Method for inducing formation of seedless fruits of crops and application
By overexpressing the apple miR156 gene, the plant monosexual fruiting is promoted, and the problems of time-consuming and labor-intensive in the prior art induction of monosexual fruiting are solved, and the unisual fruiting rate and fruit quality are significantly improved, and new gene resources are provided.
Patent Information
- Application Number
- CN202411578605.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-07
- Publication Date
- 2024-12-27
AI Technical Summary
In the prior art, using plant growth regulators to induce single-sex fruits is time-consuming and labor-intensive, the production cost is high, and it is easy to produce deformed fruits, resulting in fewer single-sex fruit varieties, and the function of miR156 in single-sex fruits in plant single-sex fruits is not clear, affecting seedlessness. Fruit cultivation.
By overexpressing the apple miR156 gene, it uses it to form a folded structure in the plants to promote monosexual solidification, and construct an overexpression vector containing the apple miR156 gene, introduced into the plants through Agrobacterium mediated method, and de-column treatment was performed to improve monosexual solid Solid rate.
It significantly improves the monosexual fruiting rate of plants such as apples and tomatoes, provides new genetic resources, promotes the cultivation of seedless fruits, and improves the edible rate and quality of the fruits.
Smart Images
Figure CN119193598A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a method for inducing the formation of seedless fruits of crops and an application thereof. Background Art
[0002] Parthenocarpy refers to the phenomenon that the ovary produces seedless fruits without pollination and fertilization. Generally speaking, the ovary will develop into a fruit only after successful pollination and fertilization. If the pollination or fertilization process is disturbed by environmental factors, the ovary will stop developing and fall off. Parthenocarpy is an important horticultural trait. It makes fertilization no longer a necessary condition for fruit development and can produce seedless fruits. Therefore, it plays an important role in production practice: on the one hand, the parthenocarpy trait can ensure the fruiting of horticultural plants under adverse conditions; on the other hand, because parthenocarpic fruits develop into seedless fruits, the edible rate and quality of the fruits are improved, and the storage resistance of the fruits is better.
[0003] At present, there are still few parthenocarpic varieties in production. In early spring and in facility cultivation, plant growth regulators are used to overcome environmental adversity and form parthenocarpic fruits. However, the induction of parthenocarpy by growth regulators is time-consuming and labor-intensive, with high production costs, and is prone to produce deformed fruits, which reduces the commercial quality of the fruit. Therefore, the use of molecular biological methods to isolate and clone parthenocarpic genes is of great significance for the selection and breeding of parthenocarpic varieties.
[0004] As a small non-coding RNA, miRNA is widely present in plants and plays an important regulatory role in various biological metabolic processes of plants by regulating the expression of related target genes. Recent studies have found that miR156 may play a role in the transition from juvenile to adult stage of plants and can regulate the transition time from juvenile to adult stage. However, the function of miR156 in plant parthenocarpy is still unclear. Therefore, how to use the miRNA multifunctional toolbox to improve the parthenocarpy rate of plants is one of the hot research topics in the agricultural field. Summary of the invention
[0005] In view of the above prior art, the purpose of the present invention is to provide a method and application of inducing seedless fruit formation in crops. The present invention has found that overexpression of apple miR156 gene can increase the parthenocarpy rate of plants, which is beneficial to the cultivation of seedless fruit plant varieties.
[0006] To achieve the above object, the present invention adopts the following technical solution:
[0007] The first aspect of the present invention provides the use of the apple miR156 gene in the following (1) or (2):
[0008] (1) Promote plant parthenocarpy;
[0009] (2) Cultivating plant varieties with seedless fruits;
[0010] The nucleotide sequence of the apple miR156 gene is shown in SEQ ID NO.1.
[0011] In the above application, the plants include but are not limited to: Arabidopsis, apple, tomato, grape and the like.
[0012] The seedless fruit formed by parthenocarpy has improved edible rate and quality, so parthenocarpy has always been an important selection indicator for plant breeding. miRNA is a class of endogenous small non-coding RNA that can regulate genes but does not encode proteins. It plays an important role in post-transcriptional regulation of genes. miR156 is one of the important members of miRNA. Currently, 31 MdMIR156 genes in the apple genome have been identified through RNA library sequencing and bioinformatics analysis, but the functions of most MdMIR156 genes have not yet been elucidated.
[0013] According to the sequence of the gene number EB146843 encoding the miR156 family, the present invention selects the region that can form a folded structure as the apple miR156 gene, which is named MdMIR156h. The nucleotide sequence is shown in SEQ ID NO.1, which is as follows:
[0014] TAAATTTAGGGTAAGGACTAGGGAACTGGGAGAGAGAAAGAGCAGGGAGTGGTGATACGTTGTTGACAGAAGATAGAGAGCACAGATGGATGACTTGCAATGGACTATGCATCTCACTCCTTTGTGCTCTCTATGCTTCTGTCATCACCTAGCTATATCCAGCTTCCCTGCCCTCCCCCACCCCTGCACCTCCCATATTAATCTAATTC.
[0015] The invention studies the function of apple miR156 gene and finds that overexpression of apple miR156 gene can promote parthenocarpy of plants, thus contributing to the cultivation of seedless fruit plant varieties.
[0016] The second aspect of the present invention provides the use of an overexpression vector or recombinant bacteria containing the apple miR156 gene in the following (1) or (2):
[0017] (1) Promote plant parthenocarpy;
[0018] (2) Cultivate plant varieties with seedless fruits.
[0019] In the above application, the overexpression vector containing the apple miR156 gene is constructed by the following method:
[0020] The apple miR156 gene was amplified using the primers shown in SEQ ID NO.2 and SEQ ID NO.3, and the amplified apple miR156 gene was connected to the plasmid vector using homologous recombinase.
[0021] Preferably, the plasmid vector is pRI101-GFP.
[0022] The third aspect of the present invention provides a method for increasing the parthenocarpy rate of plants, comprising the following steps:
[0023] Overexpression of the apple miR156 gene in plants.
[0024] In the above method, the overexpression of the apple miR156 gene in the plant is achieved by introducing an overexpression vector containing the apple miR156 gene.
[0025] Preferably, the overexpression vector containing the apple miR156 gene is introduced by Agrobacterium-mediated method.
[0026] Furthermore, the method also includes the step of emasculating and removing stigmas when the plants are in bloom but not pollinated.
[0027] In order to study the function of apple miR156 gene, the present invention constructs an overexpression vector containing apple miR156 gene. The overexpression vector is used to overexpress apple miR156 gene in plants such as Arabidopsis, apple and tomato. Then the overexpression plants are treated without pollination. The results show that compared with wild-type plants, the parthenocarpy rate of transgenic plants obtained by overexpressing apple miR156 gene in plants is significantly higher than that of wild-type plants.
[0028] Beneficial effects of the present invention:
[0029] The present invention is the first to study and discover that the apple miR156 gene is related to plant parthenocarpy. By overexpressing the apple miR156 gene in plants, the parthenocarpy rate of various plants such as apples and tomatoes can be increased. The present invention provides a new gene resource for breeding new plant varieties with seedless fruit traits, which is of great significance in production practice. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Figure 1 The pod phenotype and pod length of wild-type and transgenic Arabidopsis thaliana under pollination or non-pollination treatments, where Col-0 is the wild-type and 35S::MdMIR156h is the transgenic Arabidopsis thaliana;
[0031] Figure 2The phenotypes and fruit setting rates of wild-type and transgenic apples at fruit maturity under pollination or non-pollination treatments, where Gala is the wild-type and MdMIR156h is the transgenic apple;
[0032] Figure 3 The figures are the phenotypes and fresh weight, yield per plant and fruit setting rate of wild-type and transgenic tomatoes at fruit maturity under pollination or non-pollination treatments, among which Micro Tom is a wild-type and MdMIR156h is a transgenic tomato. DETAILED DESCRIPTION
[0033] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.
[0034] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments. The test materials used in the embodiments of the present invention are all conventional test materials in the art and can be purchased through commercial channels.
[0035] Example 1: Cloning of apple miR156 gene and construction of overexpression vector
[0036] The sequence of the gene number EB146843 (https: / / www.ncbi.nlm.nih.gov / ) encoding the miR156 family was analyzed. The sequence of EB146843 is as follows:
[0037] ATATTATAGTAT TAAATTTAGGGTAAGGACTAGGGAACTGGGAGAGAGAAAGAGCAGGGAGTGGTGAT ACGTTGTTGACAGAAGATAGAGAGCACAGATGGATGACTTGCAATGGACTATGCATCTCACTCCTTTGTGCTCTCT ATGCTTCTGTCATCACCTAGCTATATCCAGCTTCCCTGCCCCTCCCCCACACCCCTGCACCTCCCATATTAATCTA ATTCATAAAATGATTATTTGATTGATTACTAATTAATCGATTATATATGCTTCCCTTGCTTGCATATATATGCTTCCTTTGCTTGCATATATATTGTTTTAACTTTGTAATTTCATATTTAGTCTCGAGTGATTTGGGTATATTCATAAATTTACTGATTTCTCATTTTTGGATCTGACTTGTAT ATATAATTGGATTTCCCTTTTTTCTCCTTTGTAGGATCTTATGTTTTACAGGTTTGATTGAAGTAGTAGTAGTACTGGAAAAGCAGATCTATCAGAGCCGCAGGAGTACTTTGCAATCATAGGTTCTTACAAATATTATAAATAATGTGTCTGTATTTTATGGGGTTTGTTCATGCGTAAGTT.
[0038] The underlined regions in the sequence are the regions that form the folded structure.
[0039] The underlined region was selected as the apple miR156 gene (shown in SEQ ID NO.1) and cloned. The specific steps are as follows:
[0040] DNA was extracted from apple fruit using a plant DNA extraction kit; primers for the apple miR156 gene sequence were designed using the primer design website Vazyme (https: / / crm.vazyme.com / cetool / singlefragment.html). The nucleotide sequences of the primers are shown below:
[0041] pre-MdmiR156h-F: ttgatacatatgcccgtcgacTAAATTTAGGGTAAGGACTAGGG, (SEQ IDNO.2)
[0042] pre-MdmiR156h-R: gttgattcagaattcggatccGAATTAGATTAATATGGGAGGTGC.
[0043] (SEQ ID NO.3)
[0044] The cloned apple miR156 gene was connected to the overexpression pRI101-GFP plasmid vector using homologous recombinase to construct an overexpression vector containing the apple miR156 gene.
[0045] Example 2: Obtaining transgenic Arabidopsis
[0046] The overexpression vector containing the apple miR156 gene constructed in Example 1 was transformed into wild-type Arabidopsis thaliana by the floral dipping method using the Agrobacterium-mediated method to obtain transgenic Arabidopsis thaliana. The specific steps are as follows:
[0047] (1) Arabidopsis Co1-0 seeds were vernalized at 4°C for 3 days and sown. After the plants bloomed, they were placed upside down in Agrobacterium containing an apple miR156 gene overexpression vector for 1 minute for infection. The infected plants were placed on their sides in a dark place for 24 hours, and then the plants were placed upright and cultured normally. Infection was performed once every 7-10 days for a total of 3-4 times. The infected Arabidopsis was continued to be cultured and the seeds were harvested.
[0048] (2) Cultivating the seeds harvested in step (1) on a screening medium, wherein the screening medium uses 1 / 2MS as a basic medium, and 7 g / L agar powder, 10 g / L sucrose and 50 mg / L kanamycin are added to the medium; screening out positive plants.
[0049] (3) RNA was extracted from the top leaves of the positive plants, and cDNA was obtained by reverse transcription, and the wild-type plants were used as controls. Real-time fluorescence quantitative PCR was performed using pre-miR156-qRT-F (SEQ ID NO.4) and pre-miR156-qRT-R (SEQ ID NO.5) to identify the expression level of the apple miR156 gene, and transgenic Arabidopsis thaliana with overexpression of the apple miR156 gene was obtained.
[0050] pre-miR156-qRT-F: GAGCAGGGAGTGGTGATACG, (SEQ ID NO.4)
[0051] pre-miR156-qRT-R:AATATGGGAGGTGCAGGGGT. (SEQ ID NO.5)
[0052] Example 3: Acquisition of genetically modified apples
[0053] The overexpression vector containing the apple miR156 gene constructed in Example 1 was transformed into wild-type apples by the leaf disc method using the Agrobacterium-mediated method to obtain transgenic apples. The specific steps are as follows:
[0054] (1) Wild-type apple 'Gala' tissue culture seedlings were grown on medium A for 25-35 days. The medium A was MS as the basic medium, and 7 g / L agar powder, 30 g / L sucrose, 0.3 mg / L 6-BA, 0.2 mg / L IAA and 0.1 mg / L GA were added to the medium. 3 .
[0055] The apple leaves were removed, wounded with a blade, and immersed in the Agrobacterium liquid containing the apple miR156 gene overexpression vector for 7-10 minutes for infection. The infected apple leaves were placed on culture medium B and grown in the dark for two days, wherein culture medium B was MS as the basic culture medium, and 7g / L agar powder, 25g / L sucrose, 5g / L glucose, 0.5g / L hydrolyzed casein, 2mg / L TDZ and 0.5mg / L NAA were added to the culture medium; then the leaves were moved to culture medium C and grown in the dark for two days, wherein culture medium C was MS as the basic culture medium, and 7g / L agar powder, 30g / L sucrose, 2mg / L TDZ, 0.5mg / L NAA, 250mg / L cephalosporin and 250mg / L timentin were added to the culture medium; then the apple leaves were moved to culture medium D and grown in the dark, wherein culture medium D was MS as the basic culture medium, and 7g / L agar powder, 30g / L sucrose, 2mg / L TDZ, 0.5mg / L NAA, 250mg / L cephalosporin, 250mg / L timentin and 25mg / L kanamycin, the apple leaves were plated and replaced every 20 days until the apple leaves differentiated and sprouted.
[0056] (2) After the differentiated buds were placed under light for 7-10 days, they were placed on medium E for growth. The medium E was a basic medium containing MS, 7 g / L agar powder, 30 g / L sucrose, 1 mg / L 6-BA, 0.5 mg / L NAA, and 0.5 mg / L GA. 3 , 250mg / L cephalosporin, 250mg / L timentin and 25mg / L kanamycin; positive plants were screened out.
[0057] (3) RNA was extracted from the top leaves of the positive plants, and cDNA was obtained by reverse transcription, and the wild-type plants were used as controls. Real-time fluorescence quantitative PCR was performed using pre-miR156-qRT-F (SEQ ID NO.4) and pre-miR156-qRT-R (SEQ ID NO.5) to identify the expression level of the apple miR156 gene and obtain transgenic plants with overexpression of the apple miR156 gene.
[0058] pre-miR156-qRT-F: GAGCAGGGAGTGGTGATACG, (SEQ ID NO.4)
[0059] pre-miR156-qRT-R:AATATGGGAGGTGCAGGGGT. (SEQ ID NO.5)
[0060] (4) The identified transgenic plants were placed on a rooting medium for rooting culture. The rooting medium used 1 / 2MS as the basic medium, and 7 g / L agar powder, 20 g / L sucrose, 0.5 mg / L IBA, and 0.2 mg / L NAA were added to the medium to obtain transgenic apples.
[0061] Example 4: Obtaining transgenic tomatoes
[0062] The overexpression vector containing the apple miR156 gene constructed in Example 1 was transformed into wild-type tomatoes by the leaf disc method using the Agrobacterium-mediated method to obtain transgenic tomatoes. The specific steps are as follows:
[0063] (1) Wild-type tomato 'Micro Tom' seeds grew two cotyledons after 15 days of growth on MS medium.
[0064] (2) The two germinated cotyledons of the tomato were removed and wounded with a blade. The leaves were first cultured in a dark place on medium 1 (medium 1 used MS as the basic medium, and 7 g / L agar powder, 30 g / L sucrose, 2 mg / L ZT and 0.5 mg / L IAA were added to the medium) for two days, and then immersed in a liquid containing an Agrobacterium transfer vector containing the apple miR156 gene overexpression vector for 7-10 minutes. The infected leaves were placed on medium 2 (medium 2 used MS as the basic medium, and 7 g / L agar powder, 30 g / L sucrose, 2 mg / L ZT and 0.5 mg / L IAA, 300 mg / L timentin were added to the medium) and grown in a dark place for two days. Then move them to culture medium 3 (culture medium 3 uses MS as the basic culture medium, and 7g / L agar powder, 30g / L sucrose, 2mg / L ZT and 0.5mg / LIAA, 300mg / L timentin and 100mg / L kanamycin are added to the culture medium) and grow in the dark. Change the plate every 20 days until the leaves differentiate and sprout.
[0065] (3) After the differentiated buds are placed under light for 7-10 days, they are placed on medium 4 (medium 4 uses MS as the basic medium, and 7 g / L agar powder, 30 g / L sucrose, and 0.1 mg / L IAA are added to the medium) for growth.
[0066] (4) Determination of transgenic tomatoes: RNA was extracted from the top leaves of transgenic plants and reverse transcribed to obtain cDNA, and wild-type plants were used as controls. Real-time fluorescence quantitative PCR was used to identify the expression level of the apple miR156 gene using pre-miR156-qRT-F (SEQ ID NO.4) and pre-miR156-qRT-R (SEQ ID NO.5), and transgenic tomatoes with overexpression of the apple miR156 gene were obtained.
[0067] pre-miR156-qRT-F: GAGCAGGGAGTGGTGATACG, (SEQ ID NO.4)
[0068] pre-miR156-qRT-R:AATATGGGAGGTGCAGGGGT. (SEQ ID NO.5)
[0069] Example 5: Pollination and non-pollination treatment of transgenic plants
[0070] Wild-type Arabidopsis thaliana (Col-0), transgenic Arabidopsis thaliana (MdMIR156h#1, MdMIR156h#2, MdMIR156h#3) constructed in Example 2, wild-type apple (Gala), transgenic apple (MdMIR156hOE-1, MdMIR156hOE-2) constructed in Example 3, wild-type tomato (Micro Tom), and transgenic tomato (MdMIR156hOE-1, MdMIR156hOE-2, MdMIR156hOE-3) constructed in Example 4 were used as experimental materials, and pollination and non-pollination treatments were performed respectively to investigate the effect of overexpression of the apple miR156 gene on the parthenocarpy rate of plants.
[0071] (1) Pollination treatment: Arabidopsis and tomato are self-pollinating plants and do not need artificial pollination. When apple is in full bloom, remove the side flowers and keep the central flower, and pollinate it for three consecutive days.
[0072] (2) Unpollinated treatment: Arabidopsis and tomato flowers were emasculated and bagged before pollination to prevent them from coming into contact with pollen.
[0073] The pod phenotype and pod length of wild-type and transgenic Arabidopsis thaliana under pollinated or unpollinated treatments are shown in Figure 2. Figure 1 As shown, the results showed that the fruit pods of pollinated wild-type and transgenic Arabidopsis could swell normally, but the fruit pods of unpollinated transgenic Arabidopsis were longer than those of wild-type, indicating that transgenic Arabidopsis can promote the formation of parthenocarpy.
[0074] During the big bell flowering period of apples, the side flowers were thinned out, leaving the central flowers, and the stamens and stigmas of the central flowers were removed and bagged to prevent them from contacting pollen. The phenotypes and fruit setting rates of wild-type and transgenic apples at fruit maturity under pollination or non-pollination treatments are shown in the figure. Figure 2 As shown, the results indicate that transgenic apples can promote the formation of parthenocarpy.
[0075] Tomatoes were detasseled and bagged before they were pollinated to prevent them from coming into contact with pollen. The phenotypes and fresh weight, yield per plant, and fruit setting rate of wild-type and transgenic tomatoes at fruit maturity under pollinated or unpollinated treatments are shown in the figure. Figure 3As shown, the results indicate that transgenic tomatoes can promote the formation of parthenocarpy.
[0076] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. Application of apple miR156 gene in the following (1) or (2): (1) Promote plant parthenocarpy; (2) Cultivating plant varieties with seedless fruits; The nucleotide sequence of the apple miR156 gene is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that: The plants are Arabidopsis thaliana, apple and / or tomato.
3. Use of an overexpression vector or recombinant bacteria containing the apple miR156 gene in the following (1) or (2): (1) Promote plant parthenocarpy; (2) Cultivate plant varieties with seedless fruits.
4. The use according to claim 3, characterized in that: The overexpression vector containing the apple miR156 gene is constructed by the following method: The apple miR156 gene was amplified using the primers shown in SEQ ID NO.2 and SEQ ID NO.3, and the amplified apple miR156 gene was connected to the plasmid vector using homologous recombinase.
5. The use according to claim 4, characterized in that: The plasmid vector is pRI101-GFP.
6. A method for increasing the parthenocarpy rate of plants, characterized in that: The following steps are involved: Overexpression of the apple miR156 gene in plants.
7. The method according to claim 6, characterized in that Overexpression of the apple miR156 gene in plants is achieved by introducing an overexpression vector containing the apple miR156 gene.
8. The method according to claim 7, characterized in that The overexpression vector containing the apple miR156 gene was introduced by Agrobacterium-mediated method.
9. The method according to claim 6, characterized in that The method further comprises the step of performing detasseling and destigmatization treatment on the plants during the flowering but non-pollination period.