Rice cold tolerance negative regulation gene OsbHLH090 and application thereof

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a rice cold tolerance negative regulation gene OsbHLH090 and application thereof. The nucleotide sequence of the gene is shown as a sequence table SEQ ID NO: 1, and the coded amino acid sequence is shown as a sequence table SEQ ID NO: 2. According to the invention, the rice OsbHLH090 gene is edited by using a CRISPR-Cas9 gene editing technology, and the gene is knocked out to obtain the cold-sensitive rice mutant. The method comprises the following steps: cloning OsbHLH090CDS into a pC1390U vector, and constructing an overexpression vector; under cold stress, the survival rate of the mutant is higher than that of a wild type, and the survival rate of overexpressed transgenic rice is lower than that of the wild type, so that the OsbHLH090 gene is an important negative regulation factor in a rice cold-tolerant approach. The invention provides a new resource for cold-resistant breeding of plants and rice.

Description

Technical Field

[0001] The invention relates to the technical field of plant transgenic technology and crop genetic breeding, and in particular to a rice cold tolerance negative regulatory gene OsbHLH090 and an application thereof. Technical Background

[0002] Rice is an important food crop in the world, especially in Asia and Africa, but its growth is easily affected by low temperature and cold damage. With global climate change, extreme weather events occur frequently, and low temperature and cold damage pose an increasing threat to rice production, especially in frost and cold wave weather in spring and autumn. Low temperature not only slows down rice growth, but also may lead to pollination failure, panicle damage and even crop failure. Therefore, it is very important to improve the cold tolerance of rice, which can not only reduce the losses caused by cold damage, but also improve the production stability of rice in harsh climates, expand the rice planting area, and ensure the security of food supply. In addition, the cultivation of cold-tolerant rice can improve the efficiency of agricultural production, help farmers cope with low temperature losses and increase income. In recent years, with the advancement of molecular biology and genomics technology, scientists have discovered a variety of genes related to rice cold tolerance. Using technologies such as gene editing, rice varieties with stronger cold tolerance can be cultivated, which provides a precise solution for improving the cold resistance of rice.

[0003] The bHLH (basic helix-loop-helix) transcription factor family is one of the important transcription factors in plants, and is widely involved in multiple biological processes such as plant growth and development, photosynthesis, and stress resistance. In rice, bHLH transcription factors play an important regulatory role in cold tolerance, disease resistance, and plant development. With the development of molecular biology techniques, research on rice bHLH transcription factors has made significant progress in recent years, especially in rice cold tolerance, revealing the key role of bHLH transcription factors in regulating rice cold resistance.

[0004] bHLH transcription factors are named for their unique structure, which is mainly composed of a conserved basic region and a helix-loop-helix domain. They regulate the transcriptional expression of downstream genes by binding to the E-box (CANNTG) sequence in DNA. According to the differences in function and sequence, bHLH transcription factors can be divided into multiple subclasses, some of which are closely related to plant growth and development and stress response. In the study of rice cold tolerance, bHLH transcription factors participate in the mechanism of rice adaptation to low temperature stress by regulating a series of genes related to cold stress response.

[0005] Specifically, bHLH transcription factors are closely related to multiple biological pathways such as cold receptors, antioxidant enzyme systems, and hormone signaling, thereby enhancing rice's ability to adapt to low temperatures. For example, the OsbHLH148 transcription factor in rice is upregulated under low temperature stress, which can enhance rice's cold resistance. By regulating the expression of cold-responsive genes, such as antioxidant enzyme genes and stress-responsive genes, OsbHLH148 helps rice remove reactive oxygen species (ROS) produced by low temperature stress, thereby protecting cells from low temperature damage. In addition, bHLH transcription factors also work synergistically with plant hormone (such as ABA, JA, etc.) signaling pathways to jointly regulate rice's cold resistance response.

[0006] Although existing studies have revealed the important role of bHLH transcription factors in rice cold tolerance, there are still many questions to be answered. Future studies can further explore the mechanism of action of bHLH transcription factors, especially how bHLH transcription factors interact with other cold tolerance genes, plant hormone signaling pathways and environmental factors under low temperature stress. In addition, gene editing technology (such as CRISPR-Cas9) provides a new means to precisely regulate the expression of bHLH transcription factors and their downstream genes, which opens up a new research direction for breeding more cold-tolerant rice varieties. Summary of the invention

[0007] The present invention discovered the gene OsbHLH090 related to rice cold tolerance through high-throughput genomics analysis and functional genomics research. The gene is located on chromosome 1, with the MSU_Locus number of LOC_Os01g68700, a genome sequence of 3120bp in length, a coding region of 1455bp in length, and a protein encoding length of 484 amino acid residues. Through gene knockout and overexpression, we verified the function of the OsbHLH090 gene under low temperature stress. After knocking out the gene, the cold tolerance of rice seedlings was significantly enhanced and the mortality rate was reduced; while overexpressing the gene significantly increased the mortality rate of rice seedlings under low temperatures, indicating that the OsbHLH090 gene serves as a negative regulatory factor in the cold tolerance pathway of rice.

[0008] The technical solution adopted by the present invention to solve the technical problem is:

[0009] In the first aspect, the present invention protects a protein, which is any of the following proteins:

[0010] A1) a protein with an amino acid sequence as shown in SEQ ID NO: 2;

[0011] A2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein of A1) and having more than 80% identity with the protein of A1) and having the function of negatively regulating cold resistance of rice;

[0012] A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of A1) or A2).

[0013] The protein in A1) above was named OsbHLH090.

[0014] In order to facilitate purification or detection of the protein in A1), a tag protein may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No. 2 in the sequence listing.

[0015] The above proteins can be artificially synthesized, or their encoding genes can be synthesized first and then expressed biologically.

[0016] The tag protein includes but is not limited to: GST (glutathione sulfhydryltransferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein, etc.

[0017] In a specific embodiment, the protein is derived from rice.

[0018] In a second aspect, the present invention also protects biological materials related to the above-mentioned protein, wherein the biological material is any one of the following:

[0019] B1) a nucleic acid molecule encoding the protein described above;

[0020] B2) a recombinant vector containing the nucleic acid molecule described in B1);

[0021] B3) a recombinant microorganism containing the nucleic acid molecule described in B1) or a recombinant microorganism containing the recombinant vector described in B2);

[0022] B4) A transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the recombinant vector described in B3).

[0023] In a specific embodiment, the nucleotide sequence of the nucleic acid molecule in B1) is shown as SEQ ID NO:1.

[0024] In a specific embodiment, the nucleotide sequence shown in SEQ ID NO:1 (OsbHLH090 gene) encodes the protein OsbHLH090 having the amino acid sequence shown in SEQ ID NO:2.

[0025] The vectors described herein are well known to those skilled in the art, including but not limited to: plasmid, phage (such as lambda phage or M13 filamentous phage, etc.), cosmid (i.e., cosmid), Ti plasmid or viral vector. Specifically, it can be a pC1390U vector or a TKC vector.

[0026] In a third aspect, the present invention also protects the use of the above-mentioned protein or the above-mentioned biological material in negatively regulating the cold resistance of rice.

[0027] In a fourth aspect, the present invention also protects the use of the above-mentioned protein or the above-mentioned biological material in the preparation of negatively regulating rice cold resistance.

[0028] In a fifth aspect, the present invention also protects the use of the above-mentioned protein or the above-mentioned biological material in cultivating cold-resistant rice.

[0029] In a sixth aspect, the present invention also protects a method for negatively regulating rice cold resistance, wherein the method obtains cold-resistant rice by inhibiting, reducing or silencing the expression level of the gene encoding the protein mentioned above in the target rice, or by inhibiting, reducing or silencing the activity and / or content of the protein mentioned above.

[0030] In the seventh aspect, the present invention also protects a method for cultivating cold-resistant rice, by inhibiting or reducing or silencing the expression level of the gene encoding the protein mentioned above in the target rice, or by inhibiting or reducing or silencing the activity and / or content of the protein mentioned above, to obtain cold-resistant rice.

[0031] Beneficial Effects

[0032] The present invention proposes a strategy to improve the cold tolerance of rice by regulating the expression of the OsbHLH090 gene. This technology can effectively improve the growth adaptability of rice in cold environments and provide new ideas for rice breeding. In addition, the cold-tolerant gene and its application technology provided by the present invention can not only enhance the resistance of rice under low temperature conditions, but also provide a reference for improving the cold tolerance of other crops. As global climate change leads to increasingly severe low-temperature environments, this technology has broad application prospects and can help agricultural production better cope with the challenges brought by cold weather. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 is the vector map of the pC1390U vector;

[0034] Figure 2 This is the map of the TKC vector used for CRISPR-Cas9;

[0035] Figure 3 It is a map of CRISPR-Cas9 knockout targets and mutation sites;

[0036] Figure 4 The cold tolerance phenotypes and quantitative results of wild-type (WT), mutant (bhlh090) and overexpression (90OE) plants. DETAILED DESCRIPTION

[0037] The following examples are provided for better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified.

[0038] The rice variety Zhonghua 11 was preserved in the laboratory. The overexpression vector pC1390U used in the present invention is shown in the map. Figure 1 , the sequence is shown in SEQ ID NO:3.

[0039] Example 1: Cloning of the rice cold tolerance gene OsbHLH090

[0040] (1) Rice RNA extraction

[0041] 0.2 g of young rice leaves were used to extract total RNA using the Trizol method. The RNA purity was assessed by measuring the RNA concentration and A260 / A280 ratio; meanwhile, the integrity of the RNA was tested by agarose gel electrophoresis to verify its quality.

[0042] (2) Reverse transcription to obtain rice cDNA

[0043] The residual genomic DNA in RNA was removed and reverse transcribed to obtain cDNA. The operation was performed according to PrimeScript of TaKaRa Company. TM Follow the instructions of RT reagent Kit with gDNA eraser (Perfect Real Time).

[0044] The reaction conditions were as follows: incubation at 42°C for 30 min in a PCR instrument and heating at 85°C for 5 sec to inactivate Prime Script RT Enzyme Mix and gDNA Eraser.

[0045] (3) Acquisition of OsbHLH090 gene

[0046] Primers were designed using Primer3 Plus software, and the GC content was controlled between 40% and 60%. The cloning primers OsbHLH090-F and OsbHLH090-R of OsbHLH090 were designed, and PCR amplification was performed to obtain the full-length coding region product of OsbHLH090. The primer sequence information is: OsbHLH090-F: 5'GCTGCTTCTGCTTGCGATTG 3'; OsbHLH090-R: 5'GACTACCGTACATGGTGCGT 3'. According to the pC1390U vector (vector map see Figure 1 , the sequence is shown in SEQ ID NO: 3), designed primers OsbHLH090-KpnI-F and OsbHLH090-BamHI-R, and introduced the flanking sequence of the OsbHLH090 gene into the KpnI and BamHI restriction sites by PCR amplification. The success of the amplification product was verified by 1% agarose gel electrophoresis. Finally, the sequencing results showed that the sequence of the coding region of the OsbHLH090 gene was consistent with the OsbHLH090 coding region sequence annotated in the rice genome data.

[0047] Example 2: Construction of OsbHLH090 gene overexpression vector

[0048] Gene fragment recovery: Agarose gel electrophoresis was used to recover the OsbHLH090 gene coding region fragment obtained from Example 1. Vector double digestion: KpnI and BamHI were used to double digest the pC1390U vector. The vector fragment was recovered after digestion. Ligation reaction: ExnaseII ligase (Novozyme) was used to connect the OsbHLH090 gene coding region fragment with the vector fragment. The ligation reaction conditions were: 37°C, 30 minutes. Reaction system: ExnaseII ligase (2μL), 5×CE Buffer (4μL), OsbHLH090 gene fragment (2μL, 100ng), linearized pC1390U vector (2μL, 50ng), sterile water (10μL). Transformation: Take 10μL of the ligation product and transform Escherichia coli DH5α cells using the heat shock method. After transformation, the bacteria were spread on LB solid medium containing kanamycin. Cultivation and screening: Cultivate overnight at 37°C, select 10 single clones for plasmid extraction, and perform PCR identification. PCR identification and sequencing: Select two positive clones for sequencing. The sequencing results show that the inserted PCR product sequence is SEQ ID NO.1, with a length of 1455bp. The protein encoded by this sequence consists of 484 amino acid residues, and the sequence is SEQ ID NO.2. Construction of recombinant expression vector: Through the above steps, an overexpression vector containing the OsbHLH090 gene was obtained, named pC1390U-OsbHLH090.

[0049] Example 3: Construction of OsbHLH090 gene knockout vector

[0050] The exon region sequence with high specificity for gene OsbHLH090 was screened as the target through the CRISPR website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR), and then the target sequence was cloned into the TKC vector (see vector map for details). Figure 2 ), the knockout vector of OsbHLH090 was obtained by sequencing identification. The process is as follows:

[0051] (1) Primers are synthesized according to the target sequence, and the sequence information is:

[0052] Primer1: 5'CAGATGATCCGTGGCAGCATCTCCCGTCTTGGCTCCGTTTTAGAGCTAGAA 3'; Primer2: 5'TTCTAGCTCTAAAACGGAGCCAAGACGGGAGATGCTGCCACGGATCATCTG3'.

[0053] (2) Dissolve the above primer sequences in 1×TE to a 100 μM stock solution. Take 1 μL of primer 1 and primer 2 as the front and back primers, add 1 μL of each into 98 μL of 0.5×TE solution, and mix and dilute to 1 μM.

[0054] (3) Keep at 95°C for 3 min, then cool to room temperature to complete annealing.

[0055] (4) Enzyme digestion and conjugation system (Thermo scientific) is as follows:

[0056]

[0057]

[0058] The reaction procedure was: 37°C for 5 min, 20°C for 5 min. The above two conditions were maintained for 10 cycles. The amplification reaction was carried out in a BIO-RAD T100 thermal cycler. The product was transformed into Escherichia coli DH5α competent cells (Beijing Tiangen Company CB101), and the positive clones were selected and sequenced. The sequence determination results showed that the obtained fragment was an OsbHLH090 knockout vector containing the target sequence, named pTKC-OsbHLH090.

[0059] Example 4: Rice genetic transformation

[0060] Rice transformation was carried out by using the Agrobacterium EHA105-mediated genetic transformation method. The specific steps of the Agrobacterium-mediated genetic transformation method are as follows:

[0061] (1) Obtaining recombinant Agrobacterium

[0062] pC1390U-OsbHLH090 and pTKC-OsbHLH090 were transformed into Agrobacterium EHA105 strain (purchased from American Jun Company) by freeze-thaw method to obtain recombinant strains, and plasmids were extracted for PCR identification. The correctly identified recombinant strains were named EH-pC1390U-OsbHLH090 and EH-pTKC-OsbHLH090.

[0063] (2) Transformation of Agrobacterium

[0064] Seed treatment: Select mature and full rice seeds, remove the shells, disinfect with 75% alcohol for 1-2 minutes, discard the alcohol, add 0.15% mercuric chloride (containing 0.1% Tween 20) for 10 minutes, discard the mercuric chloride, and rinse with sterile distilled water for 6 times. Inoculate the seeds with callus induction medium and culture them at 28℃ for 20 days.

[0065] Preparation of Agrobacterium: Streak Agrobacterium EHA105 transformed with pC1390U-OsbHLH090 and pTKC-OsbHLH090 vectors on LB plates containing 20 mg / L Rif and 50 mg / L Kan, respectively, and culture at 28°C for 2 days; pick a single colony in LB liquid culture medium and culture at 28°C and 200 rpm for 2 days; before infection, scrape the bacterial liquid into the suspension culture medium, shake at 28°C and 180 rpm for 3-3.5 hours, and adjust to OD600=0.1-0.15.

[0066] Callus infection: Take rice callus with a diameter of 2-4 mm and immerse it in the bacterial solution for 20 minutes. Then absorb the surface bacterial solution and cover it with sterilized filter paper. After blowing dry in a clean bench for 30 minutes, transfer it to the co-cultivation medium covered with sterilized filter paper, and culture it in the dark at 20℃ overnight, and then culture it in the dark at 25℃ for 2 days.

[0067] Washing and screening: Wash the co-cultured callus with sterile distilled water for 7-8 times, and finally soak it in sterile water containing 500 mg / L carbenicillin for 30 minutes, discard the solution and dry the surface water, and blow dry it in a clean bench for 1 hour. Place the callus tissue after bacterial removal in a screening medium containing hygromycin and culture it at 32℃ for 14 days.

[0068] (3) Callus differentiation and regeneration

[0069] After 14 days of screening, the resistant calli were transferred to differentiation medium and cultured at 28°C (photoperiod of 14h light / 10h dark). When the resistant calli formed 3-4cm high regenerated seedlings on the differentiation medium, they were transferred to rooting medium and cultured until complete transgenic rice plants were formed.

[0070] Example 5: Identification of cold tolerance of wild type, OsbHLH090 gene mutants and overexpressing plants

[0071] The seeds of wild type, OsbHLH090 mutant and overexpressed rice were placed in 2.5% sodium hypochlorite solution for disinfection for 20 minutes (note that the time should not be too long), and then washed 6 times with sterilized deionized water. After washing, the seeds were evenly spread on filter paper, added with an appropriate amount of sterilized water, and placed in an incubator at 28°C for germination. Three days later, the germinated seeds were transferred to a 96-well hydroponic box, and 40 seeds of each variety (wild type, osbhlh90 mutant, overexpressed plants) were planted, and 3 biological replicates were set. The growth conditions were: 13 hours of light, 11 hours of darkness, light intensity 40000LUX, temperature 28°C during light, temperature 25°C during darkness, and relative humidity 75%.

[0072] When the seedlings grow to two weeks old, they are transferred to an artificial climate chamber for cold tolerance assessment. The cold treatment conditions are: 13 hours of light, 11 hours of darkness, light intensity of 40,000 LUX, temperature of 4°C during light, temperature of 4°C during darkness, and relative humidity of 70%. After 4 days of cold treatment, the seedlings are removed and restored to normal growth conditions: 13 hours of light, 11 hours of darkness, light intensity of 40,000 LUX, temperature of 28°C during light, temperature of 25°C during darkness, and relative humidity of 70%. After 7 days of resumption of growth, the survival rate was calculated by the ratio of the number of surviving seedlings to the total number of seedlings, and the ion leakage rate was determined (about 0.3 grams of seedling leaf samples treated at 4°C were placed in a 15-ml centrifuge tube containing 5 ml of deionized water, and shaken at 200 rpm for 1 hour at room temperature. The solution conductivity was measured and recorded as S1. Subsequently, the centrifuge tube was placed in boiling water and heated for 20 minutes, and then continued to shake at room temperature for 1 hour, and the total conductivity was measured and recorded as S2. The conductivity of deionized water was recorded as S0, and the relative ion leakage rate was calculated according to the formula: Ion leakage rate (%) = (S1-S0) / (S2-S0).).

[0073] The results are as follows Figure 4 As shown: Figure 4A shows that under normal growth conditions, the growth conditions of the wild type, osbhlh90 mutant and overexpression plants were similar, and the plant heights were close. After 4 days of cold stress treatment, all three materials were damaged to varying degrees. Compared with the wild type, the osbhlh90 mutant showed lighter damage, while the rice overexpressing OsbHLH090 was more severely damaged. Specifically, the survival rate of the osbhlh90 mutant (79.3%) was significantly higher than that of the wild type (51.0%), while the survival rate of the rice overexpressing OsbHLH090 (28.3%) was significantly lower than that of the wild type ( Figure 4 B). In addition, we also measured the ion leakage rate of each material under cold stress. The results are shown in Figure 4 C. After cold stress treatment, the ion leakage rate of the osbhlh90 mutant was 19.5%, significantly lower than that of the wild type (39.3%); while the ion leakage rate of the overexpressing rice was 70.7%, significantly higher than that of the wild type. These results indicate that the OsbHLH090 gene plays an important role in regulating rice cold tolerance.

[0074] The cold-resistant gene and application method provided by the present invention can significantly improve the adaptability and resistance of rice in low-temperature environments. Through gene editing technology, precise breeding can be achieved, reducing dependence on traditional breeding methods, and further ensuring food security.

[0075] The present invention has been described in detail above with general descriptions and specific embodiments, but it is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present invention. Therefore, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

[0076] SEQ ID NO: 1

[0077] CDS

[0078] >LOC_Os01g68700.1

[0079]

[0080] GCTACAATGGTAGGATCGTTGCAAACAGTCCACATGAAAATGGAGCTTTGACATGA

[0081] Protein

[0082] >LOC_Os01g68700.1

[0083] Met Asn Cys Gly Pro Pro Asp Gln Leu Pro Pro Ala Thr Ala Pro Ser CysPhe Leu Asn Leu AsnTrp Asp Gln Ser Met Asp Ala Ala Ala Gly Gly His Leu AspPro Ala Leu Ser Ser Met Val Ser Ser ProAla Ser Asn Ser Thr Gly Ala Leu HisGly Ile Ser Pro Gln Pro His Tyr Gly Gly Gly Thr Pro Leu SerSer Pro Pro LysLeu Asn Leu Ser Met Met Gly Gln Phe His His Tyr Ala Ala Pro Pro Gln Val GlyGlyGly Gly Gly Gly Gly Gly Gly Leu Pro Ile Leu Glu Asn Leu Met Pro Met GlyHis Leu Asp Gln PheLeu Ala Asp Pro Gly Phe Ala Glu Arg Ala Ala Arg Leu SerGly Phe Asp Ala Arg Gly Gly Gly GlyGly Gly Gly Tyr Gly Gly Ala Gly Pro AlaGln Phe Gly Leu Pro Asp Ala Gly Ala Ala Gly Ala SerLys Glu Met Glu Leu GlyAsn Thr Arg Asp Glu Ser Ser Val Ser Asp Pro Ala Pro Gly Gly Ala Glu IleProPro Lys Gly Ala Ser Asp Gly Asn Ala Arg Lys Arg Lys Ala Ser Gly Lys Gly LysGly Lys Asp SerPro Met Ser Thr Ser Ala Ala Lys Glu Asp Ser Ser Gly Lys ArgCys Lys Ser Thr Glu Glu Ser Asn AlaAla Ala Glu Glu Asn Ser Gly Lys Gly LysAla Ala Gln Ser Asn Ser Glu Asn Gly Gly GlyLys LysGln Gly Lys Asp Ser SerSer Lys Pro Pro Glu Pro Pro Lys Asp Tyr Ile His Val Arg Ala Arg Arg GlyGluAla Thr Asp Ser His Ser Leu Ala Glu Arg Val Arg Arg Glu Lys Ile Ser Gln ArgMet Lys Leu LeuGln Asp Leu Val Pro Gly Cys Asn Lys Val Val Gly Lys Ala ValMet Leu Asp Glu Ile Ile Asn Tyr ValGln Ser Leu Gln Arg Gln Val Glu Phe LeuSer Met Lys Leu Ala Thr Val Asn Pro Gln Leu Asp PheAsn Asn Leu Pro Asn LeuLeu Ala Lys Asp Met His Gln Ser Cys Ser Pro Leu Gln Ser Ser His PhePro LeuGlu Thr Ser Gly Ala Pro Leu Pro Tyr Ile Asn Gln Pro Gln Gln Gly Asn Pro LeuGly Cys GlyLeu Thr Asn Gly Met Asp Asn Gln Gly Ser Met His Pro Leu Asp ProAla Phe Cys Arg Pro Met GlySer His His Pro Phe Leu Asn Gly Val Ser Asp AlaAla Ser Gln Val Gly Ala Phe Trp Gln Asp Asp LeuGln Ser Val Val Gln Met AspMet Gly Gln Ser Gln Glu Ile Ala Thr Ser Ser Asn Ser Tyr Asn Gly ArgIle ValAla Asn Ser Pro His Glu Asn Gly Ala Leu Thr*

Claims

1. A protein, wherein the protein is any of the following: A1) a protein with an amino acid sequence as shown in SEQ ID NO: 2; A2) a protein obtained by replacing and / or deleting and / or adding amino acid residues of the protein of A1) and having more than 80% identity with the protein of A1) and having the function of negatively regulating cold resistance of rice; A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of A1) or A2).

2. The protein according to claim 1, characterized in that The protein is derived from rice.

3. A biological material related to the protein according to claim 1 or 2, wherein the biological material is any one of the following: B1) a nucleic acid molecule encoding the protein according to claim 1; B2) a recombinant vector containing the nucleic acid molecule described in B1); B3) a recombinant microorganism containing the nucleic acid molecule described in B1) or a recombinant microorganism containing the recombinant vector described in B2); B4) A transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the recombinant vector described in B3).

4. The biomaterial according to claim 2, characterized in that B1) The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:

1.

5. Use of the protein according to claim 1 or 2 or the biological material according to claim 3 or 4 in negatively regulating the cold resistance of rice.

6. Use of the protein according to claim 1 or 2 or the biological material according to claim 3 or 4 in preparing a material for negatively regulating cold resistance of rice.

7. Use of the protein according to claim 1 or 2 or the biological material according to claim 3 or 4 in cultivating cold-resistant rice.

8. A method for negatively regulating cold resistance of rice, characterized in that: Cold-resistant rice is obtained by inhibiting, reducing or silencing the expression of the gene encoding the protein of claim 1 in the target rice, or by inhibiting, reducing or silencing the activity and / or content of the protein of claim 1.

9. A method for cultivating cold-resistant rice, characterized in that: Cold-resistant rice is obtained by inhibiting, reducing or silencing the expression of the gene encoding the protein of claim 1 in the target rice, or by inhibiting, reducing or silencing the activity and / or content of the protein of claim 1.

Images