Sequencing method and kit

Abstract

The invention provides a sequencing method and a kit. The sequencing method comprises: sequencing a library to obtain a sequencing result, the sequencing result comprising first sequencing data and second sequencing data, and sequencing the library to obtain the sequencing result, comprising: (1) adding a sequencing primer, and performing first sequencing on a sequencing template to obtain the first sequencing data by forming a first new chain, the sequencing primer is configured to be hybridized with the 3'terminal of the sequencing template; (2) removing the first new chain; (3) adding a sequencing primer, and carrying out second sequencing on the sequencing template so as to obtain second sequencing data by forming a second new chain; and analyzing the sequencing result, including: (a) performing mutual correction based on at least a part of each of the first sequencing data and the second sequencing data so as to determine at least a part of sequence information of the target nucleic acid molecule. The method is favorable for improving the accuracy of a sequencing result.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a sequencing method and a kit. Background Art

[0002] The quality of sequencing data is related to sequencing methods and sequencing libraries. Currently, there are many studies devoted to the optimization of sequencing library construction and sequencing methods.

[0003] In the process of preparing libraries of trace nucleic acids (e.g., less than 1 ng), inappropriate or abnormal nucleic acid quality, preparation methods, reaction conditions used in the preparation process, including the solution system, such as too low nucleic acid concentration, inappropriate size of the screened nucleic acid fragments, and multiple components in the reaction system may interact and interfere with each other under specific conditions, etc., may all lead to the preparation of low-quality or unqualified libraries, which cannot be used for sequencing.

[0004] Generally speaking, different sequencing platforms have corresponding libraries and sequencing methods.

[0005] Among them, single-molecule sequencing technology and single-molecule sequencing platform have always represented the advanced direction of nucleic acid detection technology. As early as the 1980s, single-molecule sequencing was proposed. In 2003, Dr. Stephen Quake, a professor at the Department of Bioengineering at Stanford University, successfully demonstrated the first single-molecule DNA sequencing experiment; in 2008, Helicos' first single-molecule sequencer (HeliScope) was launched; in 2009, Korlach and Turner published a paper in Science magazine to introduce the principle of PacBio single-molecule sequencing technology. Subsequently, PacBio launched the PacBio RS sequencing system in 2010 and officially commercialized it in 2011. In 2014, Oxford Nanopore demonstrated its MinION sequencing system at the AGBT (Annual Meeting on Advances in Genome Biology and Technology). It is reported that the sequencing error rate of single-pass sequencing of any of the above sequencing platforms is very high, up to 30%, and the error type is mainly InDel (insertion and deletion) and occurs randomly. It is generally believed that this sequencing error rate can be reduced by multiple reads.

[0006] Therefore, the existing library construction methods and sequencing methods that are suitable for sequencing-by-synthesis platforms need to be improved. Summary of the invention

[0007] In order to solve at least one of the above-mentioned prior art problems to a certain extent, the present invention provides a library preparation method, a library preparation kit and a sequencing method.

[0008] In an embodiment of the present invention, a method for preparing a library is provided, comprising: obtaining a target nucleic acid molecule, which is a double-stranded nucleic acid molecule, comprising: reverse transcribing RNA derived from a nucleic acid sample to be tested to obtain a reverse transcription product, wherein the reverse transcription product includes an RNA:DNA hybrid double strand, and enriching the RNA:DNA hybrid double strand in the reverse transcription product to obtain the target nucleic acid molecule; providing a transposition complex, wherein the transposition complex includes a linker and a transposase, wherein the linker is a double-stranded nucleic acid molecule with a known sequence; contacting the target nucleic acid molecule and the transposition complex under conditions suitable for a transposition reaction to obtain a transposition product, wherein the transposition product includes a double-stranded nucleic acid molecule with a linker at the end and a gap; providing a first primer, wherein the first primer is configured to hybridize with at least a portion of the linker; and hybridizing the transposition product with the first primer and placing the transposition product under conditions suitable for a strand displacement reaction to obtain the library.

[0009] The above-mentioned library preparation method belongs to the RNA library construction method. Compared with the conventional RNA library preparation, this method is simple to operate and is conducive to the rapid preparation of the library, and is particularly suitable for the preparation of the library of the nucleic acid sample with a low starting amount; specifically, the RNA:DNA hybrid double strand after efficient enrichment is transposed by using the transposition complex, and the fragmentation of the RNA:DNA hybrid double strand, the repair of the fragmented product, and the connection of the linker of the fragmented product are achieved in one step in the same solution system, and without purification or separation, the primer (first primer) and polymerase (non-hot start DNA polymerase) are added to the solution system of the previous step reaction to perform a chain displacement reaction to fill the gap on the nucleic acid molecule of the transposition product, and obtain the target nucleic acid molecule with linkers at both ends. The library prepared by this method can be sequenced on various sequencing platforms and is conducive to obtaining accurate measurement results.

[0010] According to a specific embodiment of the present invention, the library construction method also includes at least one of the following additional technical features.

[0011] In certain specific embodiments, the amount of RNA contained in the nucleic acid sample to be tested or the starting amount of RNA for library construction is not less than 5 pg, preferably not less than 10 pg. The library construction method of this embodiment can realize library construction for such starting amount of nucleic acid, and the constructed library meets the requirements of sequencing. Optionally, the starting amount of nucleic acid does not need to be more than 50 pg. The library construction method of this embodiment has very low requirements for the starting amount of nucleic acid, and is particularly suitable for nucleic acid samples that are difficult to extract or precious and rare.

[0012] In some specific embodiments, obtaining the target nucleic acid molecule further includes: denaturing the RNA before performing the reverse transcription. Specifically, in one example, the RNA is placed at 65° C. for 3 to 10 minutes to achieve the denaturation. In this way, as much RNA in the primary structure as possible can be obtained, which is conducive to more efficient reverse transcription.

[0013] This embodiment has no limitation on the applicable reverse transcriptase, and the purpose of the reverse transcription step is to obtain RNA:DNA hybrids. Based on the different types of RNA contained in the sample, different primers can be selected for reverse transcription, such as random primers, specific primers (such as oligo dT), etc.

[0014] In some specific embodiments, reverse transcription is performed using a mixed primer, which includes Oligo dT (an oligonucleotide chain composed of T) and a random primer. In this way, the mixed primer is conducive to reverse transcription, and reverse transcription products of various RNAs can be obtained in a relatively balanced manner.

[0015] Specifically, in one example, the length of Oligo dT is 12 to 20 nt, and / or the length of the random primer is 4 to 8 nt. In this way, it is beneficial to effectively and balancedly achieve reverse transcription of various RNAs. Optionally, the ratio of Oligo dT and random primers in the reverse transcription reaction system can be further set to 1:2 to 1:6, so that reverse transcription products of various RNAs can be better obtained.

[0016] In some specific embodiments, magnetic beads are used for so-called enrichment. The enrichment treatment is to replace the reaction solution system, that is, to remove the reverse transcription reaction solution system by removing the supernatant after enrichment, and to increase the concentration of RNA:DNA hybrids to bind to the surface of magnetic beads, so as to facilitate more efficient subsequent reactions, such as the effect on the efficiency of subsequent transposition reactions. In particular, the enrichment treatment is important for the construction of libraries (library construction) of samples with low starting amounts, which affects whether the constructed library can meet the requirements of sequencing.

[0017] Magnetic beads are widely used in library construction, but the capture performance of different magnetic beads varies greatly. Among them, the main factors causing the difference in magnetic bead performance are as follows: (1) The basic properties of magnetic beads will be different due to different middle-layer matrices; (2) The adsorption characteristics of magnetic beads will be different due to different modified functional groups. For example, carboxyl modified group magnetic beads can obtain higher yields and less non-specific binding than hydroxyl groups; (3) Different particle sizes. Generally speaking, the larger the particle size, the stronger the magnetism; (4) Different functional group modification processes will result in different functional group densities and arm lengths, and different surface charges, repulsions, and hydrogen bond numbers, and the adsorption capacity will change accordingly; (5) Different magnetic bead buffer formulas will also have different effects. For example, different lubricants such as Tween-20 will affect the residue of magnetic beads; (6) Different reaction liquid ionic strength, pH value and other conditions will directly affect the activity of magnetic bead functional groups. Therefore, choosing appropriate magnetic beads for effective enrichment of hybrid double strands is conducive to obtaining accurate detection and measurement results in the subsequent process.

[0018] In some examples, the inventors selected and tested a series of commercially available magnetic beads and found that using magnetic beads with carboxyl modified groups (carboxyl or carboxyl-containing groups) on the surface for enrichment can better enrich the target nucleic acid molecules and facilitate the construction of a high-quality library. In particular, the test results of the magnetic beads with the catalog number 12601ES03 of Yeasen Company were better.

[0019] The target nucleic acid molecule is interrupted (fragmented) and connected with a linker by using a transposition reaction. In certain embodiments, the transposition complex is a Tn5 transposition complex, wherein the transposase contained is a Tn5 transposase or an engineered enzyme thereof, and the linker contained is one or two double-stranded nucleic acid molecules with known sequences, and at least a portion of the linker can hybridize / complementarily pair with the first primer to perform a subsequent strand displacement reaction, and optional PCR. Specifically, in one example, the linker has a sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2, and can be well matched with the Tn5 transposase to achieve transposition library construction (library construction).

[0020] In some specific embodiments, the method further comprises adding a stop solution to the solution system of the transposition reaction to terminate the transposition reaction, and specifically, the stop solution comprises SDS. The solution system comprising the stop solution does not need to be purified or separated to replace the solution system, and can be directly used as the solution system for subsequent strand displacement or PCR reactions.

[0021] In certain specific embodiments, the first primer has a sequence as shown in SEQ ID NO: 3 and SEQ ID NO: 4. The primer can hybridize with at least a portion of the sequence at the 3' end of the adapter, and under the catalysis of a polymerase with a strand displacement function, a new strand can be synthesized to fill the gap on the transposition product nucleic acid molecule, thereby obtaining a target nucleic acid molecule with adapters at both ends, thereby constructing a library.

[0022] Furthermore, in one example, after the strand displacement reaction, the strand displacement reaction product is subjected to PCR, and the PCR can be performed using the same solution system as the strand displacement reaction. In this way, it can be further ensured that the amount of the library meets the requirements of sequencing on the machine.

[0023] In an embodiment of the present invention, a kit is provided, which is used to implement the library preparation method in any of the above embodiments to prepare a library, and the kit includes: a first reagent for achieving reverse transcription, a second reagent for achieving enrichment, a transposition complex, and a first primer. The advantages and technical features of the method for preparing a library in any of the above embodiments are also applicable to the kit, and will not be repeated here.

[0024] In some examples, the first reagent comprises reverse transcriptase and mixed primers; the second reagent comprises magnetic beads, in particular magnetic beads with carboxyl modification groups; and the transposition complex is a Tn5 transposition complex.

[0025] In addition, in some examples, the kit also includes a stop solution for terminating the transposition reaction.

[0026] In an embodiment of the present invention, a sequencing method is provided, comprising: preparing a library using the method in any of the above embodiments; and sequencing the library to obtain a sequencing result. According to the sequencing result, using the sequencing method, that is, sequencing the library prepared using the library preparation method in any of the above embodiments, it is possible to obtain high-quality sequencing data and obtain accurate sequencing results. It is understandable that the advantages and technical features of the library preparation method in any of the above embodiments are also applicable to the sequencing method, and will not be repeated here.

[0027] According to a specific embodiment of the present invention, the sequencing method also includes at least one of the following additional technical features.

[0028] In some specific embodiments, before sequencing, the method further comprises: connecting the library to a solid substrate surface, the solid substrate surface carries a probe, and the probe is configured to hybridize with at least a portion of the connector. The so-called probe, also known as a primer, is a strand of oligonucleotides with a known sequence. The so-called solid substrate is selected from at least one of glass, silicon wafer, plastic, gel and nylon membrane. In some examples, glass is used as a solid substrate, and the solid substrate is surface-modified so that the surface of the solid substrate carries a silane group to connect / fix the probe, and then the probe is hybridized with the connector to connect the library to the surface of the solid substrate.

[0029] In some examples, the connector includes a first connector and a second connector, the probe includes a first probe and a second probe, the first probe is configured to hybridize with at least a portion of the first connector, and the second probe is configured to hybridize with at least a portion of the second connector, and the method includes: denaturing the library to obtain a single-stranded library; connecting the single-stranded library to a solid substrate surface; and amplifying the single-stranded library on the solid substrate surface to obtain a sequencing template.

[0030] Amplification can be, for example, bridge-PCR or template walking.

[0031] In certain specific embodiments, before sequencing, the method further comprises: melting the library to obtain a single-stranded library; connecting the single-stranded library to a solid substrate surface, wherein the solid substrate surface carries a probe, the probe is covalently connected to the solid substrate surface, and the probe is configured to hybridize with at least a portion of the connector; using the single-stranded library as a template, extending the probe to synthesize a complementary chain of the single-stranded library to form a sequencing template.

[0032] Furthermore, in certain specific embodiments, it also includes: removing the single-stranded template and performing a first blocking treatment on the nucleic acid molecules on the surface of the solid substrate to obtain a sequencing template, and the so-called first blocking treatment includes binding an extension blocker to the 3' end of the nucleic acid molecules on the surface of the solid substrate.

[0033] The so-called first blocking treatment can block the active groups / 3' ends of the single-stranded nucleic acid molecules on the surface of the solid substrate, such as blocking residual single-stranded templates, unreacted probes, etc., to avoid the binding or adsorption of these nucleic acid molecules to subsequent reaction components and interference with subsequent reactions, which is conducive to the acquisition of subsequent high-quality sequencing data.

[0034] In some examples, the so-called first blocking treatment includes binding the extension blocker to the 3' end of the nucleic acid molecule attached to the surface of the solid phase substrate under the action of terminal transferase, and the extension reaction blocker can be selected from at least one of ddNTP and its derivatives.

[0035] Specifically, in some examples, the blocking solution used in the first blocking treatment includes ddATP, ddTTP, ddCTP, ddGTP and terminal transferase. More specifically, in one example, the blocking solution used in the first blocking treatment includes the following components: 100U / ml Terminal Transferase (NEB, M0315L), 1×Terminal Transferase Buffer, 0.25mM cobalt chloride, 100μM ddNTP mix (a mixture of 100μM each of ddATP, ddTTP, ddCTP, and ddGTP). In this way, it is beneficial to efficiently determine the sequence of the target nucleic acid molecule and obtain high-quality sequencing data.

[0036] In some specific embodiments, the method further comprises: performing a second blocking treatment on the incompletely extended complementary chain, wherein the second blocking treatment comprises binding an extension blocker to the 3' end of the incompletely extended complementary chain, thereby facilitating the subsequent efficient determination of the sequence of the target nucleic acid molecule and obtaining high-quality sequencing data.

[0037] In some examples, the so-called second blocking treatment includes allowing an extension reaction blocker to bind to the 3' end of the incompletely extended complementary chain under the action of a DNA polymerase, and the extension reaction blocker is selected from at least one of ddNTP and its derivatives.

[0038] In certain specific embodiments, the sequencing result includes first sequencing data and second sequencing data, and sequencing the library to obtain the sequencing result includes: (1) adding a sequencing primer and performing a first sequencing on the sequencing template to obtain the first sequencing data by forming a first nascent chain, and the sequencing primer is configured to hybridize with the 3' end of the sequencing template; (2) removing the first nascent chain; (3) adding a sequencing primer and performing a second sequencing on the sequencing template to obtain the second sequencing data by forming a second nascent chain. Using this sequencing method, two or more sequencing data of the same position on the target nucleic acid molecule can be obtained. Through the mutual correction processing of the two or more data, the sequencing error rate can be effectively reduced to obtain accurate sequencing results. It is particularly suitable for sequencing samples with high requirements for data accuracy or sequencing using a single molecule sequencing platform.

[0039] In certain specific embodiments, (2) further comprises: performing a third blocking treatment on the 3' end of the first nascent chain remaining on the surface of the solid substrate, wherein the blocking treatment comprises binding an extension blocker to the 3' end of the first nascent chain.

[0040] Specifically, in some examples, the third blocking treatment includes binding an extension reaction blocker to the 3' end of the first nascent chain under the action of a DNA polymerase, and the extension reaction blocker can be selected from at least one of ddNTP and its derivatives.

[0041] The so-called second blocking treatment and / or third blocking treatment can block the 3' ends of non-target double-stranded nucleic acid molecules on the surface of the solid phase substrate, which can reduce the impact of these double-stranded nucleic acid molecules on subsequent steps or reactions. For example, the third blocking treatment can effectively block the first nascent chain that has not been removed, thereby improving the yield and quality of the second sequencing data, thereby improving the accuracy of the sequencing results.

[0042] Specifically, in some examples, the second blocking treatment and / or the third blocking solution used contains ddATP, ddTTP, ddCTP, ddGTP and DNA polymerase, wherein the DNA polymerase can be selected from taq, Klenow fragment, etc. More specifically, in a certain example, the second blocking treatment and / or the third blocking solution used contains the following components: 100U / ml Klenow large fragment, 12.5μM ddNTP mix (a mixture of 12.5μM each of ddATP, ddTTP, ddCTP, and ddGTP), 5mM manganese chloride, 20mM tris(hydroxymethyl)aminomethane, 10mM sodium chloride, 10mM potassium chloride, 10mM ammonium sulfate, 3mM magnesium chloride and 0.1% Triton X-100, and the pH is 8.3. In this way, it is conducive to efficiently determine the sequence of the target nucleic acid molecule and obtain high-quality sequencing data.

[0043] In one example, the sequencing primer has a sequence as shown in SEQ ID NO:6.

[0044] In some specific embodiments, the sequencing results are analyzed, including: (a) mutual correction based on at least a portion of the first sequencing data and the second sequencing data to determine at least a portion of the sequence information of the target nucleic acid molecule.

[0045] In some examples, the first sequencing data and the second sequencing data both contain multiple reads, and the so-called mutual correction includes: selecting high-quality reads and corresponding reads of the high-quality reads in the first sequencing data and the second sequencing data, the length of the high-quality reads is not less than a predetermined length, and the high-quality reads have a sequencing quality not less than a predetermined quality threshold; and aligning the high-quality reads with the corresponding reads of the high-quality reads, and performing sequence information correction based on the alignment results.

[0046] In some specific embodiments, (a) includes: (a-1) constructing a first read set based on the first sequencing data according to the length of the read, the length of each read in the first read set is not less than a first predetermined length; (a-2) constructing a second read set and a third read set based on the first read set according to the length of the corresponding read, the length of the corresponding read of each read in the second read set is not less than the second predetermined length, and the length of the corresponding read of each read in the third read set is within the predetermined length range; (a-3) constructing a fourth read set and a fifth read set based on the second read set and its corresponding reads according to the sequencing quality of the reads in the second read set and their corresponding reads, wherein the fourth read set and the fifth read set can be determined according to the following principles: comparing the sequencing quality of the reads in the second read set and their corresponding reads, selecting the one with higher sequencing quality as the element of the fourth read set, and selecting the one with higher sequencing quality as the element of the fourth read set; The one with lower quality is selected as the element of the fifth read set, and for the case where the sequencing quality is the same, the read from the second read set is selected as the element of the fourth read set, and the corresponding read is selected as the element of the fifth read set; (a-4) using the sequencing quality, filtering the fourth read set to construct a sixth read set, and the sequencing quality of the reads in the sixth read set is not lower than the first predetermined quality threshold; (a-5) using the sixth read set, selecting the read corresponding to the read in the sixth read set from the fifth read set to construct the seventh read set; (a-6) comparing the sixth read set with the seventh read set, and determining the first difference site on the reads of the sixth read set; and (a-7) using a predetermined sequencing error prediction model to correct the first difference site to determine the first sequence information, the sequencing error prediction model is used to determine the probability of insertion or deletion of the difference site during the sequencing process.

[0047] Specifically, in some examples, it further includes: (a-4a) using sequencing quality to filter the third read set to construct an eighth read set, wherein the sequencing quality of the reads in the eighth read set is not less than a second predetermined quality threshold; (a-5a) using the eighth read set to select reads corresponding to the reads in the seventh read set from the second sequencing data to construct a ninth read set; (a-6a) performing read comparison between the eighth read set and the ninth read set, and determining second difference sites on the reads of the eighth read set; and (a-7a) using a sequencing error prediction model to correct the second difference site to determine second sequence information.

[0048] Specifically, in some examples, the so-called sequencing error prediction model is obtained by training a naive Bayes model based on the comparison results of the first sequencing data and the second sequencing data with the reference genome.

[0049] Further, in some examples, for the first difference site and the second difference site: if the reads from the sixth read set have bases at the difference site, the corresponding reads from the seventh read set do not have bases at the difference site, and the probability of a deletion at the difference site is greater than 50%, then the bases of the reads from the sixth read set at the difference site are retained as the final sequencing results; if the reads from the sixth read set do not have bases at the difference site, the corresponding reads from the seventh read set have bases at the difference site, and the probability of an insertion at the difference site is greater than 50%, then the bases of the reads from the seventh read set at the difference site are retained as the final sequencing results; and if the reads from the sixth read set have bases at the difference site, the corresponding reads from the seventh read set also have bases at the difference site, then the bases of the reads from the sixth read set at the difference site are selected as the final sequencing results.

[0050] In some examples, the first predetermined length and the second predetermined length are each independently not less than 20 bp, preferably not less than 25 bp.

[0051] In some examples, the predetermined length ranges from 10 to 25 bp.

[0052] In some examples, the first predetermined quality threshold and the second predetermined quality threshold are independently not less than 50, preferably not less than 60. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 A schematic diagram showing the bioanalyzer detection results of libraries of nucleic acid samples with different starting amounts that have not been enriched with Yeasen cfDNA magnetic beads in one embodiment, wherein G1, G2 and G3 correspond to libraries with starting amounts of 10 pg, 50 pg and 100 pg, respectively.

[0054] Figure 2 A schematic diagram showing the bioanalyzer detection results of libraries of nucleic acid samples with different starting amounts enriched by Yeasen cfDNA magnetic beads in one embodiment, wherein G4, G5 and G6 correspond to libraries with starting amounts of 10 pg, 50 pg and 100 pg, respectively.

[0055] Figure 3 A schematic diagram showing the bioanalyzer detection results of libraries of nucleic acid samples with different starting amounts without enrichment by Yeasen clean magnetic beads in one embodiment, wherein G7, G8 and G9 correspond to libraries with starting amounts of 10 pg, 50 pg and 100 pg, respectively.

[0056] Figure 4A schematic diagram showing the bioanalyzer detection results of libraries of nucleic acid samples with different starting amounts enriched with Yeasen clean magnetic beads in one embodiment, wherein G10, G11 and G12 correspond to libraries with starting amounts of 10 pg, 50 pg and 100 pg, respectively.

[0057] Figure 5 A schematic diagram showing the bioanalyzer detection results of libraries of nucleic acid samples with different starting amounts without CZ1000 nM enrichment in one embodiment, wherein G13, G14 and G15 correspond to libraries with starting amounts of 10 pg, 50 pg and 100 pg, respectively.

[0058] Figure 6 A schematic diagram showing the bioanalyzer detection results of libraries of nucleic acid samples with different starting amounts enriched with CZ1000 nM in one embodiment, wherein G16, G17 and G18 correspond to libraries with starting amounts of 10 pg, 50 pg and 100 pg, respectively.

[0059] Figure 7 A schematic diagram showing the bioanalyzer detection results of libraries of nucleic acid samples with different starting amounts without CZ500nM enrichment in one embodiment, wherein G19, G20 and G21 correspond to libraries with starting amounts of 10pg, 50pg and 100pg, respectively.

[0060] Figure 8 A schematic diagram showing the bioanalyzer detection results of libraries of RNA samples with different starting amounts enriched with CZ500 nM in one embodiment, wherein G19, G20 and G21 correspond to libraries with starting amounts of 10 pg, 50 pg and 100 pg, respectively.

[0061] Fig. 9 A schematic diagram showing the bioanalyzer detection results of libraries of RNA samples with different starting amounts without CZ200 nM enrichment in one embodiment, wherein H1, H2 and H3 correspond to libraries with starting amounts of 10 pg, 50 pg and 100 pg, respectively.

[0062] Fig.10 A schematic diagram showing the bioanalyzer detection results of libraries of RNA samples with different starting amounts enriched with CZ 200 nM in one embodiment, wherein H4, H5 and H6 correspond to libraries with starting amounts of 10 pg, 50 pg and 100 pg, respectively.

[0063] Fig.11 A schematic diagram showing the bioanalyzer detection results of libraries of RNA samples with different starting amounts without NW700nM enrichment in one embodiment, wherein H7, H8 and H9 correspond to libraries with starting amounts of 10pg, 50pg and 100pg, respectively.

[0064] Fig.12 A schematic diagram showing the bioanalyzer detection results of libraries of RNA samples with different starting amounts enriched with NW700 nM in one embodiment, wherein H10, H11 and H12 correspond to libraries with starting amounts of 10 pg, 50 pg and 100 pg, respectively.

[0065] Fig.13 A schematic diagram showing a two-pass sequencing process in one embodiment. DETAILED DESCRIPTION

[0066] The embodiments of the present invention are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, but should not be construed as limiting the present invention. The reagents, detection instruments, etc. in the examples, unless otherwise specified, can be self-prepared or obtained through commercial channels.

[0067] In the description of the present invention, it should be understood that the terms "first", "second", etc. are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, features defined as "first", "second", etc. may explicitly or implicitly include one or more of the features.

[0068] In the description of the present invention, “plurality” means two or more than two, unless otherwise clearly and specifically defined.

[0069] The so-called "sequencing" and "sequencing determination" are the same as nucleic acid sequence determination, including DNA sequencing and / or RNA sequencing, including long fragment sequencing and / or short fragment sequencing. Generally, in sequencing based on the principle of sequencing by synthesis (SBS), a base or a specific type of base can be determined through one round of sequencing reaction, and the substrate used in the sequencing reaction is generally a nucleotide analog. In the sequencing reaction of sequencing by synthesis and / or sequencing by ligation, the so-called one round of sequencing reaction includes extension reaction (base extension), information collection (such as taking pictures / image acquisition) and group excision (cleavage). The so-called "nucleotide analog" is also called a reversible terminator (reversible terminator or terminator), which is an analog of A, T, C, G and / or U, which can follow the principle of base complementarity and pair with a specific type of base, and can terminate the binding of the nucleotide / substrate to the next position of the template.

[0070] The so-called "probe" can be DNA and / or RNA, etc., and in some embodiments can also be called "primer", "capture strand" or "immobilized strand". The so-called "probe" can be randomly distributed or regularly distributed on the substrate surface, such as array distribution.

[0071] The so-called "solid phase substrate" can be any solid support that can be used to fix nucleic acid sequences, such as nylon membranes, glass sheets, plastics, silicon wafers, magnetic beads, etc. Unless otherwise specified, the chip surface and the solid phase substrate surface can be used interchangeably. Generally, the substrate substrate surface is a chemically modified surface with reactive groups that can be connected to the probe. Surface modification, fixation, etc. can be performed using known methods or directly customized or purchased.

[0072] The so-called "adsorption" generally refers to non-specific adsorption, which refers to adsorption caused by non-covalent bond forces. Non-covalent bond forces include hydrophobic forces, van der Waals forces, electrostatic forces, etc.; in the process of nucleic acid detection based on the principle of base complementarity on a chip with probes on the surface, generally speaking, non-specific adsorption of nucleic acid molecules refers to the non-covalent connection of nucleic acid molecules to the chip surface and / or probes.

[0073] The so-called "read segment" refers to the sequence fragment obtained by measuring the DNA or RNA sequence, including the sequence obtained by measuring and identifying at least a part of the DNA or RNA using a sequencing platform. The sequencing platform can be selected from but not limited to the sequencing platforms such as Illumina's Hisq / Miseq / Nextseq, Thermo Fisher (Life Technologies)'s IonTorrent platform, BGI's BGISEQ platform and single-molecule sequencing platform. The sequencing method can be selected from single-end sequencing or double-end sequencing. The data obtained from the machine are the fragments read out, which are called read segments.

[0074] The so-called "alignment" refers to sequence alignment, which is the matching or pairing of one sequence with another sequence, including the process of locating the read segment to the reference sequence, and also includes the process of obtaining the read segment positioning / matching result.

[0075] Example

[0076] The total RNA of empty-loaded Escherichia coli DH5a was extracted as the starting nucleic acid. The starting amount of sample nucleic acid was set at three gradients: 10pg, 50pg and 100pg. The library construction effects of the six magnetic beads were compared. At the same time, two groups of comparative experiments were set for each magnetic bead. The starting amount of each experimental sample was set at three gradients of 10pg, 50pg and 100pg: the library construction method using magnetic beads enrichment and the library construction method not using magnetic beads enrichment were used to compare the library construction effects of the two different methods.

[0077] The same magnetic beads were used in the enrichment and purification steps and the magnetic bead purification steps in the same library construction process. The six types of magnetic beads used were: Group A Yeasen cfDNA magnetic beads (Cat NO: 12599ES03, Yeasen), Group B Yeasen clean magnetic beads (Cat NO: 12601ES03, Yeasen), Group C CZ1000 (Cat NO: A2401-1000, LONGMARCH), Group D CZ500nm (Cat NO: A2401-500, LONGMARCH), Group E CZ200nm (Cat NO: A2401-200LONGMARCH), Group F NW700nm (Cat NO: MSRSH-070, NanoMicro). The detailed information of the six magnetic beads is shown in Table 1.

[0078] Table 1

[0079] Magnetic beads name Magnetic bead surface modification Bead size YeasencfDNA Magnetic Beads carboxyl 1000nM Yeasenclean Magnetic Beads carboxyl 1000nM CZ1000 Hydroxyl 1000nM CZ500nm Hydroxyl 500nM CZ200nm Hydroxyl 200nM NW700nm Hydroxyl 700nM

[0080] Step 1: Construction of sequencing library

[0081] 1. RNA denaturation

[0082] The RNA was configured into three concentrations of 10 pg / μl, 50 pg / μl, and 100 pg / μl, and 6*2*3=36 experiments were performed in parallel (where "6" means 6 types of magnetic beads, "2" means two control experiments of library flow for each magnetic bead, and "3" means that the starting amount of nucleic acid in each experiment was set to 3 concentration gradients), as shown in Table 2.

[0083] Table 2

[0084]

[0085]

[0086] The reaction system was configured as shown in Table 3.

[0087] Table 3

[0088]

[0089] After mixing the above reaction system, put it into the preheated PCR instrument at 65℃ for 5 minutes and immediately put it on ice for 2 minutes.

[0090] 2. RNA reverse transcription

[0091] The RNA was reverse transcribed using a Yeasen reverse transcription kit, the kit number is Cat NO: 11112ES92, and the reaction system was configured as shown in Table 4.

[0092] Table 4

[0093] Reagents volume Previous step reaction solution 13μl 5xHifairIVbuffer 4μl dNTPmix (10 μM) 1μl HifairIVRtase (200U / μl) 1μl Tiangen inhibitor (40U / μl, CatNO:NG209) 1μl Total 20μl

[0094] After mixing the above reaction system, place it in a PCR instrument and run the following program:

[0095] 25℃5min, 50℃15min, 85℃5min, 12℃hold;

[0096] After the reaction, the 6 enrichment group experiments carried out the magnetic bead enrichment step in step 3, adding corresponding magnetic beads for enrichment, and the 6 non-enriched groups were first stored at 4°C. After the enrichment group was completed, the Tn5 transposition reaction was carried out together.

[0097] 3. Magnetic beads enrichment

[0098] Add one volume of magnetic beads (20 μl) respectively, incubate at room temperature for 5 minutes, and place on the magnetic stand for 5 minutes. Remove the supernatant and proceed to the next step immediately. Add water immediately to dissolve the magnetic beads to avoid loss due to drying.

[0099] 4. Tn5 transposition

[0100] The Tn5 transposition reaction was performed using a commercially available Tn5 transposition complex kit according to the kit instructions, such as a kit with a catalog number of CatNO: C0BD01-01AA from Shenzhen GeneMind Biotechnology Co., Ltd. (GeneMind) and a reaction system configured as shown in Table 5. The kit comprises a linker and a Tn5 transposase, wherein the linker is composed of SEQ ID NO: 1 and SEQ ID NO: 2 with a phosphate group modified at the 5' end: TCAGATCCTACAACGACGCTCTACCGATGAAGATGTGTATAAGAGACAGT (SEQ ID NO: 1) and CTGTCTCTTATACACATCTGAGTGGAACTGGATGGTCGCAGGTATCAAGGA (SEQ ID NO: 2)

[0101] Note: When preparing the magnetic bead enrichment group, water should be added first to dissolve the magnetic beads and mix them evenly to prevent the magnetic beads from over-drying; put the 5× fragmentation buffer-2 to room temperature in advance, then mix 5× fragmentation buffer-2 and 5× fragmentation buffer, add this mix first, mix evenly, and then add the transposase.

[0102] Table 5

[0103] Reagents Volume (enriched group) Volume (non-enriched group) Magnetic beads enriched product 0 20μl water 11μl / 5× Fragmentation Buffer-2 4μl 4μl 5× Fragmentation Buffer 4μl 4μl Fragmentation complex 1μl 1μl total 20μl 29μl

[0104] After mixing the above reagents, place them in a preheated PCR instrument and run the following program: 55℃10min, 4℃hold.

[0105] 5. Termination of transposition reaction

[0106] The reaction can be terminated using the stop solution with catalog number C0BD01-01AA from Shenzhen GeneMind Biotechnology Co., Ltd.

[0107] Enrichment group: Add 5 μl of 5× termination reaction buffer and mix well, incubate at room temperature for 5 min to terminate the reaction.

[0108] Non-enriched group: Add 7.5 μl 5× termination reaction buffer and mix well, incubate at room temperature for 5 min to terminate the reaction.

[0109] 6. Amplification

[0110] The PCR reaction system was configured as shown in Table 6.

[0111] Table 6

[0112]

[0113] Primer 1: 5'-TTCCTCAGATCCTACAACGACGCTCTACCGAT-3' (SEQ ID NO: 3);

[0114] Primer 2: 5'-TTCTCCTTGATACCTGCGACCATCCAGTT-3' (SEQ ID NO: 4).

[0115] Run the PCR reaction according to the program shown in Table 7 below.

[0116] Table 7

[0117]

[0118]

[0119] 7. Magnetic bead purification

[0120] (1) 0.8× purification:

[0121] According to the volume of each reaction, 0.8× purified magnetic beads were added, mixed, and left at room temperature for 5 min;

[0122] Place on a magnetic stand until clarified and discard the supernatant;

[0123] Add 200 μl 80% ethanol and pipette 10 times, let stand for 30 seconds, and discard the supernatant;

[0124] Add 200 μl 80% ethanol and pipette 10 times, let stand for 30 seconds, and discard the supernatant;

[0125] Centrifuge briefly, place on a magnetic rack, remove the supernatant completely, and dry at room temperature;

[0126] Remove the sample tube, add 20 μl of clean water, mix well, and let stand at room temperature for 5 min;

[0127] Centrifuge briefly and place on a magnetic rack until clarified. Take 18 μl of the supernatant and transfer it to a new 1.5 ml tube for the next purification step.

[0128] (2) 1× purification:

[0129] Add 1× purified magnetic beads (18 μl) to 18 μl of supernatant, mix well, and leave at room temperature for 5 min;

[0130] Place on a magnetic stand until clarified and discard the supernatant;

[0131] Add 200 μl 80% ethanol and pipette 10 times, let stand for 30 seconds, and discard the supernatant;

[0132] Add 200 μl 80% ethanol and pipette 10 times, let stand for 30 seconds, and discard the supernatant;

[0133] Centrifuge briefly, place on a magnetic rack, remove the supernatant completely, and dry at room temperature;

[0134] Remove the sample tube, add 17 μl of clean water, mix well, and let stand at room temperature for 5 min;

[0135] Centrifuge briefly and place on a magnetic rack until clarified. Take 15 μl of the supernatant and transfer it to a new 1.5 ml tube to obtain the sample library, which is stored at -20°C.

[0136] 8. Quantification

[0137] The library in step 7 was detected by microfluidic capillary electrophoresis using Labchip GX Touch (PerkElmer). The concentration of the detected purified product is shown in Table 8. It can be seen from Table 8 that the concentration of the library prepared by enrichment and purification using Yeasen clean magnetic beads and CZ1000nm magnetic beads is higher than the concentration of the library prepared by enrichment and purification using other magnetic beads. At the same time, it can be seen that the concentration of the library prepared without enrichment and purification using magnetic beads is much higher than the concentration of the library prepared by enrichment and purification using magnetic beads.

[0138] The test results are shown in the figure below: Figure 1-12 As shown,

[0139] Figure 1 :Library construction of RNA samples with different starting amounts without Yeasen cfDNA beads enrichment, and the results of library detection by bioanalyzer, where G1, G2, and G3 correspond to libraries constructed with 10pg, 50pg, and 100pg starting amounts of RNA samples, respectively. Yeasen cfDNAbeads_no enrichment_10pg;

[0140] Figure 2 : Schematic diagram of the library construction after RNA samples with different starting amounts were enriched by Yeasen cfDNA magnetic beads, and the library was tested by a bioanalyzer, where G4, G5, and G6 correspond to libraries constructed from RNA samples with starting amounts of 10pg, 50pg, and 100pg, respectively;

[0141] Figure 3 : Schematic diagram of library construction using RNA samples with different starting amounts without enrichment using Yeasen clean magnetic beads, and the results of library detection using a bioanalyzer, where G7, G8, and G9 correspond to libraries constructed using RNA samples with starting amounts of 10 pg, 50 pg, and 100 pg, respectively;

[0142] Figure 4 : Schematic diagram of the library construction after different starting amounts of RNA samples were enriched with Yeasen clean magnetic beads, and the library was tested by a bioanalyzer, where G10, G11 and G12 correspond to libraries constructed from 10pg, 50pg and 100pg starting amounts of RNA samples, respectively;

[0143] Figure 5 : Schematic diagram of library construction with different starting amounts of RNA samples without CZ1000nM enrichment, and the results of library detection by bioanalyzer, where G13, G14 and G15 correspond to libraries constructed with 10pg, 50pg and 100pg starting amounts of RNA samples, respectively;

[0144] Figure 6 : The RNA samples with different starting amounts were enriched with CZ1000nM for library construction, and the results of library detection by bioanalyzer were shown in Figure 1, where G16, G17, and G18 correspond to libraries constructed from RNA samples with starting amounts of 10pg, 50pg, and 100pg, respectively;

[0145] Figure 7 : Schematic diagram of library construction with different starting amounts of RNA samples without CZ 500nM enrichment, and the results of library detection by bioanalyzer, where G19, G20 and G21 correspond to libraries constructed with 10pg, 50pg and 100pg starting amounts of RNA samples, respectively;

[0146] Figure 8 : The RNA samples with different starting amounts were enriched with CZ500nM for library construction, and the results of library detection by bioanalyzer were shown in Figure 1, where G19, G20, and G21 correspond to libraries constructed from RNA samples with starting amounts of 10pg, 50pg, and 100pg, respectively;

[0147] Fig. 9: Schematic diagram of library construction with different starting amounts of RNA samples without CZ200nM enrichment, and the results of library detection by bioanalyzer, where H1, H2 and H3 correspond to libraries constructed with 10pg, 50pg and 100pg starting amounts of RNA samples, respectively;

[0148] Fig.10 : Schematic diagram of the library construction after different starting amounts of RNA samples were enriched with CZ 200nM, and the library was tested by a bioanalyzer, where H4, H5 and H6 correspond to libraries constructed from 10pg, 50pg and 100pg starting amounts of RNA samples, respectively;

[0149] Fig.11 : Schematic diagram of library construction of RNA samples with different starting amounts without NW700nM enrichment, and the results of library detection by bioanalyzer, where H7, H8 and H9 correspond to libraries constructed from RNA samples with starting amounts of 10pg, 50pg and 100pg, respectively;

[0150] Fig.12 : Schematic diagram of the library construction of RNA samples with different starting amounts after enrichment with NW 700nM, and the results of library detection by bioanalyzer, where H10, H11 and H12 correspond to libraries constructed with RNA samples with starting amounts of 10pg, 50pg and 100pg, respectively.

[0151] Table 8

[0152]

[0153] Step 2: Library capture / hybridization

[0154] The quantified qualified libraries were used for sequence capture and sequenced using a single-molecule sequencer.

[0155] The method disclosed in the published patent application CN105112408A can be used to immobilize the probe (such as SEQ ID NO: 5) on the chip, and the prepared library is diluted with 3*SSC hybridization solution, and then hybridized with the probe immobilized on the chip. Then, the number of hybridizations between the linker and the probe is determined based on the Cy3 signal. The technical solution disclosed in CN105112408A is incorporated into this application by reference.

[0156] 5'-TTTTTTTTTTTGGAAGATACCTGCGACCATCCAGTTCCACTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 5).

[0157] The workflow for library hybridization is as follows:

[0158] (1) Chip selection: The substrate glass of the chip used is an epoxy-modified glass chip from SCHOTT. The probe is fixed by the reaction between the amino group on the probe and the epoxy group on the chip surface. For example, the method disclosed in the published patent application CN109610006A can be referred to. The probe density fixed in the 110×110 μM area is about 18,000 Dot / FOV, that is, there are 18,000 bright spots in the 110×110 μM field of view. The technical solution disclosed in CN109610006A is incorporated into this application by reference.

[0159] (2) Hybridization solution preparation: The hybridization solution preparation system is shown in Table 9. The buffer used is 20×SSC buffer (Sigma, #S6639-1L), the final concentration is 3×SSC, the final concentration of the library is 1 nM, and the total volume is 40 μL. The prepared hybridization solution is denatured at 95°C for 2 min and quickly cooled on ice.

[0160] Table 9

[0161] 20×SSC buffer 6μL library Final concentration is 1 nM Nucleic acid-free water Make up to 40 μL

[0162] (3) The denatured hybridization solution is quickly loaded onto the chip, and the chip is placed at 55°C for 30 min to allow the library to hybridize with the probes on the chip surface.

[0163] (4) Rinse the chip with 3×SSC, 1×SSC, and 0.1×SSC in sequence.

[0164] Step 3: Sequencing

[0165] There are two sequencing methods for sequencing. The first sequencing method: using GenoCare TM The third-generation sequencing platform directly sequenced the hybridization captured library, and the sequencing results are shown in Table 10.

[0166] Table 10

[0167]

[0168]

[0169] From the sequencing results, we can see that samples G10 and G11 are samples with a starting amount of 10pg and 50pg, respectively, and have been enriched with Yeasenclean magnetic beads. Samples G7 and G8 are samples with a starting amount of 10pg and 50pg, respectively, and have not been enriched with Yeasen clean magnetic beads. G13-G18 are samples that have not been enriched with CZ1000nm magnetic beads and have been enriched with CZ1000nm magnetic beads. From the sequencing results, we can see that the accuracy of the sequencing results of the library constructed after enrichment / non-enrichment and purification with CZ1000nm magnetic beads is lower than that of the library constructed after enrichment / non-enrichment and purification with Yeasen clean magnetic beads. At the same time, by comparing the sequencing data of samples enriched and non-enriched with Yeasen clean magnetic beads, when the starting amount of the sample is not 10pg to 50pg, the accuracy of the sequencing results of the library constructed by the sample enriched with Yeasen clean magnetic beads is improved.

[0170] The second sequencing method: Two-pass sequencing method sequences the captured library. The specific sequencing process is as follows:

[0171] Step 1: Synthesize the complementary strand of the library / initial template hybridized to the chip surface in step 2 above

[0172] Specifically, the steps of synthesizing the initial template complementary strand include:

[0173] 1) Place the chip that completed library hybridization in step 2 into the GenoCare TM Sequencing instrument;

[0174] 2) Pump 750 μl of extension reagent into the hybridization channel of the chip, wherein the extension reagent components are: 120 U / ml Bst DNA polymerase (NEB, #M0275M), 0.2 mM dNTP (a mixture of 0.2 μM each of dATP, dTTP, dCTP, and dGTP), 1 M betaine, 20 mM tris(hydroxymethylaminomethane), 10 mM sodium chloride, 10 mM potassium chloride, 10 mM ammonium sulfate, 3 mM magnesium chloride, 0.1% Triton X-100, pH value is 8.3;

[0175] 3) Heat the chip to 60±0.5℃ and react for 10 minutes;

[0176] 4) Pump 220 μl of cleaning solution 1 into the chip hybridization channel to remove the extension reagent;

[0177] 5) Pump 440 μl of cleaning solution 2 into the chip hybridization channel, remove the cleaning solution 1 in 4), and complete the synthesis of the initial template complementary chain.

[0178] Step 2 (optional): Block the 3'OH of the nascent chain that was not fully extended in step 1. The specific steps are as follows:

[0179] 1) Cool the chip to 37±0.5℃ and maintain for 90 seconds;

[0180] 2) Pump 750 μl of blocking reagent 1 into the extended channel in step 1 and react for 10 minutes. The components of the blocking reagent 1 are: 100 U / ml Klenow DNA polymerase large fragment (3'→5'exo-, NEB, #M0212M), 12.5 μM ddNTP mix (a mixture of 12.5 μM each of ddATP, ddTTP, ddCTP, and ddGTP), 5 mM manganese chloride, 20 mM tris, 10 mM sodium chloride, 10 mM potassium chloride, 10 mM ammonium sulfate, 3 mM magnesium chloride, 0.1% Triton X-100, pH 8.3;

[0181] 3) 220 μl of cleaning solution 1 was introduced into the blocked channel in step 2) to remove the remaining blocking solution after the blocking reaction and complete the blocking of the 3'OH of the incompletely extended nascent chain.

[0182] Step 3: Denaturation to remove the initial template. The process of removing the initial template is as follows:

[0183] 1) Cool the chip to 55±0.5℃

[0184] 2) Pass 800 μl of formamide into the channel blocked in step 2 for denaturation for 2 minutes;

[0185] 3) Passing 220 μl of cleaning solution 1 into the denatured channel in 2) to remove the denatured initial template;

[0186] 4) Repeat 2) and 3) once to complete the removal of the initial template.

[0187] Step 4: Block the 3'OH of the residual joint on the chip surface. The process of blocking the residual joint 3'OH on the chip surface is as follows:

[0188] 1) Cool the chip to 37±0.5℃;

[0189] 2) Pass 440 μl of cleaning solution 2 into the blocked channel in step 3 to replace the remaining cleaning solution 1 in the channel;

[0190] 3) Pass 750 μl of blocking reagent 2 into the channel treated in 2) and react for 15 minutes. The components of blocking reagent 2 are: 100 U / ml Terminal Transferase (NEB, M0315L), 1× Terminal Transferase Buffer, 0.25 mM cobalt chloride, 100 μM ddNTP mix (a mixture of 100 μM each of ddATP, ddTTP, ddCTP, and ddGTP);

[0191] 4) 220 μl of cleaning solution 1 was introduced into the blocked channel in 3) to complete the blocking of the residual connector 3'OH on the chip surface.

[0192] Step 5: Hybridization of sequencing primers. The process of hybridization of sequencing primers is as follows:

[0193] 1) Raise the temperature of the chip to 55±0.5℃ and keep it for 1 minute;

[0194] 2) Pass 800 μl of diluted sequencing primer hybridization solution into the closed channel in step 4, and perform hybridization reaction for 30 minutes. The diluted sequencing primer hybridization solution is cleaning solution 3 containing 0.1 μM primer D7S1T-R2P, and the components of cleaning solution 3 include: 450 mM sodium chloride, 45 mM sodium citrate;

[0195] 3) Cool the chip to 37±0.5℃ and keep it for 90 seconds;

[0196] 4) Passing 220 μl of cleaning solution 1 into the hybridization channel in 2) to remove the unhybridized sequencing primers in the channel;

[0197] 5) Pass 440 μl of cleaning solution 2 into the channel after the treatment in 4) to replace the remaining cleaning solution 1 in the channel and complete the hybridization of the sequencing primer.

[0198] Step 6: Perform Read1 sequencing. The process of Read1 sequencing is as follows:

[0199] Take advantage of Genocare TM The sequencing platform performs 80 cycles of sequencing. Four nucleotides (nucleotide analogs) with two different fluorescent groups are used in the sequencing process. Two nucleotides labeled with different fluorescent molecules are added in each round of reaction for signal detection.

[0200] Step 7: Remove the nascent sequencing strand.

[0201] The process of removing the nascent sequencing chain is carried out according to the steps in step 3.

[0202] Step 8: Block the 3'OH of the remaining nascent chain.

[0203] The process of blocking the 3'OH of the remaining nascent chain is carried out according to the procedure in step 2.

[0204] Step 9: Hybridization with sequencing primers

[0205] CTACAACGACGCTCTACCGATGAAGATGTGTATAAGAGACAGT (SEQ ID NO: 6).

[0206] The process of hybridizing the sequencing primer is carried out according to the steps in step 5.

[0207] Step 10: Perform Read2 Sequencing

[0208] The process of Read2 sequencing is carried out according to the steps in step 6.

[0209] Step 11: Split the sequencing data to obtain two sequences, Reads1 and Reads2, with corresponding coordinates.

[0210] Specifically include:

[0211] Use Python language to split each read in the ".fa_" file output by 160-cycle sequencing base calling (BaseCalling) into two parts: the first 80 cycles and the last 80 cycles, and remove the character "_" in all Reads. Output them as two ".fa" files "Reads1.fa" and "Reads2.fa" with consistent sequence coordinates, completing the splitting of the sequencing data to obtain the two sequences of Reads1 and Reads2 with corresponding coordinates.

[0212] Furthermore, a set of analysis methods provided in this embodiment for analyzing Reads1 and Reads2 obtained by the above-mentioned Two-pass sequencing method to obtain Consensus Reads (consensus sequence or common sequence or consistent read segment) includes:

[0213] Step 12: Construct a calibration model, including:

[0214] 1) Using Python, extract the reads with the same coordinates in the Reads1 and Reads2 sequences obtained in step 11, where the length of the two sequencing reads is ≥ 25 bp, and output them as two files, T1 (Read1) and T2 (Read2), respectively. The corresponding method for the same coordinate is to set the Reads ID of the same coordinate Reads in different files to be consistent when generating Reads files;

[0215] 2) Align the corresponding reads in T1 and T2, mark the consistent and inconsistent bases of the two reads in the alignment results, and obtain the common reads. The position correspondence is achieved by comparing whether the reads IDs of the two reads are consistent;

[0216] 3) Map files T1 and T2 to Reference respectively to get Sam1 and Sam2 files. Find the longest common substring RefReads in Reference for the Reads that have corresponding positions in Sam1 and Sam2 and are mapped to the same position. The common substring refers to the area covered by both corresponding Reads after mapping;

[0217] 4) Compare the Common Reads in 2) and the RefReads in 3). For inconsistent Bases in Common Reads, mark whether they actually exist in Reference. If they do, Deletion is performed for Reads that were not detected. If they do not exist, Insertion is performed for Reads that were detected;

[0218] 5) Count the Deletion and Insertion in 4), and also count the types of the Base before and after the inconsistent position. Thus, the probability of Insertion or Deletion being caused before or after different Base types is obtained.

[0219] Specifically, the naive Bayes model used in this example is as follows:

[0220]

[0221] Where: P(D|XY) represents the probability of Deletion when a base is preceded and followed by bases X and Y respectively, X, Y∈[A,C,G,T]. P(D) represents the probability of Deletion when a base is preceded and followed by bases X and Y respectively, X,Y∈[A,C,G,T]. P(D) represents the probability of Deletion when a base is preceded and followed by bases Y; P(I) represents the probability of Insertion when a base is preceded and followed by bases I and I.

[0222] By counting the frequencies of the preceding and following bases when Deletion or Insertion occurs at different bases, we can get P(XY|D) and P(XY|I), and thus we can calculate P(D|XY) and P(I|XY).

[0223] Step 13: Filter the read length to obtain Fa1, which includes:

[0224] Use Python language to read all reads in the Reads1 file line by line. If the length of the Reads is greater than or equal to 25bp, the output text file Fa1 is generated.

[0225] Step 14: Classify the reads in Fa1 according to the read length of Reads2

[0226] Specifically, the process of classifying Reads in Fa1 according to the read length of Reads2 described in this example includes:

[0227] All Reads in Fa1 corresponding to Reads2 are read out. According to the length of Reads in Reads2, if Read2≥25bp, the corresponding Reads in Fa1 are saved in Fa2 file; if 10bp≤Read2<25bp, the corresponding Reads in Fa1 are saved in Fa3 file.

[0228] Step 15: Output confident reads based on Q value

[0229] Specifically, the process of re-outputting the confident Reads according to the Q value in this example includes:

[0230] 1) Take out all the Reads in Fa2 obtained in step 14, and simultaneously take out the corresponding Reads in Reads2. Segment the Reads ID to obtain the Quality Score value (Q value for short) of the Reads.

[0231] 2) Compare the Q values ​​of the two corresponding Reads, output the Read with the larger Q value to file Fa4, and output the Read with the smaller Q value to file Fa5. If the Q values ​​of the two are equal, the Reads in Reads1 are output to Fa4 by default, and the Reads in Reads2 are output to Fa5.

[0232] Step 16: Filter the reads in Fa4 and Fa5 based on the Q value

[0233] Specifically, the process of filtering the reads in Fa4 and Fa5 according to the Q value in this example includes:

[0234] Take the Reads in Fa4, and according to its Q value, if it is greater than or equal to 60, it will be output to file Fa6, and the Reads in Fa5 corresponding to the Reads will be output to file Fa7.

[0235] Step 17: Use the Reads in Fa7 to correct the Reads in Fa6 to obtain Consensus Reads Parts 1 (CRP1 for short).

[0236] Specifically, the process of using the Reads in Fa7 to correct the Reads in Fa6 in this example includes:

[0237] 1) Take the reads in Fa6 and the corresponding reads in Fa7. Align the two corresponding reads to each other to obtain the common consensus sequence. The Smith-Waterman algorithm is used to align the two sequences. The consensus sequence refers to the local best matching sequence obtained by adding, deleting or modifying some bases in the sequence after alignment.

[0238] 2) After obtaining the consensus sequence, the inconsistent base positions in the consensus sequence are determined one by one according to the correction model constructed in step 12. The probability of Deletion or Insertion at the position is calculated according to the base types before and after the base position. If the probability of Deletion is greater than 50%, it is considered that the base measured at the position should not appear, and the base at the position is deleted. Otherwise, the base at the position is retained.

[0239] 3) After correcting all inconsistent bases, the corrected reads are output, which is CRP1. The inconsistent base here refers to the base that is not detected in the two corresponding reads at the same time. If the base is detected twice, but the base type is inconsistent, it is not within the candidate range for correction in this example. In this case, the final base type is based on the base type of the reads in Fa6.

[0240] Step 18: Filter Reads in Fa3 Based on Q Value

[0241] Specifically, the process of filtering Reads in Fa3 according to the Q value in this example includes:

[0242] Take all the reads in Fa3, split the reads IDs of the reads in Fa3, and get the Q value of each read. Output the reads with Q value ≥ 60 to file Fa8.

[0243] Step 19: Output the corresponding Reads in Reads2 in the Fa8 file.

[0244] Specifically, the process of outputting Reads in Reads2 according to Reads in Fa8 in this example includes:

[0245] Take all the Reads in the Fa8 file, take out the corresponding Reads in Reads2, and output them to the file Fa9.

[0246] Step 20: Use the Reads in Fa9 to correct the Reads in Fa8 to obtain Consensus Reads Parts 2 (CRP2 for short).

[0247] Specifically, the process of using the Reads in Fa9 to correct the Reads in Fa8 described in this example is performed with reference to step 17.

[0248] Step 21: According to the requirements of sequencing data accuracy for different applications, the reads in CRP1 and CRP2 that meet the similarity threshold are merged and output to obtain Consensus Reads.

[0249] Specifically, the process of filtering and outputting the Reads in the ConsensusReads Part according to the accuracy requirements of the sequencing data for different applications described in this example includes:

[0250] 1) According to the requirements of sequencing data accuracy for different applications, set the corresponding similarity threshold. The similarity thresholds for Part 1 and Part 2 can be different;

[0251] 2) Calculate the similarity of the reads in CRP1 and CRP2 respectively. The similarity refers to the similarity of the corresponding reads in Reads1 and Reads2. The similarity calculation step is to first align the two corresponding reads with each other. Then calculate the ratio of the number of consistent bases in the aligned consensus sequence to the total number of bases. The alignment method, consensus sequence and inconsistent base definitions refer to step 19.

[0252] 3) According to the requirements of sequencing data accuracy for different applications, the reads that meet the similarity threshold requirements in CRP1 and CRP2 are output to the final file to obtain Consensus Reads, see Table 11.

[0253] Table 11 Comparison of mapping analysis between output sequences filtered at different similarity thresholds and reference genomes

[0254]

[0255] Note: Data loss mainly occurs in the read length filtering step. Since Read1 and Read2 sequencing are independent events, there will inevitably be some sequences with inconsistent read lengths.

[0256] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0257] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A sequencing method, characterized in that: include: Obtaining target nucleic acid molecules, including: Reverse transcription is performed on RNA derived from the nucleic acid sample to be tested to obtain a reverse transcription product, wherein the reverse transcription product includes RNA:DNA hybrid double strands, and Enriching the RNA:DNA hybrid double strands in the reverse transcription product to obtain the target nucleic acid molecule; Providing a transposition complex, the transposition complex comprising an adapter and a transposase, wherein the adapter is a double-stranded nucleic acid molecule with a known sequence; The target nucleic acid molecule and the transposition complex are placed in contact under conditions suitable for a transposition reaction to obtain a transposition product, wherein the transposition product comprises a double-stranded nucleic acid molecule having a linker at the end and a gap; providing a first primer configured to hybridize to at least a portion of the adapter; and allowing the transposition product to hybridize with the first primer and place under conditions suitable for a strand displacement reaction to obtain the library; Sequencing the library to obtain sequencing results, The sequencing result includes first sequencing data and second sequencing data, and sequencing the library to obtain the sequencing result includes: (1) adding a sequencing primer to perform a first sequencing on the sequencing template so as to obtain the first sequencing data by forming a first nascent chain, wherein the sequencing primer is configured to hybridize with the 3' end of the sequencing template; (2) removing the first nascent chain; (3) adding the sequencing primer and performing a second sequencing on the sequencing template to obtain the second sequencing data by forming a second nascent chain; Analyzing the sequencing results includes: (a) performing mutual calibration based on at least a portion of the first sequencing data and the second sequencing data, so as to determine at least a portion of the sequence information of the target nucleic acid molecule.

2. The method according to claim 1, characterized in that Prior to performing the sequencing, the method comprises: attaching the library to a solid substrate surface, the solid substrate surface carrying probes configured to hybridize to at least a portion of the linker; Optionally, the adapter comprises a first adapter and a second adapter, the probe comprises a first probe and a second probe, the first probe is configured to hybridize with at least a portion of the first adapter, and the second probe is configured to hybridize with at least a portion of the second adapter, and the method comprises: denaturing the library to obtain a single-stranded library; allowing the single-stranded library to attach to the solid substrate surface; amplifying the single-stranded library on the surface of the solid substrate to obtain a sequencing template; Optionally, the amplification is bridge amplification or template walking amplification.

3. The method according to claim 1, characterized in that Prior to performing the sequencing, the method comprises: denaturing the library to obtain a single-stranded library; attaching the single-stranded library to a solid substrate surface, the solid substrate surface carrying a probe, the probe being covalently attached to the solid substrate surface, the probe being configured to hybridize to at least a portion of the linker; Using the single-stranded library as a template, extending the probe to synthesize a complementary strand of the single-stranded library to form a sequencing template; Optionally, the method further comprises: removing the single-stranded template and performing a first blocking treatment on the nucleic acid molecules on the surface of the solid phase substrate to obtain the sequencing template, wherein the first blocking treatment comprises binding an extension blocker to the 3' end of the nucleic acid molecules on the surface of the solid phase substrate; Optionally, the first blocking treatment includes binding the extension blocker to the 3' end of the nucleic acid molecule attached to the surface of the solid phase substrate under the action of terminal transferase, and the extension reaction blocker is selected from at least one of ddNTP and its derivatives; Optionally, the method further comprises: performing a second blocking treatment on the incompletely extended complementary chain, wherein the second blocking treatment comprises binding an extension blocker to the 3' end of the incompletely extended complementary chain; Optionally, the second blocking treatment includes allowing the extension reaction blocker to bind to the 3' end of the incompletely extended complementary chain under the action of DNA polymerase, and the extension reaction blocker is selected from at least one of ddNTP and its derivatives.

4. The method according to claim 2 or 3, characterized in that (2) Also includes: Performing a third blocking treatment on the 3' end of the first nascent chain remaining on the surface of the solid substrate, wherein the third blocking treatment comprises binding an extension blocker to the 3' end of the first nascent chain; Optionally, the third blocking treatment includes allowing the extension reaction blocker to bind to the 3' end of the first nascent chain under the action of DNA polymerase, and the extension reaction blocker is selected from at least one of ddNTP and its derivatives.

5. The method according to any one of claims 1 to 4, characterized in that: The first sequencing data and the second sequencing data both include a plurality of read segments, and the mutual correction includes: Selecting high-quality reads and corresponding reads of the high-quality reads from the first sequencing data and the second sequencing data, wherein the length of the high-quality reads is not less than a predetermined length, and the high-quality reads have a sequencing quality not less than a predetermined quality threshold; and The high-quality reads are aligned with corresponding reads of the high-quality reads, and sequence information correction is performed based on the alignment results. Optionally, (a) comprises: (a-1) constructing a first read set based on the first sequencing data according to the length of the read, wherein the length of each read in the first read set is not less than a first predetermined length; (a-2) constructing a second read set and a third read set based on the first read set according to the length of the corresponding read segment, wherein the length of the corresponding read segment of each read segment in the second read set is not less than a second predetermined length, and the length of the corresponding read segment of each read segment in the third read set is within a predetermined length range; (a-3) constructing a fourth read set and a fifth read set based on the second read set and the corresponding reads according to the sequencing qualities of the reads in the second read set and the corresponding reads, wherein the fourth read set and the fifth read set are respectively determined according to the following principles: Comparing the sequencing quality of the reads in the second read set with the corresponding reads, The party with high sequencing quality is selected as an element of the fourth read segment set, and the party with low sequencing quality is selected as an element of the fifth read segment set, For the case where the sequencing quality is the same, the reads from the second read set are selected as elements of the fourth read set, and the corresponding reads are selected as elements of the fifth read set; (a-4) filtering the fourth read set by using sequencing quality to construct a sixth read set, wherein the sequencing quality of the reads in the sixth read set is not less than a first predetermined quality threshold; (a-5) using the sixth read set, selecting reads corresponding to the reads in the sixth read set from the fifth read set, so as to construct a seventh read set; (a-6) performing read alignment on the sixth read set and the seventh read set, and determining a first differential site on the reads of the sixth read set; and (a-7) using a predetermined sequencing error prediction model to correct the first differential site to determine the first sequence information, wherein the sequencing error prediction model is used to determine the probability of insertion or deletion of the differential site during the sequencing process; Optionally, further comprising: (a-4a) filtering the third read set by using sequencing quality to construct an eighth read set, wherein the sequencing quality of the reads in the eighth read set is not less than a second predetermined quality threshold; (a-5a) using the eighth read set, selecting reads corresponding to the reads in the seventh read set from the second sequencing data, so as to construct a ninth read set; (a-6a) performing read alignment on the eighth read set and the ninth read set, and determining a second differential site on the reads of the eighth read set; and (a-7a) Using the sequencing error prediction model, the second difference site is corrected to determine the second sequence information.

6. The method according to claim 5, characterized in that The sequencing error prediction model is obtained by training a naive Bayes model based on the comparison results of the first sequencing data and the second sequencing data with a reference genome; Optionally, for the first differential site and the second differential site: If the reads from the sixth read set have bases at the differential site, the corresponding reads from the seventh read set do not have bases at the differential site, and the probability of a deletion at the differential site is greater than 50%, retaining the bases of the reads from the sixth read set at the differential site as the final sequencing result; If the reads from the sixth read set do not have a base at the differential site, the corresponding reads from the seventh read set have a base at the differential site, and the probability of insertion at the differential site is greater than 50%, retaining the base of the reads from the sixth read set at the differential site as the final sequencing result; and If the reads from the sixth read set have bases at the differential site, and the corresponding reads from the seventh read set also have bases at the differential site, the bases of the reads from the sixth read set at the differential site are selected as the final sequencing results.

7. The method according to any one of claims 1 to 6, characterized in that: The first predetermined length and the second predetermined length are each independently not less than 20 bp, preferably not less than 25 bp; Optionally, the predetermined length ranges from 10 to 25 bp; Optionally, the first predetermined quality threshold and the second predetermined quality threshold are each independently not less than 50, preferably not less than 60.

8. The method according to any one of claims 1 to 6, characterized in that: The starting amount of the RNA is 5 to 50 pg; Optionally, the starting amount of the RNA is not less than 10 pg; Optionally, the obtaining of the target nucleic acid molecule further comprises: denaturing the RNA before performing the reverse transcription; Optionally, the RNA is placed at 65° C. for 3 to 10 minutes to perform the denaturation.

9. The method according to any one of claims 1 to 6, characterized in that: The reverse transcription is performed using a mixed primer, wherein the mixed primer comprises Oligo dT and a random primer; Optionally, the ratio of the Oligo dT and the random primer in the reverse transcription reaction system is 1:2 to 1:6; Optionally, the length of the Oligo dT is 12-20 nt, and / or the length of the random primer is 4-8 nt; Optionally, the enrichment is performed using magnetic beads; Optionally, the enrichment is performed using magnetic beads having carboxyl modification groups on the surface; Optionally, the transposase is Tn5 transposase or an engineered enzyme thereof, and / or the linker has the sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2; Optionally, the method further comprises adding a stop solution to terminate the transposition reaction, wherein the stop solution comprises SDS; Optionally, the first primer has the sequence shown in SEQ ID NO: 3 and SEQ ID NO: 4; Optionally, after the strand displacement reaction, PCR is performed on the strand displacement reaction product, and the reaction system used for the PCR is the same as that for the strand displacement.

10. A kit for implementing the sequencing method according to any one of claims 1 to 9 to obtain the sequencing result, the kit comprising: A first reagent for achieving the reverse transcription, a second reagent for achieving the enrichment, the transposition complex and the first primer.

Images