Lycium ruthenicum Murr. LrCHS1 gene and its encoded protein in regulating anthocyanin biosynthesis
By overexpressing the LrCHS1 gene in black goji berries, recombinant plasmids and recombinant bacteria were constructed, solving the problem of insufficient anthocyanin biosynthesis, achieving the accumulation of anthocyanin compounds, and enhancing their application potential in food and daily chemical products.
Patent Information
- Application Number
- CN202411304811.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-19
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2044-09-19
AI Technical Summary
The lack of effective methods in the current technology to improve the biosynthetic pathway of anthocyanins in black goji berries limits their potential application in the fields of nutrition and medicine.
By identifying and overexpressing the LrCHS1 gene of black goji berry, recombinant plasmids and recombinant bacteria were constructed. The LrCHS1 gene was overexpressed in plants using Agrobacterium-mediated transformation technology, which promoted the biosynthesis of anthocyanin compounds proanthocyanidin B1 and chlorinated pelargonidin.
It significantly increased the accumulation of anthocyanin compounds in plants, improved the content of proanthocyanidin B1 and chlorinated pelargonidin, provided a new biosynthetic pathway, and provided natural antioxidants and active ingredients for food and daily chemical products.
Smart Images

Figure CN119193605B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and particularly relates to the application of Lycium ruthenicum Murr. LrCHS1 gene and the encoded protein thereof in promoting anthocyanin biosynthesis. BACKGROUND
[0002] Lycium ruthenicum Murr. belongs to Solanaceae and is a perennial shrub. The fruits of Lycium ruthenicum Murr. are rich in active compounds such as polysaccharides, flavonoids, vitamins and proteins, and have high nutritional value, and also have effects of antioxidant, anti-aging, blood lipid-lowering, anticancer, anti-fatigue and potential gastrointestinal protection and radiation resistance. In addition, the content of anthocyanin in Lycium ruthenicum Murr. is higher than that in blackcurrant or blueberry. Anthocyanins are a class of water-soluble natural pigments specific to plants, have biological activity, can be used for preventing and treating various diseases, and are also widely used as natural food pigments in food. Moreover, anthocyanins also play an important role in promoting plant reproduction and protecting plants from biological and abiotic stresses.
[0003] Previous studies have shown that there are structural genes related to anthocyanin biosynthesis in Lycium ruthenicum Murr., and therefore, it is necessary to continue to explore new structural genes in order to obtain more improved Lycium barbarum varieties and provide more pathways for anthocyanin biosynthesis. SUMMARY
[0004] In view of the above technical problems, the present application provides the application of Lycium ruthenicum Murr. LrCHS1 gene and the encoded protein thereof in promoting anthocyanin biosynthesis. The present application first finds that LrCHS1 gene can promote the accumulation of anthocyanin compounds, and can be used for positively mediating anthocyanin biosynthesis in Lycium barbarum.
[0005] In order to achieve the above application purposes, the present application adopts the following technical solutions:
[0006] In a first aspect, the present application provides the application of Lycium ruthenicum Murr. LrCHS1 gene in increasing the content of anthocyanin in plants, wherein the nucleotide sequence of the Lycium ruthenicum Murr. LrCHS1 gene is shown as SEQ ID NO. 1, or the protein encoded by the amino acid sequence shown as SEQ ID NO. 2.
[0007] The present application first identifies LrCHS1 gene from Lycium barbarum, and finds through research that LrCHS1 gene can positively mediate anthocyanin biosynthesis, and significantly increase the accumulation of anthocyanin compounds procyanidin B1 (CAS number: 20315-25-7) and pelargonidin chloride (CAS number: 134-04-3) in plants.
[0008] Proanthocyanidin B1 belongs to oligomeric proanthocyanidins (OPC). Oligomeric proanthocyanidins are currently internationally recognized natural antioxidants, which have strong antioxidant and free radical elimination effects, can not only protect and stabilize vitamin C, but also restore collagen activity; can inhibit the activity of tyrosinase, thereby playing a whitening effect; and are also strong metal chelators, which can chelate metal ions. Chlorogenin has antioxidant activity, can protect cells from damage caused by oxidative stress, and can be used in the field of daily chemical products or food; has inhibitory effect on enzymes involved in ROS, RNS and pro-inflammatory cytokine production, and can help to reduce inflammatory response; can be used for treating atherosclerosis, hypertension and thrombotic diseases, and has certain potential in the treatment of diseases such as Alzheimer's disease, Parkinson's disease and cancer. By overexpressing the LrCHS1 gene in plants, proanthocyanidin B1 and chlorogenin can be obtained through a biosynthetic pathway, thereby providing a new method for obtaining the two.
[0009] Preferably, the plant is Lycium ruthenicum Murr.
[0010] Preferably, the anthocyanins include proanthocyanidin B1 and chlorogenin.
[0011] The second aspect of the present application provides the use of a protein with an amino acid sequence as shown in SEQ ID NO. 2 in increasing the content of anthocyanins in plants.
[0012] Preferably, the plant is Lycium ruthenicum Murr.
[0013] Preferably, the anthocyanins include proanthocyanidin B1 and chlorogenin.
[0014] The third aspect of the present application provides a recombinant expression vector overexpressing the Lycium ruthenicum Murr. LrCHS1 gene.
[0015] Preferably, the recombinant expression vector includes a recombinant plasmid and a recombinant bacterium.
[0016] Further preferably, the recombinant bacterium is Agrobacterium.
[0017] The fourth aspect of the present application provides a construction method of a recombinant plasmid overexpressing the Lycium ruthenicum Murr. LrCHS1 gene: using a primer LrCHS1-F with a sequence as shown in SEQ ID NO. 5 and a primer LrCHS1-R with a sequence as shown in SEQ ID NO. 6, the Lycium ruthenicum Murr. LrCHS1 gene is transformed into a plasmid, and the recombinant plasmid overexpressing the Lycium ruthenicum Murr. LrCHS1 gene is obtained.
[0018] Preferably, the plasmid is pCambia 1300-35s.
[0019] The fifth aspect of the present application provides a method for constructing a recombinant bacterium overexpressing the Lycium ruthenicum Murr LrCHS1 gene, which comprises the following steps: constructing a recombinant plasmid by using a primer OE-LrCHS1-F with a sequence as shown in SEQ ID NO. 5 and a primer OE-LrCHS1-R with a sequence as shown in SEQ ID NO. 6, and transforming the recombinant plasmid into Agrobacterium.
[0020] Preferably, the plasmid is pCambia 1300-35s.
[0021] Preferably, the Agrobacterium is Agrobacterium GS115, Agrobacterium LBA4404, Agrobacterium GV3101 or Agrobacterium EHA105.
[0022] The sixth aspect of the present application provides an application of the recombinant bacterium overexpressing the Lycium ruthenicum Murr LrCHS-1 gene in improving the content of anthocyanins in plants.
[0023] Preferably, the recombinant bacterium is Agrobacterium GV3101.
[0024] Preferably, the plant is Lycium barbarum L.
[0025] Preferably, the anthocyanins include procyanidin B1 and pelargonidin chloride.
[0026] Preferably, a bacterial suspension of the recombinant bacterium is injected into the plant.
[0027] The present application has the following beneficial effects: the LrCHS1 gene is first identified from Lycium barbarum L., and through homologous cloning, transient transformation of Lycium barbarum L. and fluorescence quantitative detection, it is first found that overexpression of the LrCHS1 gene can promote accumulation of anthocyanins and improve the content of procyanidin B1 and pelargonidin chloride, and thus can be used for biosynthesis of the anthocyanins. The method for constructing the recombinant plasmid and the recombinant bacterium overexpressing the Lycium ruthenicum Murr LrCHS1 gene can obtain a recombinant expression vector overexpressing the LrCHS1 gene, and the obtained recombinant expression vector can improve the content of procyanidin B1 and pelargonidin chloride in plants, and can be used for biosynthesis thereof. BRIEF DESCRIPTION OF DRAWINGS
[0028] Figure 1 is the expression amount of the LrCHS1 gene in the OE-LrCHS1 overexpression plant and the control in Example 1 of the present application;
[0029] Figure 2 is the content of anthocyanins in the OE-LrCHS1 overexpression plant and the control in Example 1 of the present application. DETAILED DESCRIPTION
[0030] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with specific examples. It should be understood that the specific examples described herein are only used to explain the present application and not to limit the present application. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative efforts fall within the protection scope of the present application.
[0031] Anthocyanidin is one of the most important nutritional components of Lycium ruthenicum Murr. The present application finds an important structural gene LrCHS-1 in regulating anthocyanidin biosynthesis in Lycium ruthenicum Murr. through comprehensive application of homologous cloning, transcriptome differential expression, and Lycium ruthenicum Murr. transient transformation detection technology. The test results show that the gene can be effectively applied to the biosynthesis of Lycium ruthenicum Murr. anthocyanidin compounds procyanidin B1 and pelargonidin chloride.
[0032] Based on the above research results, the present application provides application of the Lycium ruthenicum Murr. LrCHS1 gene in improving anthocyanidin content in plants. The nucleotide sequence of the Lycium ruthenicum Murr. LrCHS1 gene is shown in SEQ ID NO. 1, or the protein encoded by the amino acid sequence shown in SEQ ID NO. 2. Substitution, deletion or addition of one or more amino acids or end modification of the amino acid sequence shown in SEQ ID NO. 2 under the premise of not affecting the protein structure and activity, and the nucleotide sequence encoding the amino acid sequence, also belong to the protection scope of the present application.
[0033] The present application also provides a recombinant expression vector overexpressing the above Lycium ruthenicum Murr. LrCHS1 gene and a construction method thereof.
[0034] The present application will be further described below with specific examples.
[0035] The raw materials, reagents, medicines or instruments used in the following examples are all conventional commercially available products obtained through commercial channels unless otherwise specified. The methods used in the following examples are all conventional methods in the art unless otherwise specified.
[0036] Example 1
[0037] The present example provides cloning and function verification of the Lycium ruthenicum Murr. LrCHS1 gene.
[0038] 1. Cloning of the Lycium ruthenicum Murr. LrCHS1 gene
[0039] Total RNA of Lycium ruthenicum Murr. fruit was isolated using RNA extraction kit from Takara (Takara, Dalian, China). Single-strand cDNA of LrCHS1 gene was prepared using Reverse Aid First-strand cDNA synthesis kit from Thermo Fisher Scientific (Thermo Fisher Scientific, Waltham, MA, USA). The open reading frame (CDS) of LrCHS1 gene was amplified using primers LrCHS1-F and LrCHS1-R, and the components of the amplification system were as follows: 25 μL 2x PCR buffer, 10 μL dNTP (2 mM), 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), 5 μL single-strand cDNA, 1 μL KOD FX Neo (Osaka, Japan) and 10 μL Millipore H2O. The PCR reaction program was set as follows: 98 °C pre-denaturation for 3 min, then 30 cycles, each cycle including denaturation for 10 s, 58 °C annealing for 30 s, 68 °C extension for 2 min; finally, 68 °C extension for 5 min. The amplification product was purified and independently cloned into pMD18-T vector (Toyobo Life Science, Osaka, Japan) for Sanger sequencing.
[0040] LrCHS1-F (as shown in SEQ ID NO. 3): ATGGTCACCGTCGAGGAGGT;
[0041] LrCHS1-R (as shown in SEQ ID NO. 4): CTAAGTAGAGACACTATGGAG.
[0042] The full length of LrCHS1 open reading frame (CDS) is 1170 bp, and the nucleotide sequence is shown in SEQ ID NO. 1:
[0043] ATGGTCACCGTCGAGGAGGTACGAAAGGCACAACGTGCACAAGGTCCGG
[0044] CCACCATCATGGCCATTGGCACAGCCACTCCTTCGAATTGTGTTGATCAAA
[0045] GCACCTATCCCGATTATTATTTTCGAGTCACTAATAGTGAGCATATGACTGA
[0046] GCTTAAGGAGAAATTTAAGCGCATGTGTGACAAATCTATGATTAAGAAGA
[0047] GGTACATGCACTTAACTGAAGAAATCCTAAAAGAAAACCCCAATATTTGT
[0048] GAATACATGGCTCCTTCTATTGATGCTAGGCAAGACATAGTGGTGGTTGAA
[0049] GTGCCAAAACTTGGCAAAGAAGCAGCCCAAAAGGCCATCAAAGAATGGG
[0050] GCCAACCCAAGTCCAAGATTACCCATTTGGTATTTTGCACCACTAGTGGGG
[0051] TGGACATGCCTGGGGCCGACTACCAGCTCACTAAGCTTCTTGGGCTTCGA
[0052] CCCTCCGTTAAGAGGTTCATGATGTACCAACAAGGTTGTTTTGCTGGTGGT
[0053] ACTGTTATCAGATTGGCCAAGGACTTAGCCGAAAACAACAAGGGTGCTCG
[0054] AGTCCTTGTTGTTTGCTCAGAGATCACTGCAGTTACTTTTCGTGGCCCAAG
[0055] TGACACTCACTTGGATAGTATGGTTGGACAAGCCTTATTTGGGGATGGGGC
[0056] AGGTGCACTCATTGTAGGTTCTGATCCATTACCTGAGGTTGAAAGGCCTTT
[0057] ATTCGAGCTTGTCTCAGCAGCCCAAACTCTGCTCCCAGACAGCGAAGGTG
[0058] CTATCGATGGGCACCTTCGTGAAGTTGGGCTAACATTTCACTTACTCAAAG
[0059] ATGTTCCTGGATTGATCTCAAAGAACATTGAGAAGAGCTTGATGGAAGCA
[0060] TTCCAACCATTGGGCATTTCTGATTGGAACTCTCTCTTTTGGATTGCTCATC
[0061] CAGGTGGGCCGGCAATTCTGGACCAAGTTGAACTAAAGTTGGCCTTAAAG
[0062] CCCGAAAAACTTCGAGCTACAAGGCAAGTCTTGAGTGACTATGGAAATAT
[0063] GTCTAGTGCTTGTGTTTTGTTTATTTTGGATGAAATGAGGAAGGCCTCAGC
[0064] CAAAGAAGGGCTTGGTAGCACTGGTGAAGGCCTTGATTGGGGTGTACTCT
[0065] TTGGATTTGGGCCTGGGCTAACAGTTGAGACTGTTGTGCTCCATAGTGTCTCTACTTAG.
[0066] LrCHS1 gene encodes 389 amino acids, the sequence is shown as SEQ ID NO. 2: MVTVEEVRKAQRAQGPATIMAIGTATPSNCVDQSTYPDYYFRVTNSEHMTELKEKFKRMCDKSMIKKRYMHLTEEILKENPNICEYMAPSIDARQDIVVVEVPKLGKEAAQKAIKEWGQPKSKITHLVFCTTSGVDMPGADYQLTKLLGLRPSVKRFMMYQQGCFAGGTVIRLAKDLAENNKGARVLVVCSEITAVTFRGPSDTHLDSMVGQALFGDGAGALIVGSDPLPEVERPLFELVSAAQTLLPDSEGAIDGHLREVGLTFHLLKDVPGLISKNIEKSLMEAFQPLGISDWNSLFWIAHPGGPAILDQVELKLALKPEKLRATRQVLSDYGNMSSACVLFILDEMRKASAKEGLGSTGEGLDWGVLFGFGPGLTVETVVLHSVST.
[0067] 2, Function verification of Lycium ruthenicum Murr. LrCHS1 gene
[0068] 2.1 Transient overexpression transformation
[0069] The LrCHS1 sequence obtained by cloning was constructed into pCambia 1300-35s vector using primers OE-LrCHS1-F and OE-LrCHS1-R, and an OE-LrCHS1 overexpression vector was obtained. The OE-LrCHS1 overexpression vector was transformed into Agrobacterium GV3101 to obtain an OE-LrCHS1 overexpression engineering bacteria. The engineering bacteria were adjusted to OD 600 0.5-0.6 in an infection buffer (5 g / L D-glucose, 50 mM MES, 2 mM Na3PO4·12H2O and 0.1 mM acetonylacetone) and injected into the leaves of Ningxia wolfberry seedlings that had been cultured for 30 days, 5-10 mL per seedling; pCambia 1300-35s-GFP was used as a negative control. The leaves injected with the engineering bacteria suspension were collected 72 h after injection for subsequent real-time fluorescent quantitative PCR (qRT-PCR) and anthocyanin content detection.
[0070] OE-LrCHS1-F (as shown in SEQ ID NO. 5): GCCGACTACCAGCTCACTAA;
[0071] OE-LrCHS1-R (as shown in SEQ ID NO. 6): CACCCTTGTTGTTTTCGGCT.
[0072] 2.2 qRT-PCR detection
[0073] The overexpression of LrCHS1 gene in wolfberry leaves was detected and analyzed using BIO-RAD fluorescent quantitative PCR instrument with wolfberry Ef1a as a reference gene and SYBR Green dye method (primers: CCATACCAGCATCACCATTCTTC, as shown in SEQ ID NO. 7;
[0074] GTCACACTTCCCACATTGCC, as shown in SEQ ID NO. 8).
[0075] The qRT-PCR reaction system was: 12 μL Power Green PCR Master mixture, 1 μL qRTF (10 μM), 5 μL cDNA template and 20 μL ddH2O; the reaction conditions were: 95.0 ℃ pre-denaturation for 5 min; 95.0 ℃ denaturation for 10 s, 55 ℃ annealing for 30 s, 72 ℃ elongation for 20 s, (40 cycles); the melting curve was increased from 65 ℃ to 95 ℃, and each reading was increased by 0.5 ℃. The relative expression level of the target gene was determined using the 2 -ΔΔCT method.
[0076] Through detection of OE-LrCHS1 overexpression plants and controls, the results show that the expression amount of LrCHS1 gene in OE-LrCHS1 overexpression plants is significantly higher than that of GFP. As shown in the following table, the construction method realizes overexpression of LrCHS1 gene. Figure 1
[0077] 2.3 Detection of anthocyanin content,
[0078] The content of anthocyanin in OE-LrCHS1 overexpression plants was determined by liquid chromatography tandem mass spectrometry (LC-MS / MS) method.
[0079] 2.3.1 Sample pretreatment
[0080] Accurately weigh 0.2 g of sample in a 2 ml centrifuge tube, add 1 ml of 5% formic acid, extract on ice for 30 min, centrifuge at 12000 rpm for 10 min, and take the supernatant for LC-MS / MS analysis.
[0081] 2.3.2 Chromatography mass spectrometry acquisition conditions
[0082] The chromatography system uses Waters ultra-high performance liquid system (AcQuity UPLC, Waters, USA), uses Waters HSS T3 (100*2.1mm, 1.8um) liquid chromatography column, the sample amount is 2μL, and the column temperature is 40℃; mobile phase A (0.1% formic acid aqueous solution), mobile phase B (0.1% formic acid-acetonitrile).
[0083] The mass spectrometry system uses Q exactive high-resolution mass spectrometry detection system of Thermo company of USA, which is equipped with electrospray ion source (ESI) and Xcalibur workstation. The mass spectrometry conditions mainly include: using electrospray ion source (ESI), the analyte is analyzed in single ion detection (SIM) mode under positive ion scanning at the same time, which can greatly improve the sensitivity; sheath gas pressure 40arb; auxiliary gas pressure 10arb; ion spray voltage +3000V; temperature 350℃; ion transmission tube temperature 320℃.
[0084] Through detection of OE-LrCHS1 overexpression plants and controls, the results (as shown in the following table) show that overexpression of OE-LrCHS1 significantly increases the accumulation of anthocyanin compounds procyanidin B1 and pelargonidin chloride in plants. It shows that LrCHS1 can promote the accumulation of anthocyanin compounds. Figure 2
[0085] The above merely describes preferred embodiments of the present application, and is not used to limit the present application, any modification, equivalent replacement and improvement within the spirit and principle of the present application should be included in the protection scope of the present application.
Claims
1. Black goji berries LrCHS1 The application of genes in increasing the content of proanthocyanidins B1 and chlorinated pelargonidin in plants is characterized by, The black goji berries LrCHS1 The nucleotide sequence of the gene is shown in SEQ ID NO. 1, or it encodes a protein with an amino acid sequence shown in SEQ ID NO. 2; the plant is Ningxia wolfberry.
2. The application of a protein with the amino acid sequence shown in SEQ ID NO. 2 in increasing the content of proanthocyanidin B1 and chlorinated pelargonidin in plants; the plant being Ningxia wolfberry.
3. Overexpression of the black goji berry as described in claim 1 LrCHS1 The application of recombinant bacteria in increasing the content of proanthocyanidins B1 and chlorinated pelargonidin in plants is characterized by, The plant is Ningxia wolfberry; the application method is: injecting the bacterial suspension of the recombinant bacteria into the plant leaves.
4. The application according to claim 3, characterized in that, The recombinant bacteria is Agrobacterium GV3101.