Primer probe combination and kit for banana radopholus similis EmDEA isothermal fluorescence detection and application of primer probe combination and kit

Abstract

The invention provides a primer probe combination and a kit for banana radopholus similis EmDEA isothermal fluorescence detection and application of the primer probe combination and the kit, and relates to the technical field of molecular detection. The EmDEA isothermal fluorescence detection primer probe combination disclosed by the invention comprises a primer pair and an RNA (Ribonucleic Acid) fluorescence probe, the primer pair comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is as shown in SEQ ID NO. 5; the nucleotide sequence of the downstream primer is as shown in SEQ ID NO. 11; and the nucleotide sequence of the RNA fluorescent probe is as shown in SEQ ID NO. 19. The radopholus similis is detected on the basis of the primer probe combination and by adopting an enzyme-mediated double-amplification nucleic acid amplification technology, compared with traditional qPCR detection, the primer probe has the advantages of being short in detection time, high in sensitivity, high in pollution resistance and the like, and reliable technical support is provided for rapid and accurate detection of the radopholus similis.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular detection, and specifically relates to a primer-probe combination, a kit and application thereof for isothermal fluorescence detection of banana boring nematode EmDEA. Background Art

[0002] Banana nematode (Radopholus similis), also known as banana root rot, belongs to the order Rhabditida, the suborder Tylenchina, the superfamily Tylenchoidea, the family Pratylenchidae, and the genus Radopholus. It is a worldwide quarantine pest with more than 300 known hosts. It seriously harms economic crops such as banana (Musas spp.), citrus (Citrus spp.) and pepper (Piper nigrum), as well as ornamental plants such as Araceae and Marantaceae. Currently, more than 90 countries and regions have been reported to have the nematode distributed. In recent years, the import and export of flowers has become increasingly frequent. Banana nematode spreads long distances with host plants and has gradually become an important pathogen affecting the trade of plant products. Therefore, it is increasingly important to establish an accurate, rapid and sensitive molecular detection technology for banana nematode.

[0003] At present, in order to effectively prevent the entry of banana boring nematodes, the commonly used quarantine, detection and identification methods include morphological methods, isozyme methods and polymerase chain reaction methods. The morphological method requires relevant personnel to have rich experience, and due to the intraspecific variation of banana boring nematodes, the quarantine, detection and identification results of this method are often not accurate, and the time required is related to the experience of the operator; the isozyme method can only quarantine, detect and identify female insects, but not larvae and male insects, and the time required is as long as one day. The polymerase chain reaction molecular diagnosis method based on PCR can basically meet the requirements of accurate and rapid quarantine, detection and identification of banana boring nematodes. However, ordinary PCR requires electrophoresis or sequencing, which is time-consuming; qPCR requires a complex temperature change process, so it has high requirements for instruments, which hinders its application range; and the quarantine, detection and identification method using dual PCR primer amplification only takes 54 minutes, but adds a pair of primers, which correspondingly increases the cost of quarantine, detection and identification. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a primer-probe combination for isothermal fluorescence detection of banana boring nematode EmDEA, which can quickly, specifically and accurately identify whether a sample to be tested contains banana boring nematode.

[0005] Another object of the present invention is to provide a kit for isothermal fluorescence detection of banana nematode EmDEA.

[0006] Another object of the present invention is to provide a method for isothermal fluorescence detection of banana boring nematode EmDEA.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The invention provides a primer-probe combination for isothermal fluorescence detection of banana boring nematode EmDEA. The primer-probe combination comprises a primer pair and an RNA fluorescent probe; the primer pair comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.5; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.11; and the nucleotide sequence of the RNA fluorescent probe is shown in SEQ ID NO.19.

[0009] Preferably, the 5' end of the RNA fluorescent probe is labeled with a reporter group, and the 3' end is labeled with a quencher group.

[0010] The present invention also provides a kit for isothermal fluorescence detection of banana boring nematode EmDEA, comprising the primer-probe combination.

[0011] Preferably, the kit further comprises basic dry powder, activation solution and nuclease-free water.

[0012] The present invention also provides an isothermal fluorescence detection method for banana boring nematode EmDEA, comprising the following steps:

[0013] (1) Extracting DNA from the sample to be tested;

[0014] (2) using the extracted DNA as a template, using the primer-probe combination or the kit to perform enzyme-mediated dual exponential amplification nucleic acid detection;

[0015] (3) Analyze the results based on the characteristics of the detected fluorescence curve and the fluorescence signal value to determine whether banana boring nematodes are present in the sample.

[0016] Preferably, the judgment standard is: if the sample to be tested has an amplification curve and the Ct value is ≤20, it is determined that the sample contains banana boring nematodes; if the sample to be tested has no amplification curve or the Ct value is >20, it is determined that the sample does not contain banana boring nematodes.

[0017] Preferably, the reaction procedure of the enzyme-mediated dual exponential amplification nucleic acid detection is: at 40-45° C., the fluorescence signal is detected every 0.5-2 min, and the number of cycles is 20-35.

[0018] Preferably, the reaction system of the enzyme-mediated dual exponential amplification nucleic acid detection includes the following components: basic dry powder, 1 μL of 8μM to 12μM upstream primer, 1 μL of 8μM to 12μM downstream primer, 1 μL of 8μM to 12μM RNA fluorescent probe, 3 μL of template DNA, 4 μL of nuclease-free water, and 10 μL of 8μM to 12μM activation solution.

[0019] The present invention also provides an application of the primer probe set or the kit in detecting banana boring nematodes.

[0020] The present invention also provides an application of the primer probe set or the kit in preparing a product for detecting banana boring nematodes.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The EmDEA (Enzymes-mediated Duplex Exponential Amplification) isothermal fluorescence rapid detection method is an enzyme-mediated dual exponential amplification rapid nucleic acid detection technology. It achieves extremely high detection sensitivity and specificity in a short time by dual amplification of target nucleic acid and fluorescent probe through multi-enzyme collaboration. The present invention uses the banana boring nematode (Radopholus similis) ITS sequence as the target for primer design, and uses enzyme-mediated dual amplification (EmDEA) nucleic acid amplification detection technology to qualitatively detect banana boring nematodes. Compared with traditional qPCR detection, this scheme has the advantages of being fast, simple, and portable. The detection time is controlled within 30 minutes, with high sensitivity and strong anti-pollution performance, and can greatly reduce the risk of aerosol formation and overflow of amplification products leading to contamination. The present invention provides reliable technical support for the rapid and accurate detection of banana boring nematodes. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is the primary screening amplification map of the primer-probe combination of the present invention;

[0024] Figure 2 Amplification profile for screening downstream primers for the present invention;

[0025] Figure 3 Amplification profile for screening RNA probe primers of the present invention;

[0026] Figure 4 Amplification profile for screening upstream primers of the present invention;

[0027] Figure 5 It is a sensitivity test spectrum of the detection system of the present invention;

[0028] Figure 6 It is the specific test spectrum of the detection system of the present invention. DETAILED DESCRIPTION

[0029] The invention provides a primer-probe combination for isothermal fluorescence detection of banana nematode EmDEA. The primer-probe combination comprises a primer pair and an RNA fluorescent probe; the primer pair comprises an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is AAGCTAATACGACTCACTATAGGGCGACTCGGTAGGGCTGTCATCGCCTTT G (SEQ ID NO.5); the nucleotide sequence of the downstream primer is ACGAGCCGAGTGATCCACCGATAAGGCT (SEQ ID NO.11); and the nucleotide sequence of the RNA fluorescent probe is GCGCUCAUCAAGUCUUAAGCUGCCAAAG (SEQ ID NO.19).

[0030] The present invention selects the internal transcribed spacer sequence of the ribosome of the banana boring nematode, compares it with the homologous genes of similar species in GenBank, analyzes the specific sites and non-specific sites, and simultaneously screens the specific primers and fluorescent probes of the present invention with good amplification efficiency and specificity through a large number of reaction condition optimization, comparative tests and verification tests, and through a large number of actual sample detection application evaluations. In the present invention, the primer-probe combination is synthesized by Shanghai Invitrogen Biotechnology Co., Ltd.

[0031] In the present invention, the 5' end of the RNA fluorescent probe is labeled with a reporter group, and the 3' end is labeled with a quencher group. In the present invention, the 5' end labeled reporter group includes but is not limited to FAM, FITC, TET, HEX, JOE. The 5' end labeled reporter group in the present invention is further preferably a FAM group; the 3' end labeled quencher group includes but is not limited to DABCYL, TAMRA, MGB, BHQ-0, BHQ-1, BHQ-2 or BHQ-3, and the 3' end labeled quencher group in the present invention is further preferably a BHQ-1 group.

[0032] The invention designs upstream and downstream specific primers and fluorescent probes based on the ribosome ITS region fragment sequence of banana boring nematode, and performs isothermal nucleic acid amplification and rapid fluorescence detection. While the target sequence is rapidly amplified exponentially, the probe is bound to the target sequence and enzyme-mediated probe hydrolysis is initiated, the fluorescent group and the quenching group on the probe are separated, and a fluorescent signal is generated and accumulated. The molecular biological identification of the nematode is performed according to the characteristics of the fluorescence curve and the value of the fluorescence signal.

[0033] The present invention also provides a kit for isothermal fluorescence detection of banana boring nematode EmDEA, comprising the primer-probe combination.

[0034] In the present invention, the kit further comprises basic dry powder, activation solution and nuclease-free water. In the present invention, the basic dry powder preferably comprises the enzymes required for detection: DNA recombinase, shrimp alkaline phosphatase, T7 RNA polymerase, reverse transcriptase and signal amplifier enzyme freeze-dried products and freeze-dried protective agents. The activation solution is preferably a solution composed of nucleoside triphosphates (NTPs) and buffer. In the present invention, the basic dry powder and activation solution can be purchased from conventional commercial products. The basic dry powder and activation solution of the present invention were purchased from the basic fluorescent constant temperature amplification detection kit of Suzhou Jingrui Biotechnology Co., Ltd., item number RR032.

[0035] The present invention also provides an isothermal fluorescence detection method for banana boring nematode EmDEA, comprising the following steps:

[0036] (1) Extracting DNA from the sample to be tested;

[0037] (2) using the extracted DNA as a template, using the primer-probe combination or the kit to perform enzyme-mediated dual exponential amplification nucleic acid detection;

[0038] (3) Analyze the results based on the detected fluorescence signal value to determine whether banana boring nematodes are present in the sample.

[0039] In the present invention, the judgment standard is preferably: if the sample to be tested has an amplification curve and the Ct value is ≤20, it is determined that the sample contains the banana punching nematode; if the sample to be tested has no amplification curve or the Ct value is >20, it is determined that the sample does not contain the banana punching nematode. The smaller the Ct value and the larger the peak value, the better the detection effect or the higher the DNA concentration of the banana punching nematode in the sample.

[0040] In the present invention, the reaction procedure of the enzyme-mediated dual exponential amplification nucleic acid detection is preferably: under the condition of 40-45°C, the fluorescence signal is detected every 0.5-2 minutes, and the number of cycles is 20-35. In the present invention, the reaction procedure of the enzyme-mediated dual exponential amplification nucleic acid detection is more preferably: under the condition of 42°C, the fluorescence signal is detected every 1 minute, and the number of cycles is 30. In the present invention, the detection of the fluorescence signal in the sample is preferably carried out using a fluorescence detection device well known in the art or conventionally commercially available. In the present invention, it is preferred to use a fluorescence quantitative PCR instrument or a constant temperature fluorescence detector to detect the fluorescence signal in the sample. In the present invention, as an implementable method, FAM fluorescence signals are collected in each cycle, and the lighting of other fluorescence channels is turned off. The baseline period is preferably set to start at the first cycle and end at the second cycle, and a signal is collected once in each cycle.

[0041] In the present invention, the reaction system of the enzyme-mediated dual exponential amplification nucleic acid detection preferably includes the following components: basic dry powder, 1 μL of 8μM to 12μM upstream primer, 1 μL of 8μM to 12μM downstream primer, 1 μL of 8μM to 12μM RNA fluorescent probe, 3μL of template DNA, 4μL of nuclease-free water, and 10μL of 8μM to 12μM NTP activation solution. In the present invention, the concentration of the upstream primer, downstream primer, fluorescent probe and activation solution is more preferably 10μM. In the present invention, the configuration of the reaction system preferably adds the upstream and downstream primers, fluorescent probe, template, nuclease-free water and activation solution to the basic dry powder and mixes them thoroughly to obtain an isothermal amplification reaction system.

[0042] The present invention also provides an application of the primer probe set or the kit in detecting banana boring nematodes.

[0043] The present invention also provides an application of the primer probe set or the kit in preparing a product for detecting banana boring nematodes.

[0044] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0045] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0046] Example 1 Design and screening of primer-probe combinations

[0047] (I) Design of primer-probe combination

[0048] The present invention selects the internal transcribed spacer sequence of the banana nematode to design DNA primers and RNA probes, wherein the DNA primers are synthesized by Shenggong Bioengineering Co., Ltd., and the RNA probes are synthesized by Suzhou Jingrui Biotechnology Co., Ltd. The primer and probe sequences are shown in Table 1.

[0049] Table 1 Primer and probe information

[0050]

[0051]

[0052] (II) Determination of reaction system:

[0053] The experiment was carried out using the Basic Fluorescence Constant-Temperature Amplification Detection Kit (Cat. No. RR032) from Suzhou Jingrui Company, and the reaction system was constructed: 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, 1 μL of 10 μM fluorescent probe, 3 μL of 40 μM DNA template, 4 μL of nuclease-free water, 10 μL of activation solution in the Basic Fluorescence Constant-Temperature Amplification Detection Kit, and one tube of dry powder in the Basic Fluorescence Constant-Temperature Amplification Detection Kit.

[0054] (III) Reaction program setting

[0055] Use a fluorescence quantitative PCR instrument or a constant temperature fluorescence detector to collect FAM fluorescence signals in each cycle and turn off the light collection of other fluorescence channels. The baseline period is set to start from the first cycle and end at the second cycle. The signal is collected once in each cycle, and 30 cycles are collected. The reaction program is shown in Table 2:

[0056] Table 2 Reaction procedure

[0057] Reaction conditions parameter Reporting Group FAM Quenching Group BQ temperature 42℃ Detection time 1min Number of cycles 30

[0058] (IV) Result determination

[0059] If the machine detects the sample within 30 cycles and the amplification curve is present and the Ct value is ≤20, it is determined that the sample contains banana nematodes; if the sample does not have an amplification curve or the Ct value is >20, it is determined that the sample does not contain banana nematodes. The smaller the Ct value and the larger the peak of the amplification curve, the better the detection effect or the higher the DNA concentration.

[0060] (V) Screening of primer-probe combinations

[0061] The DNA of banana boring nematode was used as template, and coffee nematode, puncture nematode, wound nematode, amaryllis nematode, java root-knot nematode, aphid nematode and stem nematode were used as negative controls. Water was used as blank control group (NTC), and each blank control group had 2 replicates.

[0062] The above samples were tested using the primer-probe combination in Table 1, the reaction system in step (II), and the detection procedure in Table 2. By observing the conservation and specificity of the amplified products, the primer and fluorescent probe combination with good amplification efficiency and specificity was screened as F5R6-RNA7. The screening process is as follows:

[0063] 1. Preliminary screening of primer-probe combinations

[0064] Select RNA fluorescent probe RNA4, freely combine with upstream primers F3, F4 and downstream primers R2, R5, and amplify the map as shown Figure 1 .

[0065] like Figure 1As shown, the detection Ct value obtained by amplification with the F4R2-RNA4 primer-probe combination is the smallest, and the fluorescence value is the highest.

[0066] 2. Screening of downstream primers

[0067] Select upstream primer F4 and RNA fluorescent probe RNA4, screen 7 downstream primers R1, R2, R3, R4, R5, R6, R7, amplification map as shown Figure 2 .

[0068] like Figure 2 As shown, the detection Ct value obtained by amplification of the F4R6-RNA4 primer probe combination is the smallest and the fluorescence value is the highest, and the most preferred downstream primer is determined to be R6.

[0069] 3. Screening of RNA Primers

[0070] Select upstream primer F4 and downstream primer R6, screen 7 RNA fluorescent probes RNA1, RAN2, RAN3, RAN4, RAN5, RAN6, RAN7, and the amplification map is as follows Figure 3 .

[0071] like Figure 3 As shown, the detection Ct value obtained by the F4R6-RNA7 primer probe combination amplification is the smallest, and the end point fluorescence values ​​of the seven RNA probes are relatively close, and it is determined that the most preferred RNA fluorescent probe is RNA7.

[0072] 4. Screening of DNA upstream primers

[0073] Select downstream primer R6 and RNA fluorescent probe RNA7, screen 5 upstream primers F1, F2, F3, F4, F5, and the amplification map is as follows Figure 4 .

[0074] like Figure 4 As shown, the detection Ct value obtained by amplification of the F5R6-RNA7 primer probe combination is smaller, the end point fluorescence values ​​of F1, F4, and F5 are closer, and the fluorescence curves of the two samples of F5 are closer and the results are more stable, so the most preferred upstream primer is determined to be F5.

[0075] In summary, the optimal primer fluorescent probe combination, F5R6-RNA7, was screened out from the initial primer-probe combination of 5 DNA upstream primers, 7 DNA downstream primers, and 7 RNA primers.

[0076] Example 2

[0077] A kit for isothermal fluorescence detection of banana radial nematode EmDEA comprises the F5R6-RNA7 primer-probe combination screened in Example 1, basic dry powder, 10 μM activation solution and nuclease-free water; wherein the concentration of the upstream primer in the F5R6-RNA7 primer-probe combination is 10 μM, the concentration of the downstream primer is 10 μM, and the concentration of the RNA fluorescent probe is 10 μM.

[0078] Example 3 Sensitivity Detection Test of Primer Probe Set System

[0079] In this example, the sensitivity of the optimal primer-probe combination obtained by screening in Example 1 was tested. The specific steps were as follows: a single genomic DNA of the banana nematode was extracted, and the genomic DNA was diluted 10 times, 100 times, 1000 times, 10000 times, and 100000 times with nuclease-free water, and then the sensitivity was tested. The amplification map was as shown in FIG. Figure 5 shown.

[0080] like Figure 5 As shown, when a single banana boring nematode is diluted to 100 times, it can still be stably detected by the optimal F5R6-RNA7 primer-probe combination and detection method screened by the present invention, and has high sensitivity.

[0081] Example 4 Specificity detection test of primer-probe combination

[0082] This example uses the optimal primer-probe combination screened in Example 1 to detect 13 species of nematodes, and the steps are as follows:

[0083] The genomic DNA of 13 nematodes was obtained, and the genomic DNA was used as a template to perform constant temperature fluorescence quantitative detection using the optimal primer probe combination, reaction system and reaction program screened in Example 1. At the same time, NTC was set as a control group, and two groups of positive samples were repeated. The information of the 13 nematodes is shown in Table 3.

[0084] Table 3 Information on 13 species of nematodes

[0085]

[0086]

[0087] Note: 1-6 are positive samples, 7-13 are negative samples, two groups were repeated; Ct value is the average of two repeats

[0088] according to Figure 6As can be seen from Table 3, positive samples all show obvious amplification curves and Ct values. Therefore, the judgment standard of the present invention is that if the test sample shows an amplification curve and the Ct value is ≤20 within 30 cycles, it is determined that the banana punching nematode exists in the sample; if the test sample has no amplification curve or the Ct value is >20, it is determined that the banana punching nematode does not exist in the sample. The smaller the Ct value and the larger the peak value of the amplification curve, the better the detection effect or the higher the DNA concentration.

[0089] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer-probe combination for isothermal fluorescence detection of banana nematode EmDEA, characterized in that: The primer-probe combination includes a primer pair and an RNA fluorescent probe; the primer pair includes an upstream primer and a downstream primer; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.5; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.11; and the nucleotide sequence of the RNA fluorescent probe is shown in SEQ ID NO.

19.

2. The primer-probe combination according to claim 1, characterized in that: The 5' end of the RNA fluorescent probe is labeled with a reporter group, and the 3' end is labeled with a quencher group.

3. A kit for isothermal fluorescence detection of banana nematode EmDEA, characterized in that: Comprising the primer-probe combination of claim 1 or 2.

4. The kit according to claim 3, characterized in that The kit also includes basic dry powder, activation solution and nuclease-free water.

5. A method for isothermal fluorescence detection of banana nematode EmDEA, characterized in that: The steps include: (1) Extracting DNA from the sample to be tested; (2) using the extracted DNA as a template, and performing enzyme-mediated dual exponential amplification nucleic acid detection using the primer-probe combination of claim 1 or 2, or the kit of claim 3 or 4; (3) Analyze the results based on the characteristics of the detected fluorescence curve and the fluorescence signal value to determine whether banana boring nematodes are present in the sample.

6. The method according to claim 5, characterized in that The judgment standard is: if the sample to be tested has an amplification curve and the Ct value is ≤20, it is determined that the sample contains banana boring nematodes; if the sample to be tested has no amplification curve or the Ct value is >20, it is determined that the sample does not contain banana boring nematodes.

7. The method according to claim 5, characterized in that The reaction procedure of the enzyme-mediated dual exponential amplification nucleic acid detection is: under the condition of 40-45° C., the fluorescence signal is detected every 0.5-2 minutes, and the number of cycles is 20-35.

8. The method according to claim 5, characterized in that The reaction system of the enzyme-mediated dual exponential amplification nucleic acid detection includes the following components: basic dry powder, 1 μL of 8μM to 12μM upstream primer, 1 μL of 8μM to 12μM downstream primer, 1 μL of 8μM to 12μM RNA fluorescent probe, 3 μL of template DNA, 4 μL of nuclease-free water, and 10 μL of 8μM to 12μM activation solution.

9. Use of the primer-probe set according to any one of claims 1 to 2 or the kit according to any one of claims 3 to 4 in detecting banana boring nematodes.

10. Use of the primer-probe set according to any one of claims 1 to 2 or the kit according to any one of claims 3 to 4 in the preparation of a product for detecting banana nematode.

Images