Serum / plasma miRNA extraction kit and method based on DNase I enzyme treatment

Abstract

The invention provides a DNase I enzyme treatment-based serum / plasma miRNA extraction kit and a DNase I enzyme treatment-based serum / plasma miRNA extraction method. In the miRNA extraction process, according to optimized experimental conditions, parameters such as the dosage of DNase I enzyme, reaction time and the like are accurately controlled, it is ensured that DNA is efficiently removed, and meanwhile selective adsorption and elution are conducted on miRNA through a special adsorption column and two kinds of washing liquid subsequently. The operations ensure that the extracted miRNA has high purity while ensuring that the miRNA is reserved to the maximum extent, the influence of other impurities and residual DNA on the miRNA is reduced to the maximum extent, and the amplification performance of the low-abundance miRNA is remarkably improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of miRNA extraction, and relates to a serum / plasma miRNA extraction kit and method based on DNase I enzyme treatment. Background Art

[0002] With the continuous deepening of molecular biology research, miRNA, as an important biomarker, has shown great application potential in the fields of disease diagnosis, treatment monitoring, and drug development. Accurate extraction of miRNA and effective detection are crucial for a deep understanding of its biological functions and clinical applications.

[0003] There are many miRNA extraction kits on the market, which use different technical principles and methods in the miRNA extraction process. For example, some kits are based on the principle of column adsorption, using special adsorption materials to selectively adsorb and elute miRNA; some kits use organic solvent extraction methods to separate and enrich miRNA through the polarity differences of different organic solvents. However, these existing extraction kits still have some shortcomings in practical applications. For example, organic solvents are easy to cause harm to the human body; the extracted miRNA has low purity and is prone to miRNA degradation; and it is also very important that traditional miRNA extraction kits do not effectively remove DNA during the extraction process, which may interfere with subsequent qPCR detection. In practical applications, this DNA interference may manifest as poor amplification performance of some miRNA targets (Ct is usually greater than 35 or even NoCt phenomenon). This is because qPCR detection is based on the principle of specific amplification of nucleic acids. The presence of DNA may compete with miRNA for primer binding sites, or produce non-specific amplification products, thereby affecting the accuracy and reliability of the test results. This phenomenon not only affects the accuracy and reliability of the test results, but also has a negative impact on the stability of the entire test process, such as the inability to conduct effective data analysis, disease diagnosis model establishment, and model verification. Therefore, it is necessary to further develop an extraction technology that can provide high-quality miRNA nucleic acids. Summary of the invention

[0004] In view of the above problems, the present invention proposes a serum / plasma miRNA extraction kit and method based on DNase I enzyme treatment.

[0005] The technical solution adopted by the present invention to achieve the technical purpose is: The present invention provides a serum / plasma miRNA extraction kit based on DNase I enzyme treatment, comprising: a lysis binding solution, proteinase K, a washing solution 1, a washing solution 2, a DNase I enzyme, a DNase I enzyme buffer and an eluent, wherein: The lysis and binding solution comprises: 0.18%~0.30% (m / V) CTAB, 0.36%~0.73% (m / V) sodium citrate anhydrous, 0.009%~0.018% (m / V) dextran 20,000, 10~20mM Tris-HCl at pH7.5, 3.5~7mM EDTA at pH8.0, 2.9~3.2M guanidine hydrochloride, 50%~60% (V / V) isopropanol, and the pH of the lysis and binding solution is 8.0±0.05; The washing solution 1 comprises: 5-20 mM Tris-HCl at pH 7.5, 4-10 mM EDTA at pH 8.0, 1-2 M guanidine hydrochloride, 0.4%-0.8% (m / V) anhydrous sodium citrate, 0.1-1 M sodium chloride, and 60% (V / V) anhydrous ethanol; The washing solution 2 comprises: 6-10 mM Tris-HCl at pH 7.5, 70% (V / V) anhydrous ethanol; The elution solution includes nuclease-free water to which phenol red reagent is added.

[0006] In this application, "m / V" represents the mass volume ratio of a component in a solution (g / mL), "V / V" represents the volume percentage of a component in a solution, and "mM" / "M" represents the working concentration of a component in a solution (in mmol / L or mol / L).

[0007] Preferably, an elution column is also included, and the elution column is a silica gel membrane centrifugal adsorption column. More preferably, the inner diameter of the silica gel membrane is 5.1 mm, which can efficiently adsorb RNA.

[0008] The present invention also provides a method for extracting serum / plasma miRNA based on DNase I enzyme treatment, comprising: 1) Add lysis binding buffer and proteinase K to serum / plasma samples for lysis; 2) adding anhydrous ethanol to the lysate obtained in step 1) for alcohol precipitation, then adding DNase I enzyme and DNase I enzyme buffer, and incubating at 37°C; 3) adding the mixed solution obtained in step 2) into the elution column, and eluting with washing solution 1 and washing solution 2 respectively; 4) Finally, add elution solution to the center of the elution column to elute the miRNA solution.

[0009] Preferably, in step 1), the volume ratio of the serum / plasma sample, lysis binding solution and proteinase K is 10:20:1.

[0010] Preferably, step 1) comprises: adding lysis binding solution and proteinase K, vortexing thoroughly to mix, centrifuging briefly, and then standing at 65° C. for 10 min.

[0011] Preferably, in step 2), 1-7 U DNase I enzyme is added and incubated at 37° C. for 5-20 min.

[0012] More preferably, in step 2), 5 U of DNase I enzyme is added and incubated at 37° C. for 15 min.

[0013] Preferably, in step 2), the volume ratio of the added DNase I enzyme to the DNase I enzyme buffer is 1:1.

[0014] Preferably, step 3) comprises: adding the mixed solution obtained in step 2) to the elution column, and centrifuging at 12000rpm for 1min; placing the elution column back into the collection tube, adding washing solution 1, and centrifuging at 12000rpm for 30sec, and discarding the filtrate; placing the elution column back into the collection tube, adding 500µL washing solution 2, and centrifuging at 12000rpm for 30sec, and discarding the filtrate; placing the elution column back into the collection tube, and centrifuging at 12000rpm for 2min to remove the residual liquid.

[0015] Preferably, step 4) comprises: placing the elution column in a new enzyme-free (DNase / RNase-free) centrifuge tube, adding elution solution to the center of the elution column, leaving it at room temperature for 2 minutes, centrifuging it at 12000 rpm for 1 minute, and collecting the filtrate, which is the miRNA solution.

[0016] The beneficial effects of the present invention are: In view of the fact that organic solvents are easy to cause harm to the human body, the present invention uses high-concentration guanidine salts to lyse the sample, ensuring that the sample is not easy to cause harm to the human body under the premise of sufficient lysis; in view of the low purity of miRNA and the influence of residual DNA on subsequent qPCR detection, the present invention adds a DNase I enzyme treatment step to the miRNA extraction kit to remove DNA. During the extraction process, according to the optimized experimental conditions, the dosage of DNase I enzyme, reaction time and other parameters are accurately controlled to ensure that DNA is efficiently removed. This operation ensures that the extracted miRNA has high purity while ensuring that miRNA is retained to the greatest extent, and minimizes the influence of residual DNA on miRNA. After such treatment, subsequent qPCR detection is performed.

[0017] After verification using qPCR experiments, it was found that some low-abundance miRNAs in the nucleic acids extracted by conventional miRNA extraction kits (without DNase I enzyme digestion) had an amplification Ct greater than 35 or even showed NoCt. After adding a DNase I enzyme treatment step in the miRNA extraction reagent process, the amplification performance of these low-abundance miRNAs was significantly improved.

[0018] 1. Accurate detection of ultra-low abundance miRNA When faced with ultra-low abundance miRNA, existing test kits are often unable to accurately detect its weak signals due to various interference factors in the extraction process, resulting in large deviations in results or even missed detections. The present invention reduces the interference of DNA and other impurities on qPCR detection through an optimized DNase I enzyme treatment process, combined with a special elution column and washing liquid system, and can greatly reduce background noise, allowing the signals of ultra-low abundance miRNA to stand out. For example, in the detection of ultra-low abundance miRNA specific to certain early tumors, this kit can detect signals that conventional kits cannot detect, improving the accuracy of the entire miRNA detection and providing new possibilities for early tumor diagnosis.

[0019] 2. Enhance the stability of the entire testing process The problem of unstable test results caused by poor amplification performance of low-abundance miRNA has been solved, making the results of each test more consistent and improving the stability of subsequent products based on miRNA amplification performance testing in different batches and under different experimental conditions. In the process of establishing a disease diagnosis model, a more accurate and reliable diagnostic model can be built based on stable miRNA expression data, improving the accuracy and specificity of disease diagnosis. In the model verification stage, stable test results can also ensure the effectiveness and reliability of the verification process, accelerate the optimization and improvement of the model, and ultimately promote the rapid development of the entire disease diagnosis and research field.

[0020] 3. Achieved a balance between high and low abundance miRNA detection While not affecting the amplification performance of high-abundance miRNA, the detection sensitivity of low-abundance miRNA is effectively improved. This allows the precise expression of high-abundance miRNA to be accurately obtained and the signal of low-expression miRNA to be reliably detected in one test. This enables the kit to always maintain stable and efficient performance when facing complex and diverse clinical samples. Whether it is a sample in a normal physiological state or a sample with drastic changes in miRNA expression during disease progression, the subsequent qPCR method can accurately detect low-abundance miRNA, providing strong support for accurate diagnosis and treatment monitoring of diseases.

[0021] 4. Ensure human safety In the design of the kit, other materials that come into contact with samples and operators are optimized. For example, the material of the adsorption column is a new polymer material with good biocompatibility. This material not only has a highly selective adsorption capacity for miRNA, but also does not release harmful substances during contact with the sample, nor does it cause nonspecific adsorption or denaturation of biological molecules in the sample.

[0022] In the process of developing the reagent formula, in addition to using high-concentration guanidine salts to replace organic solvents, a harmless reagent formula was also developed. On the premise of ensuring the performance of the kit, the formulas of various reagents were optimized, ingredients that may be harmful to the human body were removed, and some additives with biological protection effects were added. For example, antioxidants were added to the lysis and binding solution to prevent the biological molecules in the sample from being oxidized and damaged during the lysis process, while also reducing the oxidative stress hazards that operators may suffer when they come into contact with the lysis and binding solution. This comprehensive harmless design makes this kit safer and more reliable during use, providing better occupational health protection for operators. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The extraction technology route of Example 4 of the present invention.

[0024] Figure 2 Comparison of amplification curves of the hsa-miR-206 target in Examples 1, 2, 3, and 4.

[0025] Figure 3 Ct values ​​of hsa-miR-206 target in Examples 1, 2, 3, and 4.

[0026] Figure 4 Comparison of amplification curves of hsa-miR-206 target in four enzyme addition groups: ①: 1U enzyme; ②: 3U enzyme; ③: 5U enzyme; ④: 7U enzyme.

[0027] Figure 5 Ct values ​​of hsa-miR-206 target in four enzyme addition groups.

[0028] Figure 6 Comparison of amplification curves of hsa-miR-206 target in four DNase I digestion time groups: ①: 5min; ②: 10min; ③: 15min; ④: 20min.

[0029] Figure 7 Ct values ​​of hsa-miR-206 targets in four DNase I digestion time groups. DETAILED DESCRIPTION

[0030] In order to explain the present invention more clearly, the present invention is further described in detail below in conjunction with embodiments and with reference to the accompanying drawings. It should be understood by those skilled in the art that the content described below is illustrative rather than restrictive, and should not be used to limit the scope of protection of the present invention.

[0031] In the following examples, the main reagents and materials used are: lysis binding solution, washing solution 1, washing solution 2, elution column (Merrick MI00101), proteinase K (Hanhai New Enzyme Biotechnology Co., Ltd. HH4502-01), DNase I enzyme (1U / ul; with 10 × reaction buffer (10 × Reaction Buffer); Nanjing Novozyme Biotechnology Co., Ltd. EN401). The serum samples used were obtained through legal channels. Other commercially available products can be used unless otherwise specified. Example 1: No DNase I digestion during extraction

[0032] The extraction steps are as follows: (1) Transfer 100 μL of serum sample to a 1.5 mL DNase / RNase-free centrifuge tube.

[0033] (2) Add 200 μL of lysis binding solution and 10 μL of proteinase K respectively, vortex thoroughly to mix, and then centrifuge briefly (4000 rpm / s, 3 seconds).

[0034] (3) After standing at 65°C for 10 min, cool to room temperature.

[0035] (4) Place the elution column into the collection tube and set aside.

[0036] (5) Add 600 μL of anhydrous ethanol to the 1.5 mL DNase / RNase-free tube in step (3), vortex to mix, and finally add the mixture to the elution column in step (4), centrifuge at 12,000 rpm for 1 min, and discard the filtrate.

[0037] Note: The maximum loading capacity of the elution column is 700 μL, which can be centrifuged multiple times.

[0038] (6) Place the elution column back into the collection tube, add 500 μL of wash solution 1, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.

[0039] (7) Place the elution column back into the collection tube, add 500 µL of wash solution 2, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.

[0040] (8) Repeat step (7).

[0041] (9) Place the elution column back into the collection tube and centrifuge at 12,000 rpm for 2 min to remove any residual liquid.

[0042] (10) Place the elution column in a new 1.5 mL DNase / RNase-free centrifuge tube, add 60 µL of RNase-free H2O to the center of the elution column 1, and leave at room temperature for 2 min.

[0043] (11) Centrifuge at 12000 rpm for 1 min. Collect the filtrate, which is the miRNA solution. Example 2: DNase I digestion after lysis step

[0044] The difference between this embodiment and embodiment 1 is that step (2) is: Add 200 μL of lysis binding solution and 10 μL of proteinase K respectively, vortex thoroughly to mix, and then centrifuge briefly. Add 5 μL (5 U) DNase I enzyme and 5 μL (buffer volume corresponding to 5 U enzyme) DNase I enzyme buffer to the lysis mixture, and incubate at 37°C for 15 min.

[0045] The other steps are exactly the same as those in Example 1. Example 3: DNase I digestion on an adsorption column

[0046] The difference between this embodiment and embodiment 1 is that step (5) is: Add 600 μL of anhydrous ethanol to the 1.5 mL DNase / RNase-free tube in step (3), vortex to mix, and finally add the mixture to the elution column in step (4). Centrifuge at 12,000 rpm for 1 min, discard the filtrate, and add a mixture of 5 μL (5 U) DNase I enzyme and 5 μL (the amount of buffer corresponding to 5 U enzyme) DNase I enzyme buffer to the center of the membrane of the adsorption column, and incubate at 37°C for 15 min.

[0047] Note: The maximum loading capacity of the elution column is 700 μL, which can be centrifuged multiple times. After all centrifugations are completed, DNase I digestion can be performed on the adsorption column.

[0048] The other steps are exactly the same as those in Example 1. Example 4: DNase I digestion after alcohol precipitation step

[0049] The difference between this embodiment and embodiment 1 is that step (5) is: Add 600 μL of anhydrous ethanol to the 1.5 mL DNase / RNase-free tube in step (3), vortex to mix, add 5 μL (5 U) DNase I enzyme and 5 μL (the amount of buffer corresponding to 5 U enzyme) DNase I enzyme buffer, incubate at 37°C for 15 min, and finally add the mixture to the elution column in step (4), centrifuge at 12,000 rpm for 1 min, and discard the filtrate.

[0050] The other steps are exactly the same as those in Example 1.

[0051] The technical route of this embodiment can be seen Figure 1 . Example 5: DNase I enzyme addition test

[0052] The difference between this embodiment and embodiment 1 is that step (5) is: Add 600 μL of anhydrous ethanol to the 1.5 mL DNase / RNase-free tube in step (3), vortex to mix, add different concentrations of DNase I enzyme (1U, 3U, 5U, 7U) and the corresponding amount of DNase I enzyme buffer according to Table 1, incubate at 37°C for 15 min, and finally add the mixed solution to the elution column in step (4), centrifuge at 12000 rpm for 1 min, and discard the filtrate.

[0053] Table 1 Different concentrations of DNase I and corresponding buffer volumes

[0054] The other steps are exactly the same as those in Example 1. Example 6: DNase I enzyme digestion time test

[0055] The difference between this embodiment and embodiment 1 is that step (5) is: Add 600 μL of anhydrous ethanol to the 1.5 mL DNase / RNase-free tube in step (3), vortex to mix, add 5 μL (5 U) DNase I enzyme and 5 μL (the amount of buffer corresponding to 5 U enzyme) DNase I enzyme buffer, incubate at 37°C (gradient test according to the digestion time in Table 2: 5, 10, 15, 20 min), and finally add the mixture to the elution column in step (4), centrifuge at 12000 rpm for 1 min, and discard the filtrate.

[0056] Table 2 DNase I digestion time in different experimental groups

[0057] The other steps are exactly the same as those in Example 1. Test Case

[0058] Taking hsa-miR-206 as an example, the miRNA extracted from Examples 1 to 6 was detected and data analyzed according to the following method: 1. Design primers and probes The miRNA target used in this test example is hsa-miR-206, whose sequence is: UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO.1). The primer probe information designed based on its sequence is shown in the following table: Table 3 Primer and probe information of hsa-miR-206

[0059] 2. RT and qPCR experiments (1) Prepare the RT reaction solution according to the system in Table 4, add it to a 0.2 mL PCR tube or 96-well plate, cover the tube or seal the 96-well plate with film, mix well, and centrifuge.

[0060] Table 4 RT reaction system

[0061] (2) Turn on the PCR instrument, insert the PCR tube or 96-well plate to be loaded, set the reverse transcription reaction program according to Table 5, set the reaction volume to 10 μL, and start the instrument.

[0062] Table 5 Reverse transcription procedure

[0063] (3) Prepare qPCR reaction solution according to the system in Table 6, add it to a 0.2 mL PCR tube or 96-well plate, cover the tube or seal the 96-well plate with film, mix well, and centrifuge.

[0064] Table 6 qPCR reaction system

[0065] (4) Turn on the PCR instrument, insert the PCR tube or 96-well plate to be loaded, set the qPCR reaction program according to Table 7, set the reaction volume to 20 μL, and start the instrument.

[0066] Table 7 qPCR program

[0067] 3. Data Analysis (1) Set the amplification curve algorithm to the absolute fluorescence value method.

[0068] (2) Uncheck the automatic threshold and manually adjust the threshold line to the beginning of the exponential growth phase of the amplification curve.

[0069] (3) Export data: Click Analyze and the software will automatically perform analysis. Select all sample data and click Export experimental data for analysis.

[0070] A comparison of the amplification curves of the hsa-miR-206 target in Examples 1, 2, 3, and 4 is shown in Figure 2 (The serial number on the curve corresponds to the example number), and the Ct in the four examples is arranged from large to small as follows: Example 1> Example 2> Example 3> Example 4, see Figure 3 .

[0071] The comparison of the amplification curves of the hsa-miR-206 target in the four enzyme addition groups is shown in Figure 4 The Ct of the four enzyme addition groups is arranged from large to small as follows: 1U enzyme amount>3U enzyme amount>7U enzyme amount>5U enzyme amount, see Figure 5 .

[0072] The comparison of the amplification curves of the hsa-miR-206 target in the four DNase I digestion time groups is shown in Figure 6 The Ct of each miRNA target in the four DNase I enzyme digestion time groups is arranged from large to small: 5min>20min>10min>15min.

[0073] Based on the results of the six examples, the best DNA removal effect was achieved by adding ethanol for alcohol precipitation followed by DNase I digestion, and the digestion conditions were 5 U of enzyme and 5 μL of buffer for 15 min at 37° C., that is, the amplification performance of certain low-abundance miRNAs was improved the most.

[0074] Obviously, the above embodiments of the present invention are merely examples to more clearly illustrate the present invention, and are not limitations on the implementation methods of the present invention. For ordinary technicians in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is impossible to list all the implementation methods here. All obvious changes or modifications derived from the technical solution of the present invention are still within the protection scope of the present invention.

Claims

1. A serum / plasma miRNA extraction kit based on DNase I enzyme treatment, characterized in that: include: Lysis and binding solution, proteinase K, washing solution 1, washing solution 2, DNase I enzyme, DNase I enzyme buffer and elution solution, wherein: The lysis and binding solution comprises: 0.18% to 0.30% CTAB, 0.36% to 0.73% sodium citrate anhydrous, 0.009% to 0.018% dextran 20,000, 10 to 20 mM Tris-HCl at pH 7.5, 3.5 to 7 mM EDTA at pH 8.0, 2.9 to 3.2 M guanidine hydrochloride, and 50% to 60% isopropanol, and the pH of the lysis and binding solution is 8.0 ± 0.05; The washing solution 1 comprises: 5-20 mM Tris-HCl at pH 7.5, 4-10 mM EDTA at pH 8.0, 1-2 M guanidine hydrochloride, 0.4%-0.8% anhydrous sodium citrate, 0.1-1 M sodium chloride, and 60% anhydrous ethanol; The washing solution 2 comprises: 6-10 mM Tris-HCl at pH 7.5, 70% anhydrous ethanol; The elution solution includes nuclease-free water to which phenol red reagent is added.

2. The serum / plasma miRNA extraction kit based on DNase I enzyme treatment according to claim 1, characterized in that: It also includes an elution column, which uses a silica gel membrane centrifugal adsorption column.

3. A method for extracting serum / plasma miRNA based on DNase I enzyme treatment, characterized in that: include: 1) Add lysis binding buffer and proteinase K to serum / plasma samples for lysis; 2) adding anhydrous ethanol to the lysate obtained in step 1) for alcohol precipitation, then adding DNase I enzyme and DNase I enzyme buffer, and incubating at 37°C; 3) adding the mixed solution obtained in step 2) into the elution column, and eluting with washing solution 1 and washing solution 2 respectively; 4) Finally, add elution solution to the center of the elution column to elute the miRNA solution.

4. The method for extracting serum / plasma miRNA based on DNase I enzyme treatment according to claim 3, characterized in that: In step 1), the volume ratio of the serum / plasma sample, lysis binding solution and proteinase K is 10:20:

1.

5. The method for extracting serum / plasma miRNA based on DNase I enzyme treatment according to claim 3 or 4, characterized in that: Step 1) includes: adding lysis binding solution and proteinase K to the serum / plasma sample, vortexing thoroughly to mix, centrifuging briefly, and then standing at 65°C for 10 minutes.

6. The method for extracting serum / plasma miRNA based on DNase I enzyme treatment according to claim 3, characterized in that: In step 2), add 1-7 U DNase I and incubate at 37°C for 5-20 min.

7. The method for extracting serum / plasma miRNA based on DNase I enzyme treatment according to claim 6, characterized in that: In step 2), add 5 U of DNase I enzyme and incubate at 37°C for 15 min.

8. The method for extracting serum / plasma miRNA based on DNase I enzyme treatment according to claim 3 or 6, characterized in that: In step 2), the volume ratio of the added DNase I enzyme to the DNase I enzyme buffer is 1:

1.

9. The method for extracting serum / plasma miRNA based on DNase I enzyme treatment according to claim 3, characterized in that: Step 3) includes: adding the mixed solution obtained in step 2) to the elution column, centrifuging at 12000rpm for 1min; returning the elution column to the collection tube, adding washing solution 1, centrifuging at 12000rpm for 30sec, and discarding the filtrate; returning the elution column to the collection tube, adding 500µL washing solution 2, centrifuging at 12000rpm for 30sec, and discarding the filtrate; returning the elution column to the collection tube, centrifuging at 12000rpm for 2min to remove the residual liquid.

10. The method for extracting serum / plasma miRNA based on DNase I enzyme treatment according to claim 3, characterized in that: Step 4) includes: placing the elution column into a new enzyme-free centrifuge tube, adding elution solution to the center of the elution column, leaving it at room temperature for 2 minutes, centrifuging it at 12000 rpm for 1 minute, and collecting the filtrate, which is the miRNA solution.

Images