence spectrum of bCDs. bCDs have obvious absorption at 240 nm and 352 nm, respectively. These two absorption peaks are attributed to the π-π* transition of the C=C aromatic ring structure and the n-π* transition of C=O in bCDs, respectively. Under 360 nm excitation, bCDs has a maximum fluorescence emission peak at 450 nm. As shown in the inset, bCDs is a colorless clear solution under sunlight and exhibits strong blue fluorescence under ultraviolet light. Figure 3 B is the UV-visible light spectrum and fluorescence spectrum of gQDs. Under 360 nm excitation, gQDs have a maximum fluorescence emission wavelength at 540 nm. The gQDs shown in the inset are light yellow solutions under sunlight and exhibit strong green fluorescence under ultraviolet light. They can be used as fluorescence donors to construct fluorescent probes. Figure 3 C is the UV-visible spectrum and fluorescence spectrum of rQDs. Under 360 nm excitation, rQDs have a maximum fluorescence emission wavelength at 640 nm. The inset shows that rQDs are a pale yellow solution under sunlight and exhibit strong red fluorescence under UV light. The above results show that bCDs, gQDs and rQDs have good fluorescence properties and can be used as fluorescent markers to construct single-excitation triple-emission fluorescent probes.

[0055] 3 Probe Working Principle The working principle of constructing fluorescent probes based on HCR and nanomaterials (CDs, QDs and Fe3O4 MNPs) for detecting three target proteins is as follows Figure 4 As shown. Apt Trigger consists of two parts, namely, the aptamer sequence that specifically recognizes the target protein and the trigger sequence of HCR. First, the carboxylated Fe3O4 MNPs are cross-linked with the pretreated PTK7 Apt Trigger, GPC3 Apt Trigger and MUC1 Apt Trigger through amide bonds to obtain Fe3O4-PTK7 complex, Fe3O4-GPC3 complex and Fe3O4-MUC1 complex. At the same time, the pretreated bCDs, gQDs and rQDs are connected with the pretreated PH2, GH2 and MH2 through amide bonds to obtain bCDs-PH2, gQDs-GH2 and rQDs-MH2. Subsequently, the Fe3O4-PTK7 complex, Fe3O4-GPC3 complex, Fe3O4-MUC1 complex, PH1, GH1, MH1, bCDs-PH2, gQDs-GH2 and rQDs-MH2 are mixed evenly to prepare fluorescent probes.

[0056] The prepared fluorescent probe was used to detect the tumor markers PTK7, GPC3 and MUC1 in serum. When the target protein was present in the system, it specifically bound to the corresponding Apt Trigger, the Apt Trigger conformation changed, the DNA hairpin structure opened, and the Trigger sequence originally in the DNA hairpin loop could undergo base complementary pairing with the sticky end of H1. Then H1 exposed the sequence complementary to H2 and opened the hairpin structure of H2. H2 continued to open H1, triggering continuous HCR to generate long-chain dsDNA with a gap, thereby amplifying the fluorescence signal. After magnetic separation, it was washed with pH 7.4 PBS until the supernatant had no fluorescence. The fluorescence intensity of the resuspension was measured under 360nm excitation. The contents of PTK7, GPC3 and MUC1 were positively correlated with the fluorescence intensity of bCDs, gQDs and rQDs, respectively, thereby achieving simultaneous quantification of the three targets. When the target protein was not present in the system, the hairpin DNA coexisted stably in the solution, and there was no corresponding fluorescence after magnetic separation.

[0057] 4. Feasibility verification of experimental scheme First, the fluorescence relationship between bCDs, gQDs and rQDs was studied. To detect the three targets simultaneously, the fluorescence signals corresponding to the targets should not interfere with each other. Figure 5 As can be seen from A, the fluorescence of carbon dots and quantum dots decreases after mixing, while Figure 5In B, the fluorescence of bCDs-PH2, gQDs-GH2 and rQDs-MH2 exists independently. After mixing bCDs-PH2, gQDs-GH2 and rQDs-MH2, the fluorescence intensity remains unchanged and no mutual interference occurs. This may be due to the increase in the distance between the fluorescent nanomaterials after the carbon dots, quantum dots and the corresponding DNA cross-linking. The above results show that the fluorescence of bCDs-PH2, gQDs-GH2 and rQDs-MH2 will not interfere with each other.

[0058] 5. Feasibility verification of hybridization chain reaction The hairpin DNA used in the present invention can recognize the target protein and trigger HCR. The feasibility of HCR is verified by AGE and AFM. The HCR system contains the target protein, Apt Trigger, H1 and H2. The PTK7 HCR reaction results are shown in Figure 2. Figure 6 As shown in A and 6 B, when PTK7 is present in the system, a large number of double-stranded DNA structures are produced in lane 1, indicating that PTK7-Apt Trigger binds to the target protein and triggers continuous HCR. Lane 2 represents a mixture of PTK7-Apt Trigger, PH1 and PH2. Without the addition of the target, there is no spontaneous reaction between the hairpin DNAs, which indicates that all DNA substrates can stably coexist in the reaction buffer. The bands in lanes 3-5 represent PTK7-Apt Trigger, PH1 and PH2, respectively. Figure 6 B is the AFM image of the PTK7 HCR reaction system. Under AFM, it was observed that after the target protein was added to the reaction system, a large number of micrometer-long linear assembly polymers appeared, and the polymer height was about 2 nm, which was consistent with the characteristics of double-stranded DNA. Figure 6 As shown in C, the results of lane 1 show that when the target protein GPC3 exists in the system, a large amount of double-stranded DNA is generated above the lane. The results of lane 2 show that when the system does not contain GPC3, GPC3-Apt Trigger can stably coexist with GH1 and GH2 in the reaction buffer. Lanes 3-5 represent GPC3-Apt Trigger, GH1, and GH2, respectively. Figure 6 The AFM image in D further verified the HCR reaction results in lane 1 of 6C. The AGE results of MUC1 HCR are shown in Figure 6 As shown in E, the results of lane 1 show that when the target protein MUC1 is present in the system, Apt Trigger binds to MUC1 and opens its hairpin structure, triggering HCR and generating double-stranded DNA structures of different lengths. Figure 6The AFM results of F further verified the reaction results of MUC1 HCR, and the results of lane 2 of 6E showed that when there was no target protein in the system, MUC1-Apt Trigger could stably coexist with MH1 and MH2 in the solution. The above results confirmed that the Apt Trigger used in the present invention can bind to the corresponding target protein and trigger HCR.

[0059] Secondly, the feasibility of constructing a single-excitation triple-emission fluorescent probe based on bCDs, gQDs, and rQDs for the simultaneous detection of three tumor markers was studied. Figure 7 A, 7 B, 7 C, 7 D are the fluorescence change diagrams after adding different concentrations of PTK7, GPC3 and MUC1 and adding the three at the same time. It can be seen that when adding different concentrations of PTK7, blue fluorescence is generated at 450 nm; when adding different concentrations of GPC3, green fluorescence is generated at 540 nm; when adding different concentrations of MUC1, red fluorescence is generated at 640 nm. When the three targets PTK7, GPC3 and MUC1 are added at the same time, the blue fluorescence at 450 nm, the green fluorescence at 540 nm and the red fluorescence at 640 nm are all enhanced. The results show that the fluorescence signal is only positively correlated and enhanced when its corresponding target is present, and there is no response interference between the three targets. Therefore, this fluorescent probe can be used to synchronously detect PTK7, GPC3 and MUC1.

[0060] 6 Characterization of nanomaterials after cross-linking with DNA 6.1 Characterization of spectral properties of Fe3O4-Apt Trigger, bCDs-PH2, gQDs-GH2 and rQDs-MH2 Characterize whether DNA is successfully cross-linked with the corresponding nanomaterials. Figure 8 A, 8 C, 8 E show that Fe3O4MNPs have a wide absorption in the UV-visible light spectrum, while DNA has a characteristic absorption peak at 258 nm due to the presence of the -C=C- skeleton. The prepared Fe3O4-PTK7 Apt Trigger (Fe3O4-PAT complex), Fe3O4-GPC3 Apt Trigger (Fe3O4-GAT complex) and Fe3O4-MUC1 Apt Trigger (Fe3O4-MAT complex) have both the wide absorption of magnetic ferroferric oxide nanoparticles and the characteristic absorption peak of DNA at 258 nm in the UV-visible light spectrum, indicating that Apt Trigger is successfully bound to Fe3O4 MNPs. Figure 8As shown in Figures B, 8D, and 8F, after the corresponding H2 was modified on the fluorescent nanomaterial, the characteristic ultraviolet absorption peak of DNA appeared at 258 nm, and the QDs-DNA after dialysis purification had the characteristic absorption peak of DNA. Therefore, the bCDs-PH2, gQDs-GH2, and rQDs-MH2 prepared by the present invention can be used as the fluorescence output signal of HCR for the detection of PTK7, GPC3, and MUC1.

[0061] 6.2 Magnetic Characterization of Fe3O4-Apt Trigger VSM was used to investigate whether the magnetic properties of Fe3O4 MNPs changed before and after they were connected to DNA. Fig. 9 It shows that the hysteresis loops of Fe3O4 MNPs and Fe3O4-DNA almost overlap, exhibiting superparamagnetic behavior, indicating that cross-linking of DNA with Fe3O4 MNPs has almost no effect on the magnetic properties of Fe3O4 MNPs, and Fe3O4 MNPs can be used as an efficient separator for complex matrices under the action of a magnetic field.

[0062] 7. Optimization of reaction conditions 7.1 Optimization of PTK7 detection conditions In order to achieve a better response ability of the single excitation triple emission fluorescent probe constructed by the present invention to PTK7, the detection conditions of PTK7 were optimized, including the concentration of PTK7-Apt Trigger and PTK7 cross-linking, HCR reaction time, and the reaction concentration ratio of PTK7-Apt Trigger to PH1 and PH2. When investigating the influence of various factors, the single variable method was used to calculate the fluorescence intensity I in the reaction system. 450 The stronger the fluorescence intensity, the more sensitive the fluorescent probe is to PTK7, that is, the better the sensitivity of the system.

[0063] Under the same experimental conditions, the effect of the concentration of PTK7 Apt Trigger cross-linked with PTK7 on the responsiveness of the fluorescent probe was investigated. 20 μL of 100 nM PTK7 was incubated with different concentrations of Fe3O4-PTK7 Apt Trigger (5, 10, 15, 20, 30, 40 μg / mL), and then excess H1 and H2 were added. The reaction buffer was added to 200 μL and kept at 37 °C for 1 h. After magnetic separation, the supernatant was washed with pH 7.4 PBS until there was no fluorescence. After the precipitate was resuspended in PBS, the fluorescence intensity of the solution was measured at an excitation wavelength of 360 nm. The results are shown in Fig.10As shown in A, with the increase of Fe3O4-PTK7 Apt Trigger in the reaction system, the fluorescence at 450 nm gradually increased. When the system contained 20 μg / mL Fe3O4-PTK7 Apt Trigger, the fluorescence intensity tended to be stable. Therefore, 20 μg / mL Fe3O4-PTK7 Apt Trigger was selected as the optimal reaction concentration.

[0064] Subsequently, the concentration ratio of Apt Trigger to H1 and H2 was optimized. The concentrations of H1 and H2 were the same. 100 nM PTK7 was incubated with 1 μM PTK7 Apt Trigger, and then different concentrations of H1 and H2 were added (the ratio was set to 1:1:1, 1:2:2, 1:5:5, 1:10:10), and the reaction buffer was added to 10 μL. The reaction was shaken at 37 °C for 1 h. The agarose gel results showed that the concentration of HCR products increased with the increase of the concentration ratio. Therefore, 1:2:2 was selected as the optimal concentration ratio for the reaction.

[0065] Under the same experimental conditions, the effect of HCR reaction time on the responsiveness of the fluorescent probe was investigated. 10 μL of 100 nM PTK7 was mixed with 20 μg / mL Fe3O4-PTK7 Apt Trigger, 200 nM PH1, and 40 μL bCDs-PH2, and reacted at 37 °C for different time periods (15, 30, 45, 60, 120, and 180 min). After the reaction, the supernatant was separated by magnetic separation and washed with PBS buffer until there was no fluorescence in the supernatant. The fluorescence of the supernatant was then detected at an excitation wavelength of 360 nm. Fig.10 As shown in C, within 15-60 min, as the reaction time increases, the fluorescence intensity of the system gradually increases. However, when the reaction time exceeds 60 min, the fluorescence response signal does not increase significantly. Therefore, 60 min is selected as the optimal reaction time in the experiment.

[0066] 7.2 Optimization of GPC3 detection conditions The optimization method for GPC3 detection conditions is the same as that for PTK7. Fig.11 A is the optimization result of the reaction concentration of Fe3O4-GPC3 Apt Trigger and 25 nM GPC3. With the increase of Fe3O4-GPC3 Apt Trigger concentration, the fluorescence intensity gradually increased. When the system contained 20 μg / mL Fe3O4-GPC3 Apt Trigger, the fluorescence at 540 nm tended to be stable. Therefore, 20 μg / mL Fe3O4-GPC3 Apt Trigger was selected as the optimal reaction concentration. Fig.11B is the optimization result of the concentration ratio of GPC3 Apt Trigger to GH1 and GH2. The AGE results show that with the increase of the concentration ratio of Apt Trigger to H1 and H2, the concentration of HCR product increases. Compared with other conditions, when the concentration ratio is 1:2:2, the concentration of HCR product is higher and the residual substrate of the reaction is less. Therefore, 1:2:2 is selected as the optimal concentration ratio of the reaction. Fig.11 C is the reaction time optimization result. As the reaction time increases, I 540 The fluorescence intensity was the strongest at 60 min. When the reaction time was extended, the fluorescence intensity at 540 nm remained basically unchanged. Therefore, the optimal reaction time for HCR was 60 min.

[0067] 7.3 Optimization of MUC1 detection conditions The optimization method for MUC1 detection conditions is the same as that for PTK7. Fig.12 A is the optimization result of the reaction concentration of Fe3O4-MUC1 Apt Trigger and 15 nM MUC1. With the increase of Fe3O4-MUC1 Apt Trigger concentration, the fluorescence intensity gradually increased. When the system contained 20 μg / mL Fe3O4-MUC1 Apt Trigger, the fluorescence at 640 nm tended to be stable. Therefore, 20 μg / mL Fe3O4-MUC1 Apt Trigger was selected as the optimal reaction concentration. Fig.12 B is the optimization result of the concentration ratio of MUC1 Apt Trigger to MH1 and MH2. The AGE results show that when the concentration ratio of Apt Trigger to H1 and H2 is 1:1:1, the HCR product concentration is high, but the amount of residual substrate is large and the reaction is not complete; when the concentration ratio is 1:2:2, the HCR product concentration is high and a small amount of reaction substrate remains; when the concentration ratio is 1:5:5 and 1:10:10, longer double-stranded DNA is generated, but the substrate is not completely reacted, which may be that the HCR reaction has reached saturation. Therefore, 1:2:2 is selected as the optimal concentration ratio for the reaction. Fig.12 C is the reaction time optimization result. As the reaction time increases, I 640 The fluorescence intensity gradually increases, and the fluorescence intensity is the strongest at 60 min. When the reaction time is further extended, the fluorescence intensity at 640 nm remains basically unchanged, so the optimal reaction time of HCR is 60 min. The optimal reaction conditions of the single excitation triple emission fluorescent probe prepared by the present invention for detecting PTK7, GPC3 and MUC1 are basically the same, which provides the possibility for the synchronous detection of the target.

[0068] 8 Single excitation triple emission fluorescent probe detection of PTK7, GPC3 and MUC1 8.1 PTK7 Detection Under the optimal detection conditions, the prepared fluorescent probe was used to quantitatively detect PTK7. Fig.13 As can be seen from A, with the increase of PTK7 concentration, the blue fluorescence intensity at 450 nm gradually increased, indicating that the fluorescent probe has a good fluorescence response to PTK7. 450 The PTK7 concentration can be quantified and the fluorescence intensity can be used to perform a linear fit on the logarithm of the concentration, such as Fig.13 As shown in B, there is a good linear relationship in the range of 0.02~5.0 nM, and the linear equation is I 450 = 265.50 Lg[PTK7]+729.38, r value is 0.9983, and the detection limit is 6 pM calculated according to 3σ / k (where σ is the standard deviation of the blank sample, k is the slope of the calibration curve, n = 10). The results show that the fluorescent probe prepared by the present invention has the ability to detect PTK7.

[0069] In order to explore the sensitivity of the fluorescent probe for PTK7 detection, the detection limit (LOD) of the method for detecting PTK7 in the present invention was compared with the detection limit (LOD) of the method for detecting PTK7 disclosed in the prior art. The results are shown in Table 2. Compared with other detection methods, the detection limit (LOD) of the fluorescent probe is lower or close, and the probe is simpler to prepare and easier to operate, and has greater advantages in detecting PTK7.

[0070] Table 2 Comparison of the detection limits of fluorescent probes for PTK7 detection with those reported in the literature

[0071] The accuracy and precision of its detection of PTK7 were studied. Given that the detection range was 0.02-5.0 nM, three concentrations (0.05, 1.0, and 4.0 nM) were selected to calculate the intra-day and inter-day precision and accuracy. The results are shown in Table 3. The intra-day and inter-day accuracy of the three concentrations of low, medium, and high was 96.0-103.0%, which met the detection requirements of biological samples, and the intra-day and inter-day precision RSD < 15%. The results show that the single excitation and triple emission fluorescent probe constructed by the present invention can be used for the detection of PTK7 in actual samples.

[0072] Table 3 Intra-day and inter-day precision and accuracy verification results of PTK7 determination (n=3)

[0073] 8.2 GPC3 detection Under the optimal reaction conditions, the prepared fluorescent probe was used for quantitative detection of GPC3. Fig.14As can be seen from A, with the increase of GPC3 concentration, the green fluorescence intensity at 540 nm gradually increased, indicating that the fluorescent probe has a good fluorescence response to GPC3. 540 The concentration of GPC3 can be quantified, and the fluorescence intensity can be used to make a linear fit to the logarithm of the concentration. Fig.14 As shown in B, there is a good linear relationship in the range of 0.1~20 nM, and the linear equation is I 540 = 356.33 Lg[GPC3]+510.51, r value is 0.9982, and the detection limit is 53 pM calculated according to 3σ / k (where σ is the standard deviation of the blank sample, k is the slope of the calibration curve, n=10). The results show that the synchronous detection fluorescent probe prepared by the present invention has the ability to detect GPC3.

[0074] In order to explore the sensitivity of the fluorescent probe for GPC3 detection, the detection limit (LOD) of the method for detecting GPC3 in the present invention was compared with the detection limit (LOD) of the method for detecting GPC3 disclosed in the prior art. The results are shown in Table 4. Compared with other detection methods, the detection limit (LOD) of the fluorescent probe is lower or close, and the probe is simpler to prepare and easier to operate, and has greater advantages in detecting GPC3.

[0075] Table 4 Comparison of the detection limits of fluorescent probes for GPC3 detection with those reported in the literature

[0076] The accuracy and precision of its detection of GPC3 were studied. In view of the detection range of 0.1~20 nM, three concentrations of low, medium and high (0.20, 2.00, 16.00 nM) were selected to calculate the intra-day and inter-day precision and accuracy. The results are shown in Table 5. The intra-day and inter-day accuracy of the three concentrations of low, medium and high was 98.2~102.7%, which met the detection requirements of biological samples. The intra-day and inter-day precision RSD <15%. The results show that the fluorescent probe constructed by the present invention can be used for the detection of GPC3 in actual samples.

[0077] Table 5 Intra-day and inter-day precision and accuracy verification results of GPC3 determination (n=3)

[0078] 8.3 MUC1 detection Under the optimal reaction conditions, the prepared fluorescent probe was used for quantitative detection of MUC1. Fig.15 As can be seen from A, with the increase of MUC1 concentration, the red fluorescence intensity at 640 nm gradually increased, indicating that the fluorescent probe has a good fluorescence response to MUC1. 640The MUC1 concentration can be quantified and a linear fit can be made using the fluorescence intensity versus the logarithm of the concentration, e.g. Fig.15 As shown in B, there is a good linear relationship in the range of 0.05~10 nM, and the linear equation is I 640 = 310.15 Lg[MUC1]+523.41, r value is 0.9979, and the detection limit is 29 pM calculated according to 3σ / k (where σ is the standard deviation of the blank sample, k is the slope of the calibration curve, n = 10). The results show that the synchronous detection fluorescent probe prepared by the present invention has the ability to detect MUC1.

[0079] In order to explore the sensitivity of the fluorescent probe for MUC1 detection, the detection limit (LOD) of the method for detecting MUC1 in the present invention was compared with the detection limit (LOD) of the method for detecting MUC1 disclosed in the prior art. The results are shown in Table 6. Compared with other detection methods, the detection limit (LOD) of the fluorescent probe is lower or close, and the probe is simpler to prepare and easier to operate, and has greater advantages in detecting GPC3.

[0080] Table 6 Comparison of the detection limits of fluorescent probes for MUC1 detection with those reported in the literature

[0081] The accuracy and precision of its detection of MUC1 were studied. Considering that the detection range is 0.05~10 nM, three concentrations (0.10, 1.00, 8.00 nM) were selected to calculate the intra-day and inter-day precision and accuracy. The results are shown in Table 7. The intra-day and inter-day accuracy of the three concentrations of low, medium and high is 98.7~106.4%, which meets the detection requirements of biological samples, and the intra-day and inter-day precision RSD < 15%. The results show that the synchronous fluorescent probe constructed by the present invention can be used for the detection of MUC1 in actual samples.

[0082] Table 7 Intra-day and inter-day precision and accuracy verification results of MUC1 determination (n = 3)

[0083] 8.4 Simultaneous detection of PTK7, GPC3 and MUC1 Under the optimal reaction conditions, the prepared fluorescent probes were used to simultaneously detect PTK7, GPC3 and MUC1. Fig.16 As can be seen from A, with the increase of the concentration of the three targets, the fluorescence intensities at 450 nm, 540 nm and 640 nm gradually increased, indicating that the fluorescent probe has a good fluorescence response to PTK7, GPC3 and MUC1; using the fluorescence intensity I 450 ,I 540 and I 640The concentrations of PTK7, GPC3, and MUC were quantified, and the fluorescence intensity was used to perform a linear fit on the logarithm of the concentration, as shown in Fig.16 As shown in 16B, 16C, and 16D, PTK7 has a good linear relationship in the range of 0.02 to 5 nM, and the linear equation is I 450 = 265.08 Lg[PTK7]+743.32, r value is 0.9960; GPC3 has a good linear relationship in the range of 0.1~20 nM, and the linear equation is I 540 =348.95 Lg[GPC3]+511.42, r value is 0.9981; MUC1 has a good linear relationship in the range of 0.05~10 nM, and the linear equation is I 640 = 304.98 Lg[MUC1]+519.47, r value is 0.9976. The linear results of synchronous detection of PTK7, GPC3 and MUC1 were compared with those of individual detection. The slope and correlation of the linear equation of the synchronous detection of the three target proteins were consistent with the results of individual detection of the target protein and the linear range of the target protein was consistent. The results showed that the fluorescent probe prepared by the present invention has the ability to synchronously detect PTK7, GPC3 and MUC1.

[0084] Before the fluorescent synchronous probe constructed by the present invention is used to detect the target protein in the actual serum sample, it is necessary to verify the anti-interference ability of the probe to the complex matrix in the serum and the selectivity to the target protein. The serum composition is relatively complex, containing proteins, amino acids, metal ions, etc., which may interfere with the detection results, and the synchronous detection fluorescent probe constructed by the present invention is composed of nucleic acids and nanomaterials. Therefore, it is necessary to consider whether the microRNA overexpressed in liver cancer and breast cancer will bind to the probe to trigger HCR. miRNA-21 is the most common overexpressed miRNA in cancer, and it is highly expressed in breast cancer, and miRNA-122 is specifically expressed in liver cancer. Therefore, common matrices, metal ions, and microRNAs overexpressed in liver cancer and breast cancer (K + , Ca 2+ Mg 2+ 、Na + , MB, BSA, miRNA-21, miRNA-122), and studied its selectivity and anti-interference. High concentrations of interfering substances were added to the system to verify the selectivity of the probe, such as Fig.17 As shown, the results indicate that only the target protein can trigger the corresponding HCR to produce a fluorescent signal, and the effect of metal ion interferences on the detection of the target protein is very small and can be ignored.

[0085] 9. Detection of PTK7, GPC3 and MUC1 in serum The present invention detects the content in human serum. Since the matrix composition in these biological samples is complex and may affect the determination of the probe, the standard addition method is selected to determine PTK7, GPC3 and MUC1 in human serum samples to eliminate matrix interference. The probe is used for the simultaneous detection of PTK7, GPC3 and MUC1 in the serum of breast cancer patients and liver cancer patients. The results show that the detection result of GPC3 in the serum of breast cancer patients is lower than the LOD value of this method, and the detection result of PTK7 in the serum of liver cancer patients is lower than the LOD value of the fluorescence sensing platform. Table 8 shows the results of the determination of the content of three tumor markers in the serum of breast cancer patients, and Table 9 shows the results of the determination of the content of PTK7, GPC3 and MUC1 in the serum of liver cancer patients. In order to investigate the accuracy of this method, recovery experiments were also conducted. The results are shown in Tables 8 and 9. The spiked recovery of PTK7 in the serum of breast cancer patients was in the range of 96.7-104.0%, with an RSD range of 2.0-8.7%; the spiked recovery of GPC3 was in the range of 99.0-101.0%, with an RSD range of 5.6-7.4%; the spiked recovery of MUC1 was in the range of 96.7-102.5%, with an RSD range of 4.1-9.2%. The spiked recovery of PTK7 in the serum of liver cancer patients was in the range of 99.3-103.5%, with an RSD range of 6.7-9.0%; the spiked recovery of GPC3 was in the range of 98.6-101.4%, with an RSD range of 1.9-6.0%; the spiked recovery of MUC1 was in the range of 97.1-103.7%, with an RSD range of 3.9-7.1%. The recovery rate experimental results show that the recovery rate and RSD of the detection method of the present invention meet the detection requirements of biological samples, indicating that the method is accurate and reliable and can be used for actual sample determination.

[0086] Table 8 Determination of PTK7, GPC3 and MUC1 in the serum of breast cancer patients (n = 3)

[0087] Table 9 Determination of PTK7, GPC3 and MUC1 in serum of patients with liver cancer (n = 3)

[0088] Note: ND stands for Not Detect.

[0089] The fluorescent probe was used for multi-sample detection to examine the relationship between the samples and the target protein. The results are shown in Fig.18And Table 10, there are 21 samples in total, including 5 normal serum samples, 8 liver cancer serum samples and 8 breast cancer serum samples. In normal blood samples, there are no test results due to the low content of the target protein; since the expression level of GPC3 in breast cancer is low and lower than the LOD of this method, the synchronous fluorescent probe only detects PTK7 and MUC1 in breast cancer serum samples; the synchronous detection fluorescent probe is used to detect the levels of three tumor markers in liver cancer serum, PTK7 is lowly expressed in liver cancer serum and the expression level is lower than the LOD of this method, so the single excitation three-emission fluorescent probe constructed by the present invention synchronously detects GPC3 and MUC1 in liver cancer serum samples. Fig.18 A shows that the levels of PTK7 and MUC1 in normal serum samples are much lower than the expression levels of PTK7 and MUC1 in the serum of breast cancer patients, indicating that PTK7 and MUC1 can be used as breast cancer tumor markers to distinguish normal people from breast cancer patients. Fig.18 B. The results show that the levels of GPC3 and MUC1 in the serum of liver cancer patients are significantly higher than the expression levels of GPC3 and MUC1 in normal serum, indicating that GPC3 and MUC1 can be used as liver cancer tumor markers to distinguish normal people from liver cancer patients. The above results show that the fluorescent probe prepared by the present invention can achieve the simultaneous detection of three tumor markers and the differential diagnosis of two cancers, and the differential diagnosis of different cancers can be achieved by selecting appropriate tumor markers.

[0090] Table 10 Results of simultaneous detection of three tumor markers in different serum samples 10 MCF-10A, MCF-7, LO2 and HepG2 cell imaging In order to study the application of this fluorescent probe in cell imaging, the cell safety of the fluorescent probe was systematically studied using the CCK-8 method. Fig.19 As shown in the figure, when the fluorescent probe was co-incubated with HepG2, LO2, MCF-7 and MCF-10A cells for 12 h, the cell survival rate remained above 90%, which fully demonstrated that the synchronous detection fluorescent probe constructed by the present invention has low toxicity to cells and high biosafety, and can be further used in cell experiments. Subsequently, the fluorescent probe was used for HepG2, LO2, MCF-7 and MCF-10A cell imaging. The above four cells were incubated with the fluorescent probe for 1 h and then imaged using CLSM. The results are shown in the figure. Fig. 20As shown, the MCF-7 cell surface presents obvious blue and red fluorescence signals, the HepG2 cell surface presents green and red fluorescence, and the LO2 and MCF-10A cell surfaces have almost no fluorescence signals. This is because the fluorescent probe prepared by the present invention can bind to PTK7 and MUC1 overexpressed on the MCF-7 cell surface and trigger HCR, thereby generating blue and red fluorescence; GPC3 and MUC1 overexpressed on the HepG2 cell surface can bind to the fluorescent probe and generate green and red fluorescence signals on the cell surface, while the MCF-10A and LO2 cell surfaces do not generate obvious fluorescence due to the low expression of the target protein. The results show that the synchronous detection fluorescent probe developed by the present invention binds to multiple markers on the cell surface to trigger HCR to achieve multi-target co-localization imaging. Since MUC1 is a broad-spectrum tumor marker, the fluorescent probe prepared by the present invention can also be used to detect other types of cancer.

[0091] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, a person skilled in the art should understand that it is still possible to modify the technical solutions described in the aforementioned embodiments, or to perform equivalent replacements on some of the technical features therein. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing a fluorescent probe for synchronous detection of PTK7, GPC3 and MUC1, characterized in that: The steps include: (1) adding an aqueous ammonia solution to a mixed aqueous solution of FeCl2·4H2O and FeCl3·6H2O, and performing a chemical reaction at 50-70° C. to obtain ferrosoferric oxide nanoparticles; mixing the obtained ferrosoferric oxide nanoparticles with an aqueous solution of citric acid to obtain carboxylated ferrosoferric oxide nanoparticles; (2) The carboxylated ferroferric oxide nanoparticles obtained in step (1) are activated under the action of EDC / NHS, and the activated mixed solution is cross-linked with pretreated PTK7-Apt Trigger, GPC3-Apt Trigger and MUC1-Apt Trigger to prepare Fe3O4-PAT complex, Fe3O4-GAT complex and Fe3O4-MAT complex in turn; wherein the treatment process of the pretreated PTK7-Apt Trigger, GPC3-Apt Trigger and MUC1-Apt Trigger is as follows: the PTK7-Apt Trigger, GPC3-Apt Trigger and MUC1-Apt Trigger dry powders are centrifuged respectively, dissolved in PBS buffer solution, first heated at 90-100°C for 3-8 minutes, and then cooled on ice for 1-5 minutes to obtain pretreated PTK7-Apt Trigger, GPC3-Apt Trigger and MUC1-Apt Trigger in turn. Trigger; (3) Activating the blue carbon dots under the action of EDC / NHS, and then cross-linking the activated mixed solution with the pretreated PTK7-H2 to prepare a bCDs-PH2 complex; wherein the treatment process of the pretreated PTK7-H2 is as follows: after centrifuging PTK7-H2, dissolving it in a PBS buffer solution, first heating it at 90-100°C for 3-8 minutes, and then cooling it on ice for 1-5 minutes to obtain the pretreated PTK7-H2; (4) Activating the green fluorescent CdSe / ZnS quantum dots under the action of EDC / NHS, and then cross-linking the activated mixed solution with the pretreated GPC3-H2 to prepare a gQDs-GH2 complex; wherein the treatment process of the pretreated GPC3-H2 is as follows: GPC3-H2 is centrifuged, dissolved in PBS buffer solution, first heated at 90-100°C for 3-8 minutes, and then cooled on ice for 1-5 minutes to obtain the pretreated GPC3-H2; (5) Activating the red fluorescent CdSe / ZnS quantum dots under the action of EDC / NHS, and then cross-linking with the pretreated MUC1-H2 to prepare an rQDs-MH2 complex; wherein the treatment process of the pretreated MUC1-H2 is as follows: MUC1-H2 is centrifuged, dissolved in a PBS buffer solution, first heated at 90-100°C for 3-8 minutes, and then cooled on ice for 1-5 minutes to obtain the pretreated MUC1-H2; (6) The Fe3O4-PAT complex, Fe3O4-GAT complex and Fe3O4-MAT complex prepared in step (2), the bCDs-PH2 complex prepared in step (3), the bCDs-PH2 complex prepared in step (4), the rQDs-MH2 complex prepared in step (5), PTK7-H1, GPC3-H1 and MUC1-H1 are mixed evenly to prepare a fluorescent probe; in, The sequence of PTK7-Apt Trigger is as follows: NH2-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGATTTAGGCGGCGGCGCAGC; The sequence of PTK7-H1 is as follows: CGGCGGCGCAGCATCGCCGCTGCGCCGCCGCCTAAA; The sequence of PTK7-H2 is as follows: GGCGATGCTGCGCCGCCGTTTAGGCGGCGGCGCAGC-NH2; The sequence of GPC3-Apt Trigger is as follows: NH2-TAACGCTGACCTTAGCTGCATCGCTTACATGTTCCAAGTATTGCAGCTAAGG; The sequence of GPC3-H1 is as follows: CAAGTATTGCAGCTAAGGCCAATTCCTTAGCTGCAATACTTGGAACAT; The sequence of GPC3-H2 is as follows: AATTGGCCTTAGCTGCAATACTTGATGTTCCAAGTATTGCAGCTAAGG-NH2; The sequence of MUC1-Apt Trigger is as follows: NH2-GCAGTTGATCCTTTGGATACCCTGGGGATCAACTGCACTAGGATTCTGTG; The sequence of MUC1-H1 is as follows: CTGCACTAGGATTCTGTGGGTTAACACAGAATCCTAGTGCAGTTGATC; The sequence of MUC1-H2 is as follows: TTAACCCACAGAATCCTAGTGCAGGATCAACTGCACTAGGATTCTGTG-NH2.

2. The preparation method according to claim 1, characterized in that: In step (1), the reaction temperature is 60°C; the mass ratio of FeCl2·4H2O to FeCl3·6H2O is 1.0-1.3:2.7, preferably 1.13:2.7; the mass ratio of citric acid to ferrosoferric oxide nanoparticles is 4-6:0.2, preferably 5:0.

2.

3. The preparation method according to claim 1, characterized in that: In step (2), the treatment process of the pretreated PTK7-Apt Trigger, GPC3-Apt Trigger and MUC1-Apt Trigger is as follows: the PTK7-Apt Trigger, GPC3-Apt Trigger and MUC1-Apt Trigger dry powders are centrifuged respectively, dissolved in PBS buffer solution, first heated at 95°C for 5 min, and then cooled on ice for 4 min, to obtain the pretreated PTK7-Apt Trigger, GPC3-Apt Trigger and MUC1-Apt Trigger in turn.

4. The preparation method according to claim 3, characterized in that: In step (2), the mass ratio of carboxylated ferrosoferric oxide nanoparticles, EDC and NHS is 0.2:15-20:20-25, preferably 0.2:19:22; the mass ratio of carboxylated ferrosoferric oxide nanoparticles to PTK7-Apt Trigger is 0.2:0.175-0.195, preferably 0.2:0.184; the mass ratio of carboxylated ferrosoferric oxide nanoparticles to GPC3-Apt Trigger is 0.2:0.145-0.165, preferably 0.2:0.156; the mass ratio of carboxylated ferrosoferric oxide nanoparticles to MUC1-Apt Trigger is 0.2:0.155-0.175, preferably 0.2:0.

163.

5. The preparation method according to claim 1, characterized in that: In step (3), the mass ratio of blue carbon dots, EDC and NHS is 0.2:15-20:20-25, preferably 0.2:19:22; the mass ratio of blue carbon dots to PTK7-H2 is 0.2:0.1-0.2, preferably 0.2:0.

113.

6. The preparation method according to claim 1, characterized in that: In step (4), the mass ratio of green fluorescent CdSe / ZnS quantum dots, EDC and NHS is 0.2:15-20:20-25, preferably 0.2:19:22; the mass ratio of green fluorescent CdSe / ZnS quantum dots to GPC3-H2 is 0.2:0.14-0.16, preferably 0.2:0.

150.

7. The preparation method according to claim 1, characterized in that: In step (5), the mass ratio of red fluorescent CdSe / ZnS quantum dots, EDC and NHS is 0.2:15-20:20-25, preferably 0.2:19:22; the mass ratio of red fluorescent CdSe / ZnS quantum dots to MUC1-H2 is 0.2:0.145-0.165, preferably 0.2:0.

156.

8. The preparation method according to claim 1, characterized in that: In step (6), the concentration ratio of the Fe3O4-PAT complex to the PTK7-H1 and bCDs-PH2 complex is 1:2:2; the concentration ratio of the Fe3O4-GAT complex to the GPC3-H1 and gQDs-GH2 complex is 1:2:2; the concentration ratio of the Fe3O4-MAT complex to the MUC1-H1 and rQDs-MH2 complex is 1:2:

2.

9. A fluorescent probe for synchronous detection of PTK7, GPC3 and MUC1 obtained by the preparation method according to any one of claims 1 to 8.

10. Use of the fluorescent probe for synchronous detection of PTK7, GPC3 and MUC1 according to claim 1 as a method for detecting PTK7, GPC3 and / or MUC1.

Images