Nucleic acid detection method for double-stranded DNA

Abstract

The invention relates to the technical field of nucleic acid detection, and discloses a nucleic acid detection method for double-stranded DNA. According to the invention, through application of a pre-primer probe and a Cas12a / crRNA system, amplification and detection of double-stranded DNA are converted into exponential amplification and detection of the primer probe, in the exponential amplification of the primer probe, a large amount of single-stranded DNA products are generated through a continuous cyclic process of enzyme digestion, strand extension and strand displacement, then the single-stranded DNA products continue to be subjected to cyclic amplification, and the single-stranded DNA products are subjected to quantitative detection. The exponential amplification of the signal of the target detection double-stranded DNA can be more stably and quickly realized through the exponential amplification of the primer probe.

Description

Technical Field

[0001] The present invention relates to the technical field of nucleic acid detection, and in particular to a nucleic acid detection method for double-stranded DNA. Background Art

[0002] Rapid and accurate detection of nucleic acids plays a vital role in the clinical diagnosis of pathogen infections.

[0003] Existing nucleic acid detection technologies, such as polymerase chain reaction (PCR), DNA microarray and gene sequencing, can accurately detect pathogen DNA, but they have some problems, such as long detection time, high detection costs, and the need for complex instruments and professional technical operators. These problems make the above technologies difficult to apply in situations where resources are limited or where on-site diagnosis is required.

[0004] At present, some nucleic acid isothermal amplification technologies suitable for on-site detection have been established, including loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), exponential amplification (EXPAR) and rolling circle amplification (RCA). These amplifications have some disadvantages, such as primer dimers and aerosol contamination in LAMP and RPA amplification, and low amplification efficiency in RCA. Among them, EXPAR has higher amplification efficiency and faster amplification speed, making it one of the ideal nucleic acid amplification technologies that can be applied to on-site detection. Studies have shown that at a single temperature, EXPAR can generate up to 10 8 However, conventional EXPAR amplification requires single-stranded nucleic acid fragments to initiate the reaction and cannot directly detect double-stranded DNA (such as genomic DNA).

[0005] The CRISPR / Cas system is an immune system found in most bacteria and all archaea to resist the invasion of foreign substances. The CRISPR / Cas system (such as Cas9, Cas12) can recognize and cut double-stranded DNA. Summary of the invention

[0006] In order to solve the problem of nucleic acid detection of double-stranded DNA, especially for the on-site detection problem of double-stranded DNA, the present invention provides a kind of nucleic acid detection method for double-stranded DNA, wherein, on-site detection has higher requirements for efficient and fast. The present invention, through the application of pre-primer probe and Cas12a / crRNA system, converts the amplification and detection of double-stranded DNA into the exponential amplification and detection of primer probe, in the exponential amplification of primer probe, by enzyme cutting, chain extension, the continuous cycle process of chain displacement, a large amount of single-stranded DNA products are produced, and then the single-stranded DNA product continues cyclic amplification, and the exponential amplification of the signal of target detection double-stranded DNA can be more stably realized by the exponential amplification of primer probe.

[0007] The specific technical scheme of the present invention is: In one aspect, the present invention provides a method for detecting double-stranded DNA nucleic acid, comprising the following steps: Step S1: Evenly mix the object to be detected with the pre-primer probe and the Cas12a / crRNA complex and incubate; Step S2: adding the mixture obtained after incubation to the EXPAR amplification reaction system to perform an amplification reaction; Step S3: mixing the mixture after the amplification reaction with the detection probe to perform a detection color reaction; in: The sequence of the pre-primer probe is: 5'-first sequence-second sequence-3'; the first sequence is a short-chain RNA base that can resist Cas12 / crRNA shearing, and the RNA base can serve as a primer for DNA polymerase polymerization extension; the second sequence is a DNA base that can be sheared by activated Cas12 / crRNA; the 3' end of the pre-primer probe is phosphorylated; The sequence of the crRNA is: UAAUUUCUACUAAGUGUAGAU NNNNNNNNNNNNNNNNNNNNN , wherein the underlined portion is the recognition region of the target detection double-stranded DNA, which is designed according to the target detection double-stranded DNA, and its length is determined according to the target detection double-stranded DNA; The EXPAR amplification reaction system includes an amplification template chain, Nt.BstNBI nicking endonuclease, and Bst 2.0 DNA polymerase. The sequence of the amplification template chain is: 5'-third sequence-GTGAGACTC-third sequence-3', and the third sequence can complement the first sequence; The sequence of the detection probe includes a sequence segment that can complementarily pair with the EXPAR amplification reaction product of the first sequence.

[0008] The present invention converts the amplification and detection of double-stranded DNA into the exponential amplification and detection of primer probes through the application of pre-primer probes and Cas12a / crRNA systems. In the exponential amplification of primer probes, a large amount of single-stranded DNA products are generated through the continuous cycle of enzyme cutting, chain extension and chain displacement, and then the single-stranded DNA products continue to be cyclically amplified. The exponential amplification of the target detection double-stranded DNA signal can be more stably achieved through the exponential amplification of the primer probe.

[0009] Specifically, the present invention realizes rapid and sensitive determination of whether there is target detection double-stranded DNA from the object to be detected through the above steps S1~S2. In the presence of target DNA, in step S1, Cas12 / crRNA recognizes target DNA, and activates its trans cutting ability, shears the phosphodiester bond of deoxyribonucleic acid in pre-primer probe, and produces mature primer probe. In step S2, these mature primer probes can be hybridized with amplification template chains, and chain extension is performed under the action of Bst DNA polymerase to form new double-stranded DNA, and Nt.BstNBI nicking endonuclease can recognize the restriction site on the double-stranded DNA, produce a nick, and DNA polymerase can perform chain extension and chain displacement from the nick to produce single-stranded DNA products, which can be hybridized with another amplification template chain, start new amplification, and realize the exponential amplification of primer probes, which is a step for rapid method target detection double-stranded DNA presence signal. The exponential amplification of short primer probes is used to amplify the target detection double-stranded DNA presence signal, which is more stable and fast than direct amplification of target detection double-stranded DNA.

[0010] The classic RPA+Cas12 detection technology, when designing the EXPAR amplification template sequence, must consider three problems at the same time: the problem of efficient amplification of RPA primers, the problem of whether the product amplified by the RPA primer contains the PAM recognition site of CRISPR / Cas12, and the problem of shearing efficiency of the recognition site. Therefore, the RPA+Cas12 detection technology often has the problem that efficient RPA primers are designed, but the product amplified by the efficient RPA primers does not contain the PAM recognition site of CRISPR / Cas12 or contains the PAM recognition site of CRISPR / Cas12 but has low shearing activity. The sequence of the above crRNA includes a recognition region for target detection double-stranded DNA, which is designed according to the target detection double-stranded DNA. The design does not need to consider the problem of primer dimers, and only needs to find an efficient PAM recognition site of CRISPR / Cas12. Therefore, compared with the classic RPA+Cas12 detection technology, the present invention is simpler and more efficient when replacing different target detection double-stranded DNAs, and has high feasibility.

[0011] Preferably, in step S1, the RNA base is 10-25 bp.

[0012] More preferably, the RNA base is: AGGGUAAACCAAAUA.

[0013] Preferably, in step S1, the DNA base is 5 to 10 bp.

[0014] More preferably, the DNA base is: CCCCCT.

[0015] Preferably, in step S1, the Cas12a / crRNA complex is a complex obtained by combining Cas12a protein and crRNA in a 1:1 molar ratio.

[0016] Preferably, in step S1, the incubation conditions are: 30-40° C., and incubation for 10-120 min.

[0017] Preferably, in step S2, the EXPAR amplification reaction system includes 45~60nM amplification template chain, 200~300 μM dNTP mix, 0.5~1.0 U / μL Nt.BstNBI nicking endonuclease, 0.2~1.0 U / μL Bst 2.0DNA polymerase, 1~2µM single-stranded binding protein, 1×Isothermal amplification buffer, and 0.25×NEBuffer3.1 buffer.

[0018] Preferably, in step S2, the mixture obtained after incubation is added to the EXPAR amplification reaction system at 18% to 24% (v / v).

[0019] Preferably, in step S2, the amplification reaction is carried out at 50-60° C. for 5-40 min.

[0020] Preferably, in step S3, the sequence of the detection probe is: 5'-GTTTACCCTTTTTT-3'.

[0021] Preferably, the detection color development reaction is: If the target detection double-stranded DNA is present in the object to be detected, then after mixing, the EXPAR amplification reaction product of the first sequence is complementary paired with the detection probe, causing color development; If the target double-stranded DNA does not exist in the object to be detected, no color development will occur after mixing.

[0022] Color rendering can be achieved through general existing technologies.

[0023] Step S3 is: dripping the mixture after the amplification reaction onto the test strip, and performing a color development reaction on the test strip; The gold pad of the test strip is embedded with a nanogold probe, and the probe sequence of the nanogold probe is: 5'-AAAAATGGTATTTGTTTTT-3'; the gold pad of the test strip is provided with a detection line, and a detection line probe is fixed on the detection line, and the detection line probe sequence is: 5'-GTTTACCCTTTTTT-3'; If the target detection double-stranded DNA exists in the object to be detected, the detection line will show color after mixing; if the target detection double-stranded DNA does not exist in the object to be detected, the detection line will not show color after mixing.

[0024] Specifically, the present invention provides a more accurate color development method, specifically: the mixture after the amplification reaction is added dropwise to the lateral flow chromatography test paper, and the color development reaction is used to determine whether the object to be detected contains the target detection double-stranded DNA. In the lateral flow chromatography test paper, a sample pad, a gold-labeled pad, a nitrocellulose membrane and a water-absorbing pad are included. The gold-labeled pad is embedded with a nanogold-labeled probe, and the probe sequence of the nanogold probe is: 5'-AAAAATGGTATTTGTTTTT-3', and the nitrocellulose membrane is respectively marked with a detection line and a control line, and the detection line contains a biotinylated detection line capture probe, and the detection line capture probe sequence is 5'-GTTTACCCTTTTTT-3', and the control line contains a biotinylated control line capture probe, and the sequence of the control line capture probe is 5'-TTTTTCAAATACCA-3'. If the object to be detected contains double-stranded DNA of target detection, through step S2, a large amount of single-stranded DNA products (primer probe amplification) will be produced. When the single-stranded DNA product flows through the gold pad and the nitrocellulose membrane, it will be hybridized with the nanogold-labeled probe and the detection line capture probe at the same time by base complementary pairing, so as to produce a red band on the detection line, and the free nanogold-labeled probe can be hybridized with the control line capture probe, and it is red on the control line, so that 2 red bands appear. If the object to be detected does not contain double-stranded DNA of target detection, the trans-cleavage activity of Cas12a / crRNA will be silenced, and the pre-primer probe cannot be cut, and a mature primer probe cannot be produced, so step S2 cannot start exponential signal amplification, and the above-mentioned single-stranded DNA product is not produced, so that only the red band produced by the hybridization of the free nanogold-labeled probe and the control line capture probe appears. The color development method provided by the present invention utilizes the principle of base complementary pairing, has high specificity, and due to the presence of the control line, has high accuracy, and has the advantages of being cheap and easier to preserve.

[0025] On the other hand, the present invention provides application of the above nucleic acid detection method in the detection of double-stranded DNA.

[0026] Compared with the prior art, the present invention has the following technical effects: (1) The present invention converts the amplification and detection of double-stranded DNA into the exponential amplification and detection of primer probes through the application of pre-primer probes and Cas12a / crRNA systems. The exponential amplification of the target detection double-stranded DNA signal can be more stably and quickly achieved through the exponential amplification of the short sequence primer probe, thereby achieving rapid, sensitive and accurate detection of the target detection double-stranded DNA. The prior art mostly uses CRISPR / Cas9 to cleave double-stranded DNA to generate DNA fragments to activate EXPAR amplification and amplification detection signals, thereby achieving the purpose of detecting double-stranded DNA at the detection site. However, the EXPAR amplification of the double-stranded DNA requires the redesign of the EXPAR amplification template sequence when detecting different targets, which greatly increases the complexity of the design. When the present invention detects double-stranded DNA of different targets, the presence signals of different target detection double-stranded DNA can all be converted into the presence signals of the primer probe, the cleavage product of the above-mentioned pre-primer probe, thereby avoiding the redesign of the EXPAR amplification template sequence.

[0027] (2) The operation of designing sequences involved in the present invention is only the design of the recognition region of the target detection double-stranded DNA in the crRNA sequence, and the design does not need to consider the problem of primer dimers. When replacing different target detection double-stranded DNAs, it is only necessary to find the corresponding efficient CRISPR / Cas12 PAM recognition site to achieve exponential amplification of the target detection double-stranded DNA signal and achieve accurate and efficient signal amplification. However, in the classic RPA+Cas12 detection technology, when designing the EXPAR amplification template sequence, three issues must be considered at the same time: the efficient amplification of RPA primers, whether the product amplified by the RPA primers contains the PAM recognition site of CRISPR / Cas12, and the shearing efficiency of the recognition site. Therefore, compared with the classic RPA+Cas12 detection technology, the present invention is simpler, more efficient, and more feasible when replacing different target detection double-stranded DNAs. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 A schematic diagram of a process for detecting double-stranded DNA nucleic acid according to the present invention; Figure 2 This is a schematic diagram of the structure of the lateral flow chromatography test strip assembled in Application Example 1 of the present invention; Figure 3 This is a diagram showing the feasibility analysis results of a nucleic acid detection method for double-stranded DNA of the present invention; Figure 4 This is a sensitivity analysis result diagram of a nucleic acid detection method for double-stranded DNA of the present invention; Figure 5This is a diagram showing the specific analysis results of a nucleic acid detection method for double-stranded DNA according to the present invention. DETAILED DESCRIPTION

[0029] The present invention will be further described below in conjunction with embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work should belong to the scope of protection of the present invention.

[0030] Example 1 This embodiment provides a method for detecting double-stranded DNA nucleic acid, comprising the following steps: Step S1: Evenly mix the object to be detected with the pre-primer probe and the Cas12a / crRNA complex and incubate; Step S2: adding the mixture obtained after incubation to the EXPAR amplification reaction system to perform an amplification reaction; Step S3: mixing the mixture after the amplification reaction with the detection probe to perform a detection color reaction; in: The sequence of the pre-primer probe is: 5'-first sequence-second sequence-3'; the first sequence is a short-chain RNA base that can resist Cas12 / crRNA shearing, and the RNA base can serve as a primer for DNA polymerase polymerization extension; the second sequence is a DNA base that can be sheared by activated Cas12 / crRNA; the 3' end of the pre-primer probe is phosphorylated; The sequence of the crRNA is: UAAUUUCUACUAAGUGUAGAU NNNNNNNNNNNNNNNNNNNNN , wherein the underlined portion is the recognition region of the target detection double-stranded DNA, which is designed according to the target detection double-stranded DNA, and its length is determined according to the target detection double-stranded DNA; The EXPAR amplification reaction system includes an amplification template chain, Nt.BstNBI nicking endonuclease, and Bst 2.0 DNA polymerase. The sequence of the amplification template chain is: 5'-third sequence-GTGAGACTC-third sequence-3', and the third sequence can complement the first sequence; The sequence of the detection probe includes a sequence segment that can complementarily pair with the EXPAR amplification reaction product of the first sequence.

[0031] In this embodiment, the amplification and detection of double-stranded DNA are converted into exponential amplification and detection of primer probes through the application of pre-primer probes and Cas12a / crRNA systems. In the exponential amplification of the primer probe, a large amount of single-stranded DNA products are generated through the continuous cycle of enzyme nicking, chain extension, and chain displacement. Then, the single-stranded DNA products continue to be cyclically amplified. The exponential amplification of the target detection double-stranded DNA signal can be more stably achieved through the exponential amplification of the primer probe.

[0032] Specifically, the present embodiment is realized by the above steps S1~S2, and it is realized to quickly and sensitively determine whether there is a target detection double-stranded DNA from the object to be detected. In the case of the presence of the target detection double-stranded DNA, in step S1, Cas12 / crRNA recognizes the target DNA, and activates its trans cutting ability, shears the phosphodiester bond of the deoxyribonucleic acid in the pre-primer probe, and produces a mature primer probe. In step S2, these mature primer probes can be hybridized with the amplification template chain, and the chain is extended to form a new double-stranded DNA under the action of BstDNA polymerase, and Nt.BstNBI nicking endonuclease can recognize the restriction site on the double-stranded DNA, produce a nick, and the DNA polymerase can extend the chain and replace the chain from the nick to produce a single-stranded DNA product, and the single-stranded DNA product can be hybridized with another amplification template chain, and a new amplification is started to realize the exponential amplification of the primer probe, which is a step for the existence of a signal of the target detection double-stranded DNA in a rapid method. The exponential amplification of a short primer probe is used to amplify the target detection double-stranded DNA existence signal, which is more stable than directly amplifying the target detection double-stranded DNA.

[0033] The classic RPA+Cas12 detection technology, when designing the EXPAR amplification template sequence, must consider three issues at the same time: the problem of efficient amplification of RPA primers, the problem of whether the product amplified by the RPA primer contains the PAM recognition site of CRISPR / Cas12, and the problem of shearing efficiency of the recognition site. Therefore, the RPA+Cas12 detection technology often has the problem that efficient RPA primers are designed, but the product amplified by the efficient RPA primers does not contain the PAM recognition site of CRISPR / Cas12 or contains the PAM recognition site of CRISPR / Cas12 but has low shearing activity. The sequence of the above crRNA contains the recognition region of the target detection double-stranded DNA, which is designed according to the target detection double-stranded DNA. The design does not need to consider the problem of primer dimers, and only needs to find the efficient PAM recognition site of CRISPR / Cas12. Therefore, compared with the classic RPA+Cas12 detection technology, this embodiment is simpler, more efficient, and more feasible when replacing different target detection double-stranded DNAs.

[0034] In the absence of the target detection double-stranded DNA, in step S1, the trans-cleavage activity of Cas12a / crRNA will be silenced, and the pre-primer probe cannot be cut. Then in step S2, the uncut pre-primer binds to the amplification template chain, but because the 3' end of the uncut pre-primer is marked with a phosphate group and does not pair with the GTGAGACTC sequence segment in the amplification template chain, it will not be extended and amplified by the DNA polymerase, so exponential amplification will not occur. After step S2, no single-stranded DNA product is produced.

[0035] Preferably, in step S1, the RNA base is 10-25 bp.

[0036] More preferably, the RNA base is: AGGGUAAACCAAAUA.

[0037] Preferably, in step S1, the DNA base is 5 to 10 bp.

[0038] More preferably, the DNA base is: CCCCCT.

[0039] Preferably, in step S1, the Cas12a / crRNA complex is a complex obtained by combining Cas12a protein and crRNA in a 1:1 molar ratio.

[0040] Preferably, in step S1, the incubation conditions are: 30-40° C., and incubation for 10-120 min.

[0041] Preferably, in step S2, the EXPAR amplification reaction system includes 45~60nM amplification template chain, 200~300 μM dNTP mix, 0.5~1.0 U / μL Nt.BstNBI nicking endonuclease, 0.2~1.0 U / μL Bst 2.0DNA polymerase, 1~2µM single-stranded binding protein, 1×Isothermal amplification buffer, and 0.25×NEBuffer3.1 buffer.

[0042] Preferably, in step S2, the mixture obtained after incubation is added to the EXPAR amplification reaction system at 18% to 24% (v / v).

[0043] Preferably, in step S2, the amplification reaction is carried out at 50-60° C. for 5-40 min.

[0044] Preferably, in step S3, the sequence of the detection probe is: 5'-GTTTACCCTTTTTT-3'.

[0045] Preferably, the detection color development reaction is: If the target detection double-stranded DNA exists in the object to be detected, the EXPAR amplification reaction product of the first sequence is complementary to the detection probe after mixing, so that color development occurs; if the target detection double-stranded DNA does not exist in the object to be detected, color development cannot occur after mixing. Color development can be achieved by general existing technologies.

[0046] Specifically, the present embodiment provides a more accurate color development method, specifically: the mixture after the amplification reaction is added dropwise to the lateral flow chromatography test paper, and the color development reaction is used to determine whether the object to be detected contains the target detection double-stranded DNA. In the lateral flow chromatography test paper, a sample pad, a gold-labeled pad, a nitrocellulose membrane and a water-absorbing pad are included. The gold-labeled pad is embedded with a nanogold-labeled probe, and a detection line and a control line are respectively drawn on the nitrocellulose membrane. The detection line contains a biotinylated detection line capture probe, and the detection line capture probe sequence is 5'-GTTTACCCTTTTTT-3', and the control line contains a biotinylated control line capture probe, and the sequence of the control line capture probe is 5'-TTTTTCAAATACCA-3'. If the object to be detected contains double-stranded DNA for target detection, through step S2, a large amount of single-stranded DNA products (primer probe amplification) will be produced. When the single-stranded DNA product flows through the gold pad and the nitrocellulose membrane, it will be hybridized with the nanogold-labeled probe and the detection line capture probe at the same time through base complementary pairing, so as to produce a red band on the detection line, and the free nanogold-labeled probe can be hybridized with the control line capture probe, and it is red on the control line, so that 2 red bands appear. If the object to be detected does not contain double-stranded DNA for target detection, the trans-cleavage activity of Cas12a / crRNA will be silenced, and the pre-primer probe cannot be cut, and a mature primer probe cannot be produced, so step S2 cannot start exponential signal amplification, and the above-mentioned single-stranded DNA product is not produced, so that only the red band produced by the hybridization of the free nanogold-labeled probe and the control line capture probe appears. The color development method provided in the present embodiment utilizes the principle of base complementary pairing, with high specificity, and due to the presence of the control line, high accuracy, and has the advantages of being cheap and easier to preserve.

[0047] In the case where the target double-stranded DNA is present, the specific process of the detection method provided in this embodiment is as follows: Figure 1As shown, Cas12 / crRNA recognizes the target detection double-stranded DNA and activates its trans cutting ability, shearing the phosphodiester bond of the deoxyribonucleic acid in the pre-primer probe to produce a mature primer probe. These mature primer probes are then hybridized with the amplification template chain, and the chain is extended to form a new double-stranded DNA under the action of Bst DNA polymerase. Nt.BstNBI nicking endonuclease can recognize the restriction site on the double-stranded DNA to produce an incision, and the DNA polymerase can extend and displace the chain from the incision to produce a single-stranded DNA product, which can hybridize with another amplification template chain to start a new amplification. A large amount of single-stranded DNA products can be produced through the continuous cycle of enzyme nicking, chain extension, and chain displacement. The single-stranded DNA product is then detected by lateral flow chromatography test paper. In the lateral flow chromatography test paper, the gold label pad is embedded with a nanogold-labeled probe, and the nitrocellulose membrane is respectively marked with a detection line and a control line. When the single-stranded DNA product flows through the gold-labeled pad and the nitrocellulose membrane, it will hybridize with the nanogold probe and the capture probe on the detection line through base complementary pairing, thereby generating a red band on the detection line, and the free nanogold-labeled probe can hybridize with the capture probe on the control line, appearing red on the control line, resulting in the appearance of two red bands.

[0048] Compared with the prior art, this embodiment has the following technical effects: (1) This embodiment uses the pre-primer probe and Cas12a / crRNA system to convert the amplification and detection of double-stranded DNA into the exponential amplification and detection of the primer probe. The exponential amplification of the target detection double-stranded DNA signal can be more stably achieved through the exponential amplification of the short sequence primer probe, thereby achieving rapid, sensitive and accurate detection of the target detection double-stranded DNA. The prior art mostly uses CRISPR / Cas9 to cleave double-stranded DNA to generate DNA fragments to activate EXPAR amplification and amplification detection signals, thereby achieving the purpose of detecting double-stranded DNA at the detection site. However, the EXPAR amplification of the double-stranded DNA requires the redesign of the EXPAR amplification template sequence when detecting different targets, which greatly increases the complexity of the design. In this embodiment, when detecting different target detection double-stranded DNA, the presence signals of different target detection double-stranded DNA can all be converted into the presence signals of the primer probe, the cleavage product of the above-mentioned pre-primer probe, thereby avoiding the redesign of the EXPAR amplification template sequence.

[0049] (2) The operation of designing the sequence in this embodiment is only the design of the recognition region of the target detection double-stranded DNA in the crRNA sequence, and the design does not need to consider the problem of primer dimers. When replacing different target detection double-stranded DNAs, it is only necessary to find the corresponding efficient CRISPR / Cas12 PAM recognition site to achieve exponential amplification of the target detection double-stranded DNA signal and achieve accurate and efficient signal amplification. However, in the classic RPA+Cas12 detection technology, when designing the EXPAR amplification template sequence, three issues must be considered at the same time: the efficient amplification of RPA primers, whether the product amplified by the RPA primer contains the PAM recognition site of CRISPR / Cas12, and the shearing efficiency of the recognition site. Therefore, compared with the classic RPA+Cas12 detection technology, this embodiment is simpler, more efficient, and more feasible when replacing different target detection double-stranded DNAs.

[0050] Application Example 1 Based on the nucleic acid detection method provided in Example 1, this application example uses the DNA fragment of the GB gene of herpes simplex virus as the target to detect double-stranded DNA, i.e., the target, and evaluates the feasibility of the method. The specific steps are as follows: (1) Perform Cas12a / crRNA cleavage. The total volume of the Cas12a / crRNA cleavage system is 10 µL, containing 10 pM synthetic herpes simplex virus gene DNA, 250 nM pre-primer probe and 25 nM Cas13a / crRNA complex (Cas12a / crRNA complex is obtained by mixing Cas12a protein and crRNA in a molar ratio of 1:1). The reaction mixture is incubated at 37 °C for 30 min.

[0051] The sequence of the pre-primer probe is: 5'- AGGGUAAACCAAAUA CCCCCT-3', the underlined part is the RNA base, and the 3' end is phosphorylated.

[0052] Among them, the crRNA sequence is designed according to the GB gene sequence, and the sequence of crRNA is: 5' - UAAUUUCUACUAAGUGUAGAU UAGUACAUGGUGGCCUUGAA -3'.

[0053] (2) Perform EXPAR amplification reaction. The total volume of the EXPAR amplification reaction is 10 µL, containing 50 nM EXPAR amplification template, 250 µM dNTP mix and 2 µL of Cas12a / crRNA cleavage reaction product from step (1), 0.625 U / µL Nt.BstNBI nicking endonuclease, 0.5 U / µL Bst 2.0 DNA polymerase, 1 µM single-stranded binding protein, 1×Isothermal amplification buffer and 0.25×NEBuffer 3.1 buffer. The reaction mixture is incubated at 55 °C for 15 min.

[0054] Among them, the EXPAR amplification template sequence is: 5'-TGGTATTTGGTTTACCCTGTGAGACTCTGGTATTTGGTTTACCCT-3', the 3' end is phosphorylated.

[0055] The formula of 1×Isothermal amplification buffer is as follows: 20 mM Tris-HCl, 50 mM KCl, 10 mM (NH4)2S04, 2 Mm MgS04, 0.1% Tween-20, pH 8.8.

[0056] The formula of 0.25×NEBuffer 3.1 buffer is as follows: 6.25 mM Tris-HCl, 12.5 mM NaCl, 1.25 mM MgCl2 and 0.125 mM dithiothreitol, pH 7.9.

[0057] (3) Preparation of gold nanoparticle-labeled probes.

[0058] Prepare a labeled probe with the sequence: 5'-AAAAATGGTATTTGTTTTT-3'. Prepare colloidal gold using the sodium citrate reduction method, the steps are: heat 100 mL of HAuCl4 with a concentration of 1 mM to boiling, and after the boiling stabilizes, add 8 mL of sodium citrate solution with a concentration of 38.8 mM under rapid stirring. Within two minutes, the color of the solution changes from golden yellow → colorless → black → dark purple → wine red → translucent red. Continue stirring for 15-30 minutes, stop heating and continue stirring to cool to room temperature, and a colloidal gold solution is obtained, and the colloidal gold particle size is about 20 nm.

[0059] Nanogold-labeled probes were prepared by microwave thermal drying. The specific steps were as follows: 50 μL of 100 μM labeled probe was mixed with 1 mL of colloidal gold, and then added to a glass bottle. The glass bottle was placed in a household microwave oven and heated at medium-high heat for 3 min. At this time, the mixed solution in the glass bottle was completely dry. Subsequently, 1 mL of triple distilled water was added to the heated and dried glass bottle, and the mixture was gently blown and mixed with a pipette. After the solution in the glass bottle was transferred to an EP tube, it was centrifuged at 25°C and 12000 rpm / min for 20 minutes; after the supernatant was removed, it was resuspended in washing buffer (0.3 M NaCl, 0.01 M phosphate buffer, pH7.4), and then centrifuged at 25°C and 12000 rpm / min for 20 minutes. After aspirating the supernatant, resuspend it in 1 mL of resuspension buffer (1M NaCl, 20 mM Na3PO4, 5% BSA, 0.25% Tween-20, 10% sucrose) to obtain the nanogold-labeled probe.

[0060] (4) Assemble the test strips.

[0061] Nucleic acid test strips such as Figure 2 As shown in the figure, it consists of four parts: sample pad, gold label pad, nitrocellulose membrane and absorbent pad. The assembly steps are as follows: a) Sample pad: The sample pad is made of glass cellulose membrane. After being cut into appropriate size, it is soaked with sample pad treatment solution (0.25% Triton X-100, 0.05 M Tris-HCl, and 0.15 M NaCl, PH 8.0) and dried at room temperature for use.

[0062] b) Gold label pad treatment: The gold label pad is made of glass cellulose membrane, which is cut into a suitable size, soaked with the nanogold probe solution prepared in step (3), dried at room temperature and set aside.

[0063] c) Treatment of nitrocellulose membrane: Take the biotinylated control line capture probe and the biotinylated detection line capture probe, incubate them with streptavidin (1 mg / mL) respectively, and then use ZX two-dimensional membrane gold spraying instrument (HM3020) to draw them on different positions of the nitrocellulose membrane as detection line and control line, respectively, with a spacing of about 3 mm. Let them dry naturally at room temperature for later use.

[0064] in: The sequence of the control line capture probe is 5'-TTTTTCAAATACCA-3', The sequence of the detection line capture probe is 5'-GTTTACCCTTTTTT-3'.

[0065] d) Treatment of absorbent pad: Use a paper cutter to cut the absorbent pad into suitable size to provide capillary force to make the sample to be tested flow.

[0066] e) Assembly of the test strip: Place the sample pad, gold label pad, nitrocellulose membrane and absorbent pad in the order Figure 2 The structures shown are sequentially pasted on the PVC board, with adjacent parts overlapping by 2 mm, and cut into 4 mm wide strips with a rolling paper cutter, and stored dry at room temperature for later use.

[0067] (5) Lateral flow chromatography test strip color development and result reading.

[0068] After the reaction in step (2) is completed, 10 µL of the reaction solution is dripped onto the sample pad of the test paper in step (4), and 100 µL of running buffer (4× SSC, 0.05% Tween-20, 1× PBS, 1% BSA) is slowly dripped onto the sample pad. After standing for 5 minutes, the detection line band and the control line band on the lateral flow chromatography test paper are observed. The presence or absence of the target can be determined based on the presence or absence of bands on the detection line.

[0069] The presence of a red stripe on the test line indicates a positive result and the presence of the target, while the absence of a red stripe on the test line indicates a negative result and the absence of the target.

[0070] A red stripe on the control line indicates that the test is valid, and no red stripe on the control line indicates that the test is invalid.

[0071] (6) Feasibility analysis

[0072] Cas12a / crRNA+HSV DNA+pre-primer was used as the experimental group (Group 1), and no HSV DNA (Group 2), no pre-primer (Group 3), no Cas12a / crRNA (Group 4), and no Cas12a / crRNA+HSV DNA were used as the control group (Group 5). Under the same conditions, a feasibility verification experiment was performed through the above steps (1) to (5). The results are shown in Figure 2. Figure 3 shown.

[0073] Depend on Figure 3 It can be seen that only the detection line of the experimental group can see obvious bands, which proves the feasibility of the method in Example 1.

[0074] Application Example 2 The sensitivity of the method provided in Example 1 was evaluated by taking the herpes simplex virus GB gene fragment as the detection target. The steps are as follows: The herpes simplex virus GB gene DNA fragment was diluted according to a certain concentration, and the concentration distribution was: 2×10 -15 M, 2×10 -14M, 2×10 -13 M, 2×10 -12 M, 2×10 -11 M, 2×10 -10 M, 2×10 -9 M. The specific steps of amplification and detection are the same as steps (1) to (5) of Application Example 1, except for the concentration of the herpes simplex virus gene DNA in step (1).

[0075] The sensitivity verification results are shown in Figure 4 .

[0076] like Figure 4 As shown in Figure 2, the concentration of herpes simplex virus gene DNA fragments that can be detected by this method is 2×10 -15 M, indicating that this method has high detection sensitivity.

[0077] Application Example 3 The herpes simplex virus GB gene fragment was used as the detection target to evaluate the specificity of the method provided in Example 1. The steps are as follows: Based on the sequence of the GB gene fragment of herpes simplex virus, the sites of single base mutation or two base mutations are artificially designed, such as Figure 5 As shown in a, compared with the DNA fragment without base mutation (WT), M-1, M-2, M-3, M-4, M-5, M-6 and M-7 each contain a single base mutation, and M-8 and M-9 each contain two base mutations. The DNA fragments containing mutation sites were detected by the method in Example 1, and the detection results are shown in FIG. Figure 5 As shown in b, the band intensity of the DNA fragments containing two base mutations (M-8, M-9) and the DNA fragment without base mutations (WT) is significantly different. The specific steps of amplification and detection are the same as steps (1) to (5) of Application Example 1, except that the herpes simplex virus gene DNA added in step (1) is WT, M-1, M-2, M-3, M-4, M-5, M-6, M-7, M-8, and M-9, respectively.

[0078] Test results such as Figure 5 As shown in b.

[0079] Depend on Figure 5 b It can be seen that this method can distinguish mutations of two bases and has high detection specificity.

[0080] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0081] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A method for detecting double-stranded DNA nucleic acid, characterized in that: The following steps are involved: Step S1: Evenly mix the object to be detected with the pre-primer probe and the Cas12a / crRNA complex and incubate; Step S2: adding the mixture obtained after incubation to the EXPAR amplification reaction system to perform an amplification reaction; Step S3: mixing the mixture after the amplification reaction with the detection probe to perform a detection color reaction; in: The sequence of the pre-primer probe is: 5'-first sequence-second sequence-3'; the first sequence is a short-chain RNA base that can resist Cas12 / crRNA shearing, and the RNA base can serve as a primer for DNA polymerase polymerization extension; the second sequence is a DNA base that can be sheared by activated Cas12 / crRNA; the 3' end of the pre-primer probe is phosphorylated; The sequence of the crRNA is: UAAUUUCUACUAAGUGUAGAU NNNNNNNNNNNNNNNNNNNNN , wherein the underlined portion is the recognition region of the target detection double-stranded DNA, which is designed according to the target detection double-stranded DNA, and its length is determined according to the target detection double-stranded DNA; The EXPAR amplification reaction system includes an amplification template chain, Nt.BstNBI nicking endonuclease, and Bst 2.0 DNA polymerase. The sequence of the amplification template chain is: 5'-third sequence-GTGAGACTC-third sequence-3', and the third sequence can complement the first sequence; The sequence of the detection probe includes a sequence segment that can complementarily pair with the EXPAR amplification reaction product of the first sequence.

2. The nucleic acid detection method according to claim 1, characterized in that: In step S1, the RNA base is 10-25 bp; the DNA base is 5-10 bp.

3. The nucleic acid detection method according to claim 2, characterized in that: The RNA base is: AGGGUAAACCAAAUA; The DNA base is: CCCCCT.

4. The nucleic acid detection method according to claim 1, characterized in that: In step S1, the Cas12a / crRNA complex is a complex obtained by combining Cas12a protein and crRNA in a 1:1 molar ratio.

5. The nucleic acid detection method according to claim 1, characterized in that: In step S1, the incubation conditions are: 30-40°C for 10-120 min.

6. The nucleic acid detection method according to claim 1, characterized in that: In step S2, the EXPAR amplification reaction system includes 45~60nM amplification template chain, 200~300 μM dNTP mix, 0.5~1.0 U / μL Nt.BstNBI nicking endonuclease, 0.2~1.0 U / μL Bst 2.0 DNA polymerase, 1~2μM single-stranded binding protein, 1×Isothermalamplification buffer, and 0.25×NEBuffer 3.1 buffer.

7. The nucleic acid detection method according to claim 1, characterized in that: In step S2, the amplification reaction is carried out at 50-60°C for 5-40 min.

8. The nucleic acid detection method according to claim 1, characterized in that: In step S3, the sequence of the detection probe is: 5'- GTTTACCCTTTTTT-3'; The detection color reaction is: If the target detection double-stranded DNA exists in the object to be detected, the EXPAR amplification reaction product of the first sequence will complementarily pair with the detection probe after mixing, causing color development; if the target detection double-stranded DNA does not exist in the object to be detected, no color development will occur after mixing.

9. The nucleic acid detection method according to claim 1 or 8, characterized in that: Step S3 is: dripping the mixture after the amplification reaction onto the test strip, and performing a color development reaction on the test strip; The gold pad of the test strip is embedded with a nanogold probe, and the probe sequence of the nanogold probe is: 5'-AAAAATGGTATTTGTTTTT-3'; the gold pad of the test strip is provided with a detection line, and a detection line probe is fixed on the detection line, and the detection line probe sequence is: 5'-GTTTACCCTTTTTT-3'; If the target detection double-stranded DNA exists in the object to be detected, the detection line will show color after mixing; if the target detection double-stranded DNA does not exist in the object to be detected, the detection line will not show color after mixing.

10. Use of the nucleic acid detection method according to any one of claims 1 to 9 in the detection of double-stranded DNA.

Images