Plasma marker for colorectal cancer diagnosis or prediction and application thereof

Abstract

The invention belongs to the technical field of biology, and relates to a plasma marker for colorectal cancer diagnosis or prediction and application of the plasma marker. The invention creatively provides the application of specific enhancer RNA (eRNA58712) in serum in early diagnosis or detection of colorectal cancer, which marks that important progress is achieved in the aspect of finding novel biomarkers. The expression quantity of the eRNA58712 in serum of a colorectal cancer patient is obviously higher than that of a healthy individual, and the expression level of the eRNA58712 has an obvious positive correlation relationship with occurrence and development of the colorectal cancer, which means that rapid and accurate early recognition of the colorectal cancer can be realized on a molecular level by measuring the concentration of the eRNA58712 in a blood sample.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a plasma marker for diagnosing or predicting colorectal cancer and an application thereof. Background Art

[0002] As the third most common malignant tumor in the world, colorectal cancer has a high incidence and mortality rate. Data from 2022 showed that there were more than 1.9 million new confirmed cases and 904,000 deaths worldwide. Although the mortality rate of the disease is declining in some developed countries such as Japan and Singapore, the incidence and mortality of colorectal cancer in China are on the rise. For patients with colorectal cancer, early diagnosis of the disease is crucial because the 5-year survival rate of patients in stage I or II is relatively high, while the 5-year survival rate of patients in stage IV is less than 15%.

[0003] Therefore, exploring new biomarkers to identify diseases earlier and reveal their development mechanisms has become a research focus. In recent years, enhancer RNA (eRNA), as an emerging research object, has played an important role in cancer-related mechanisms. Enhancers are key regulatory elements that can increase the transcriptional activity of target genes. They are traditionally considered to be regions that bind transcription factors, but the latest studies have shown that these regions can produce long non-coding RNAs, namely eRNAs, which have been found in a variety of human cell lineages and play an important role in a variety of cancers, including breast cancer and prostate cancer. For example, in breast cancer, ESR1 activation increases the production of FOXC1 and TFF1 eRNAs; while in prostate cancer, KLK3 eRNA promotes cancer cell proliferation by affecting the expression of androgen receptor-regulated genes. These evidences show that eRNAs are not only involved in the occurrence and development of cancer, but also have value as potential biomarkers.

[0004] However, the main diagnostic methods for colorectal cancer, such as colonoscopy, are the gold standard, but their popularity is limited by their invasiveness, complex operation and high cost. Non-invasive fecal occult blood test / immunochemical test is suitable for large-scale screening, but due to limited sensitivity and specificity, it may cause misdiagnosis. Virtual colonoscopy (CT colonography) provides another non-invasive option, but it also faces the problem of high cost. In view of the limitations of the above methods, a new diagnostic strategy based on eRNA has been proposed, aiming to develop a more accurate, efficient and non-invasive diagnostic tool to improve patient prognosis and reduce the burden on the medical system. Although this theory is promising, further research is still needed to translate it into clinical practice to verify the exact function of eRNA and its effectiveness as a diagnostic tool.

[0005] The Chinese patent application document (CN117106912A) discloses a functional enhancer RNA site related to the identification and early screening of high-risk populations for colorectal cancer and its application, but the patent focuses on the rs3094296 site and its corresponding enhancer RNA (SENP7e). Although this site does have a certain diagnostic value, its scope of application is relatively narrow, mainly targeting specific genetic variations. However, due to the diversity and complexity of SNPs (single nucleotide polymorphisms), this method is not suitable for all patients, especially those who do not carry this site, resulting in insufficient screening coverage. Summary of the invention

[0006] The purpose of the present invention is to address the above-mentioned problems existing in the prior art and to propose a plasma marker for the diagnosis or prediction of colorectal cancer, which detects the expression level of eRNA58712 in plasma, and is particularly used to detect the expression of eRNA58712 in the plasma of colorectal cancer patients, thereby serving as a molecular marker for intestinal cancer.

[0007] The object of the present invention can be achieved through the following technical solutions: a plasma marker for diagnosis or prediction of colorectal cancer, wherein the marker is eRNA58712 with a sequence as shown in SEQ ID NO: 1.

[0008] The present invention also provides a primer combination of the above plasma marker for diagnosis or prediction of colorectal cancer, the primer combination comprising: a specific primer for eRNA58712.

[0009] In the above primer combination for plasma markers for diagnosis or prediction of colorectal cancer, the specific primers for eRNA58712 include the forward primer shown in SEQ ID NO: 2 and the reverse primer shown in SEQ ID NO: 3.

[0010] The present invention also provides a use of the above-mentioned plasma marker for diagnosis or prediction of colorectal cancer in the preparation of a colorectal cancer diagnosis product.

[0011] The present invention also provides an application of the above-mentioned primer combination of plasma markers for diagnosis or prediction of colorectal cancer in the preparation of a colorectal cancer diagnosis product.

[0012] A kit for diagnosing or predicting colorectal cancer, characterized in that the kit comprises the above-mentioned marker or the above-mentioned primer combination.

[0013] A colorectal cancer targeted drug, comprising the above-mentioned marker or the above-mentioned primer combination.

[0014] Preferably, the present invention also provides a method for measuring marker eRNA in plasma, the method comprising the following steps:

[0015] S1. Collect blood from subjects and extract total RNA from plasma;

[0016] S2, reverse transcription of RNA into cDNA;

[0017] S3, using the specific primers of eRNA58712 to perform qRT-PCR detection on the cDNA solution of the above step (2), so as to obtain the corresponding signal value;

[0018] S4. Obtain the Cq value (i.e., Y value) of each sample and calculate the corresponding eRNA copy number in the sample using the standard curve. Then, the calculated copy number is calculated according to the formula 80×10 X The results were converted into absolute copy numbers per 1 mL of plasma, and statistical analysis was performed on the copy numbers of eRNA58712 in 1 mL of plasma from colorectal cancer patients.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] 1. The present invention has innovatively proposed the application of specific enhancer RNA (eRNA58712) in serum for early diagnosis or detection of colorectal cancer, marking an important progress in the search for new biomarkers. The present invention uses the fact that the expression of eRNA58712 in the serum of patients with colorectal cancer is significantly higher than that in healthy individuals, and its expression level has a significant positive correlation with the occurrence and development of colorectal cancer, which means that by measuring the concentration of eRNA58712 in blood samples, rapid and accurate early identification of colorectal cancer can be achieved at the molecular level. Compared with existing screening methods, such as colonoscopy, fecal occult blood test and virtual colonoscopy, the detection technology based on eRNA58712 is not only easy to operate, but also has the advantage of being non-invasive, which greatly improves the comfort of patients and reduces medical costs.

[0021] 2. The key innovation of the present invention is that it can provide a highly targeted biomarker, which makes the diagnosis process more accurate and reliable. As a highly specific and sensitive indicator, eRNA58712 helps to improve the detection rate of colorectal cancer, especially in the early stages of the disease. In addition, since the expression changes of eRNA58712 are closely related to the growth state of the tumor, it also has the potential to be used as an important tool for monitoring the progression of the disease, providing valuable reference information for clinicians to formulate personalized treatment plans.

[0022] 3. The eRNA58712-based diagnostic strategy of the present invention is expected to become one of the effective means to improve the early detection and management of colorectal cancer, showing great innovation potential and broad application prospects, thereby ultimately improving the quality of life and survival chances of patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Full-length single-cell data were used to map the distribution of cancer epithelial cells in different cancers and the expression patterns of marker eRNAs in some colorectal cancer epithelial cells.

[0024] Figure 2 The transcription of eRNA58712 was detected by RACE experiment;

[0025] Figure 3 The ROC curve of the kit for colorectal cancer detection in the present invention is shown;

[0026] Figure 4 Provided is a fluorescence quantitative standard curve of the eRNA58712 plasmid standard in the embodiments of the present invention;

[0027] Figure 5 The results of comparing the expression levels of eRNA58712 in the plasma of healthy subjects and the plasma of patients with colorectal cancer in the embodiments of the present invention are shown;

[0028] Figure 6 The ROC curves of the conventional marker CA199 and the eRNA marker eRNA58712 in plasma in detecting colorectal cancer patients are shown. DETAILED DESCRIPTION

[0029] The following are specific embodiments of the present invention, which further describe the technical solutions of the present invention, but the present invention is not limited to these embodiments.

[0030] Embodiment 1:

[0031] This study first collected plasma samples from 96 healthy individuals and 94 colorectal cancer patients from the First Affiliated Hospital of Ningbo University on the basis of obtaining informed consent from the individuals or their families, and collected the patients' complete clinical information data.

[0032] S1. Plasma separation: Collect 5 mL of peripheral blood sample into a blood collection tube containing EDTA anticoagulant, immediately refrigerate at 4°C, let stand for 30 minutes, centrifuge at 3000 rpm for 10 minutes at 4°C to remove blood cell residues in the plasma, then carefully draw the upper plasma and transfer it to an enzyme-free centrifuge tube. The separated plasma is packaged and stored in a -80°C refrigerator for subsequent use.

[0033] S2. Plasma RNA extraction: Use Trizol LS reagent produced by Invitrogen, USA. Take 250μL plasma sample and place it in a 1.5mL centrifuge tube without nuclease contamination. After adding 750μL Trizol LS reagent, cover the tube tightly and mix by vortexing for 15 seconds, then let it stand at 4°C for 10 minutes. Next, centrifuge the tube briefly for 10 seconds, add 200μL chloroform, cover the tube tightly and shake it upside down manually 6 times, let it stand at 4°C for 3 minutes, and centrifuge it at 12000rpm for 15 minutes to obtain three layers of separated liquid. Prepare a nuclease-free 1.5mL centrifuge tube, add 500μL isopropanol, aspirate 500μL of the upper transparent liquid after centrifugation and transfer it to isopropanol, mix well, let it stand at 4°C for 10 minutes, centrifuge it at 12000rpm for 10 minutes, and carefully remove the supernatant. Subsequently, 1 mL of pre-cooled 75% ethanol was added to the centrifuge tube, and the tube was capped and inverted to wash the precipitate, and then centrifuged at 12000 rpm at 4 ° C for 3 minutes, and the supernatant was discarded. Next, the centrifuge tube was returned to the centrifuge, centrifuged at 12000 rpm at 4 ° C for 1 minute, the residual supernatant was discarded, and dried for 3 minutes. Finally, 8 μL of enzyme-free water was added and mixed by pipetting. Take 1 μL of RNA solution and measure the RNA concentration and purity of the sample with NanoDrop One ultra-micro UV spectrophotometer produced by Thermo Fisher Scientific, USA, to ensure that the A260 / A280 ratio is between 1.8 and 2.1. Finally, 7 μL of total RNA was taken for reverse transcription reaction.

[0034] S3. cDNA synthesis: The operation was performed according to the instructions of the Polestar1st cDNA synthesis kit (including gDNA removal) produced by Beijing Baoying Tonghui Biotechnology Co., Ltd. The reverse transcription reaction system was configured with the following components, with a total volume of 20 μL:

[0035] Table 1: Reverse transcription reaction system

[0036]

[0037] The reaction system was incubated at 25°C for 10 minutes, followed by reaction at 55°C for 60 minutes, and finally heated at 85°C for 5 minutes to terminate the reaction. The synthesized cDNA can be stored at -20°C or used directly for fluorescence quantitative PCR analysis.

[0038] Table 2: Specific primers for qRT-PCR detection

[0039] sequence name serial number Sequence(5'-3') eRNA58712 forward primer SEQ ID NO: 2 TCCAGGACTCGTGGGATTTT eRNA58712 reverse primer SEQ ID NO: 3 CCACCAGGCATTCACCTATTT

[0040] Figure 2The transcription of eRNA58712 was detected by RACE experiment; agarose gel electrophoresis clearly showed the amplified fragments, including the intermediate sequence, 942 bp 3'RACE product and 198 bp 5'RACE product. The present invention conducted subsequent experiments on the sequence at positions 3068-3366 of eRNA58712 as shown in SEQ ID NO:1.

[0041] S4. Preparation of plasmid standard: After TA cloning and sequencing of the PCR product of eRNA58712 shown in SEQ ID NO: 1, the obtained base sequence was cloned into the pUC57 plasmid to construct a recombinant plasmid pUC57-eRNA58712 (the length of the inserted base sequence is 299 bp, and the total length of the plasmid is 3003 bp). The recombinant plasmid was prepared by General Biotechnology (Anhui) Co., Ltd.

[0042] S5. UV spectrophotometer measurement of recombinant plasmid: Add 50 μL of enzyme-free water to the plasmid DNA powder, dissolve it and prepare the first high-concentration standard, and use a UV spectrophotometer to measure its concentration and OD260 value. The concentration of pUC57-eRNA58712 was 249.67 ng / μL, and the OD260 value was 4.993. According to the formula (where the DNA length is the full length of the plasmid, including the vector backbone) for calculation.

[0043] S6. Absolute quantitative PCR: First, the high-concentration standard was diluted stepwise at different ratios, and the copy numbers of five different dilution gradients (including 7.58×10 9 copies / μL,7.58×10 8 copies / μL,7.58×10 7 copies / μL,7.58×10 6 copies / μL and 7.58×10 5 Each cDNA sample was repeated three times, and these samples were added to a 96-well PCR plate and amplified using a two-step method to obtain Cq values ​​corresponding to five different dilution gradients.

[0044] The amplification reaction was programmed as follows: pre-denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 15 seconds, annealing at 62°C for 20 seconds, and extension at 72°C for 30 seconds, for a total of 45 cycles. Through qRT-PCR amplification, the system generated a standard curve for the recombinant plasmid pUC57-eRNA58712 based on the changes in the fluorescence signal. The correlation coefficient R 2The linear regression equation was 0.995, indicating a good linear relationship within the concentration range of the plasmid dilution. The linear regression equation generated was Y = -3.6954X + 41.61, where Y is the Cq value, 10 X The amplification efficiency was 86.5%, indicating that the standard curve can accurately reflect the amplification of the target product. On this basis, the Cq value of each sample was determined, and its copy number was calculated through the corresponding standard curve. Then, according to the formula 80×10 X The absolute copy number of eRNA in 1 mL of plasma was calculated, and the copy number of eRNA58712 in 1 mL of plasma of colorectal cancer patients was statistically analyzed.

[0045] Figure 3 The ROC curve of the kit for colorectal cancer detection in the present invention is shown; the area under the curve reaches 0.730, the sensitivity and specificity are 0.543 and 0.833 respectively, and the cutoff value is 4316 copies / mL, indicating that eRNA58712 has good efficacy as a diagnostic marker.

[0046] Figure 4 The fluorescence quantitative standard curve of the eRNA58712 plasmid standard in the embodiment of the present invention is provided; the correlation coefficient R 2 The linear regression equation was 0.995, indicating that the standard curve had a good linear relationship within the concentration range of the plasmid dilution. The linear regression equation was Y = -3.6954X + 41.61. The amplification efficiency was 86.5%, indicating that the standard curve could accurately reflect the amplification of the target product.

[0047] Figure 5 The results of the comparison of the expression levels of eRNA58712 in the plasma of healthy subjects and in the plasma of colorectal cancer patients in the embodiment of the present invention are shown; it was found that the absolute copy number of this eRNA in CC patients was significantly higher than that in healthy subjects (4551 vs. 2919, p<0.001, Wilcoxon rank sum test).

[0048] S7. Results show: Figure 6 The ROC curves of the conventional marker CA199 in plasma and the eRNA marker eRNA58712 of the present invention in detecting colorectal cancer patients are shown. It can be seen from the figure that eRNA58712 has a higher diagnostic value in colorectal cancer plasma, and its area under the ROC curve is 0.730, which is higher than 0.654 of CA199, showing good diagnostic ability. At the same time, the ROC of the combination of the two as a combined diagnostic marker reached 0.872.

[0049] Figure 1The distribution map of cancer epithelial cells of different cancers and the expression pattern of marker eRNA in some colorectal cancer epithelial cells were drawn using full-length single-cell data. This figure shows the t-SNE (t-distributed random neighbor embedding) analysis of cancer epithelial cells in different cancer types, and different colors represent different cancer types. The dotted box represents the expression of colorectal cancer epithelial cell marker eRNA in epithelial cells of different cancer types. Through clustering, the present invention can find significant differences between each cancer epithelial cell, indicating that there is strong heterogeneity between tumors. Therefore, the present invention uses eRNA specifically expressed in various cancer types as a potential biomarker.

[0050] In summary, the present invention has innovatively proposed the application of specific enhancer RNA (eRNA58712) in serum for early diagnosis or detection of colorectal cancer, marking an important progress in the search for new biomarkers. The present invention utilizes that the expression of eRNA58712 in the serum of colorectal cancer patients is significantly higher than that in healthy individuals, and its expression level has a significant positive correlation with the occurrence and development of colorectal cancer, which means that by measuring the concentration of eRNA58712 in blood samples, rapid and accurate early identification of colorectal cancer can be achieved at the molecular level. Compared with existing screening methods, such as colonoscopy, fecal occult blood test and virtual colonoscopy, the detection technology based on eRNA58712 is not only easy to operate, but also has the advantage of being non-invasive, which greatly improves the comfort of patients and reduces medical costs.

[0051] The parts of the embodiments herein that are not exhaustive of the midpoint values ​​of the technical scope claimed for protection by the present invention and the new technical solutions formed by equivalent replacement of single or multiple technical features in the technical solutions of the embodiments are also within the scope claimed for protection by the present invention; at the same time, in all the listed or unlisted embodiments of the scheme of the present invention, each parameter in the same embodiment merely represents an example of its technical solution (i.e., a feasible solution), and there is no strict coordination and limitation relationship between the parameters, wherein the parameters can be replaced with each other without violating the axioms and the claims of the present invention, unless otherwise stated.

[0052] The technical means disclosed in the scheme of the present invention are not limited to the technical means disclosed in the above technical means, but also include technical schemes composed of any combination of the above technical features. The above is a specific implementation of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications are also regarded as the protection scope of the present invention.

[0053] The specific embodiments described herein are merely examples of the spirit of the present invention. Those skilled in the art may make various modifications or additions to the specific embodiments described or replace them in similar ways, but they will not deviate from the spirit of the present invention or exceed the scope defined by the appended claims.

Claims

1. A plasma marker for diagnosis or prediction of colorectal cancer, characterized in that: The marker is eRNA58712 whose sequence is shown in SEQ ID NO:

1.

2. A primer combination for plasma markers for diagnosis or prediction of colorectal cancer as claimed in claim 1, characterized in that: Primer combinations include: Specific primers for eRNA58712.

3. The primer combination of plasma markers for diagnosis or prediction of colorectal cancer according to claim 2, characterized in that: The specific primers for eRNA58712 include a forward primer shown in SEQ ID NO: 2 and a reverse primer shown in SEQ ID NO:

3.

4. Use of the plasma marker for diagnosis or prediction of colorectal cancer as claimed in claim 1 in the preparation of a colorectal cancer diagnostic product.

5. Use of a primer combination of plasma markers for diagnosis or prediction of colorectal cancer as described in claims 2-3 in the preparation of a colorectal cancer diagnostic product.

6. A kit for diagnosing or predicting colorectal cancer, characterized in that: The kit comprises the marker according to claim 1 or the primer combination according to claims 2-3.

7. A colorectal cancer targeted drug, comprising the marker according to claim 1 or the primer combination according to claims 2-3.

Images