DNA tetrahedron modified liposome probe, reagent, kit and method for synchronously detecting protein and nucleic acid in cEVs and application

Abstract

The invention relates to a DNA tetrahedron modified liposome probe, a reagent, a kit and a method for synchronously detecting protein and nucleic acid in cEVs and application. The DNA tetrahedron modified liposome probe comprises a DNA tetrahedron, an aptamer, a first hairpin probe, a second hairpin probe, a closed chain, a third hairpin probe and a fourth hairpin probe, and nucleotide sequences of the aptamer, the first hairpin probe, the second hairpin probe, the closed chain, the third hairpin probe and the fourth hairpin probe are respectively as shown in SEQ ID NO.1-6. The DNA tetrahedron is composed of nucleotide sequences as shown in SEQ ID NO.7-10, the aptamer, the first hairpin probe, the second hairpin probe and the closed chain are modified on the outer surface of the DNA tetrahedron and connected with the DNA tetrahedron, and the third hairpin probe and the fourth hairpin probe are modified on the inner surface of the DNA tetrahedron and connected with the DNA tetrahedron. When the DNA tetrahedron modified liposome probe is used for synchronously detecting protein and nucleic acid in cEVs, the sensitivity is high, the specificity is strong, and the repeatability is good.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a DNA tetrahedron-modified liposome probe, reagent, kit, method and application for synchronously detecting proteins and nucleic acids in cEVs. Background Art

[0002] Malignant tumors are the main cause of human death. Early diagnosis and treatment of tumors are of great significance to improving patients' quality of life, life safety, improving tumor prognosis and increasing survival rate.

[0003] Liquid biopsy is a diagnosis of diseases such as cancer through blood or body fluids. It can monitor circulating tumor cells (CTCs), circulating tumor DNA (ctDNA) fragments, circulating RNA (Circulating RNA) exosomes (carrying a variety of cell-derived proteins, RNA, DNA, lipids, etc.), and circulating extracellular vesicles (cEVs) released from primary tumors or metastatic lesions into body fluids or blood. cEVs are considered to be the most promising new biomarkers for tumor liquid biopsy.

[0004] Among the related technologies, the commonly used detection methods for cEVs markers at the laboratory level are mainly Western Blotting (WB) and RT-qPCR. However, both Western Blotting and RT-qPCR can only detect the average content of cEV markers, and cannot reflect the situation of a single EV. The proportion of cEVs released by tumor cells in the early stage of tumor is not high in the total EV population, which limits the application of these technologies in early diagnosis of tumors.

[0005] In recent years, single-molecule platforms such as nanoflow cytometry, super-resolution fluorescence microscopy, and droplet microfluidics have gradually emerged to achieve accurate detection of single EV molecular markers. However, single-molecule platforms such as nanoflow cytometry, super-resolution fluorescence microscopy, and droplet microfluidics have the disadvantages of being limited to detecting a single cEVs marker and having cumbersome operations, resulting in insufficient detection accuracy. Summary of the invention

[0006] In view of the shortcomings of the prior art mentioned above, the present invention provides DNA tetrahedron-modified liposome probes, reagents, kits, methods and applications for the simultaneous detection of proteins and nucleic acids in cEVs, so as to sensitively, rapidly and multi-dimensionally simultaneously detect the concentrations of proteins and nucleic acids in circulating extracellular vesicles (cEVs).

[0007] To achieve the above objectives, the scheme of this application is as follows:

[0008] In the first aspect, the present invention provides a DNA tetrahedron modified liposome probe, comprising a DNA tetrahedron, an aptamer, a first hairpin probe (H1), a second hairpin probe (H2), a blocking chain (Blocker), a third hairpin probe (H3) and a fourth hairpin probe (H4), wherein the nucleotide sequences of the aptamer, the first hairpin probe, the second hairpin probe, the blocking chain, the third hairpin probe and the fourth hairpin probe are respectively as shown in SEQ ID NO.1-6, the DNA tetrahedron is composed of the nucleotide sequence shown in SEQ ID NO.7-10, the aptamer, the first hairpin probe, the second hairpin probe and the blocking chain are modified on the outer surface of the DNA tetrahedron and connected to the DNA tetrahedron, and the third hairpin probe and the fourth hairpin probe are modified on the inner surface of the DNA tetrahedron and connected to the DNA tetrahedron.

[0009] Optionally, the aptamer, the first hairpin probe and the second hairpin probe specifically bind to and recognize programmed death-ligand 1 (PDL1 aptamer).

[0010] Optionally, the third hairpin probe and the fourth hairpin probe specifically bind to and recognize the nucleic acid miRNA-142.

[0011] In a second aspect, the present application also provides the use of the DNA tetrahedron-modified liposome probe as described above in the preparation of a reagent for the simultaneous detection of proteins and nucleic acids in circulating extracellular vesicles.

[0012] In a third aspect, the present application also provides a reagent for synchronously detecting proteins and nucleic acids in circulating extracellular vesicles, including the DNA tetrahedron-modified liposome probe as described above.

[0013] In a fourth aspect, the present application also provides a kit for synchronously detecting proteins and nucleic acids in circulating extracellular vesicles, comprising the DNA tetrahedron-modified liposome probe as described above.

[0014] Optionally, the molar ratio of the aptamer, the first hairpin probe, the second hairpin probe and the closed strand is 0.5-1.5: 0.5-1.5: 0.5-1.5: 0.5-1.5.

[0015] Optionally, the molar ratio of the third hairpin probe to the fourth hairpin probe is 0.5-1.5:0.5-1.5.

[0016] Optionally, the molar ratio of the nucleotide sequence shown in SEQ ID NO.7, the nucleotide sequence shown in SEQ ID NO.8, the nucleotide sequence shown in SEQ ID NO.9 and the nucleotide sequence shown in SEQ ID NO.7 is 0.5-1.5:0.5-1.5:0.5-1.5:0.5-1.5.

[0017] In a fifth aspect, the present application also provides a method for synchronously detecting proteins and nucleic acids in circulating extracellular vesicles for the purpose of non-disease diagnosis and / or treatment, comprising the following steps:

[0018] The concentration of proteins and nucleic acids in circulating extracellular vesicles is determined by amplifying and detecting the template DNA of the sample to be detected using the DNA tetrahedron-modified liposome probe described above and / or the reagent described above and / or the kit described above.

[0019] Beneficial effects of the present invention:

[0020] The DNA tetrahedron-modified liposome probe of the present application is used to simultaneously detect proteins and nucleic acids in circulating extracellular vesicles, with high sensitivity, strong specificity and good repeatability.

[0021] The DNA tetrahedron-modified liposome probe of the present application is used to simultaneously detect proteins and nucleic acids in circulating extracellular vesicles, with good stability and accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is a schematic diagram of the present application, Reaction System represents a reaction system, Fluorescence Detection represents fluorescence detection, Healthy Donor represents a healthy human body, and Cancer Patients represents cancer patients;

[0023] Figure 2 Figure 1 is the electrophoresis result diagram; Figure A is the electrophoresis diagram of CHA reaction (first column: H4; second column: H3; third column: H3+H4; fourth column: H3+H4+target); Figure B is the electrophoresis diagram of HCR reaction (first column: H2; second column: H1; third column: H1+H2; fourth column: H1+H2+target);

[0024] Figure 3 The sensitivity test results are shown in the figure below. The left figure shows the sensitivity test results for the nucleic acid miR-142, and the right figure shows the sensitivity test results for the protein barcode Triger. FL Intensity means fluorescence intensity, the same below. Figure 4This is a graph of specificity test results, SM represents single gene mutation, BM represents double gene mutation, TM represents triple gene mutation, random represents random mutation, and BLank represents blank control;

[0025] Figure 5 This is a feasibility test result diagram. DETAILED DESCRIPTION

[0026] The following will describe the embodiments of the present invention with reference to the accompanying drawings and preferred embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be understood that the preferred embodiments are only for illustrating the present invention, not for limiting the scope of protection of the present invention.

[0027] It should be noted that the illustrations provided in the following embodiments are only schematic illustrations of the basic concept of the present invention, and thus the drawings only show components related to the present invention rather than being drawn according to the number, shape and size of components in actual implementation. In actual implementation, the type, quantity and proportion of each component may be changed arbitrarily, and the component layout may also be more complicated.

[0028] like Figure 1 As shown, the principle of the present application is as follows: the present application designs two different types of hairpin probes for nucleic acid miRNA-142 and PDL1 protein on circulating extracellular vesicles (cEVs) in cancer diagnosis. For nucleic acid miRNA-142 detection, when the specific sequence on the miRNA hairpin probe binds to the target nucleic acid miRNA-142, the hairpin opens, causing the distance between the fluorescent group and the quenching group modified on the hairpin to become farther, thereby releasing fluorescence; for PDL1 protein detection, when the aptamer binds to the target protein PDL1, the closed chain Blocker is released, and the Blocker binds to the hairpin and opens the hairpin to release fluorescence, which is then detected by a fluorescence instrument, thereby achieving simultaneous detection of nucleic acid miRNA-142 and PDL1 protein concentrations.

[0029] The nucleotide sequences used are as follows (all synthesized by biological companies):

[0030] (1) The sequence of the PDL1 aptamer (i.e., aptamer) for specific detection of protein PDL1 is:

[0031] 5'-ACGGGCCACATCAACTCATTGATAGACAATGCGTCCACTGCCCG-3';

[0032] (2) The sequence of the first hairpin probe (H1) for specific detection of protein PDL1 is:

[0033] 5'-GCAAAGAAACACCC / iBHQ1dT / TAGCCCAGGATGTACTAGGCTGGGCT / i6FAMdT / GGGGTGTTT-3'

[0034] (3) The sequence of the second hairpin probe (H2) for specific detection of protein PDL1 is:

[0035] 5'-TAGCCCAGCCTAGTACATCCTGGGCTGGGGTGTTTGATGTACTAGG-3';

[0036] The sequence of the blocking chain (Blocker) of the specific detection protein PDL1 is:

[0037] 5'-ATGAGTTGATTGTTCAAGGTTGT-3';

[0038] The sequence of the third hairpin probe (H3) for specific detection of nucleic acid miRNA-142 is:

[0039] 5'-AGTAGTGCTT / iBHQ1dT / TCTACTTTATGGATGTACTAGGCATAAAGTAG / iCy3dT / AAAG-3';

[0040] The sequence of the fourth hairpin probe (H4) for specific detection of nucleic acid miRNA-142 is:

[0041] 5'-CTTTATGCCTAGTACATCCATAAAGTAGAAAGGATGTACTAGG-3';

[0042] The sequence of L1 constituting the DNA tetrahedron that specifically connects to the hairpin probe is:

[0043] 5'-TTTCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTCTT-3';

[0044] (8) The sequence of L2 constituting the DNA tetrahedron that specifically connects to the hairpin probe is:

[0045] 5'-AAAAAGCTAGCTAGCTAGCTTATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATACTT-3';

[0046] (9) The sequence of L3 constituting the DNA tetrahedron that specifically connects to the hairpin probe is:

[0047] 5'-ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTATT-3'

[0048] (10) The sequence of L4 constituting the DNA tetrahedron that specifically connects to the hairpin probe is:

[0049] 5'-AAAAAGCTAGCTAGCTAGCTTTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCATTTCACGTACGGG-3';

[0050] All sequences were synthesized by biological companies.

[0051] In the following description, numerous details are discussed to provide a more thorough explanation of embodiments of the present invention; however, it is apparent to one skilled in the art that embodiments of the present invention may be practiced without these specific details.

[0052] (I) Construction of DNA tetrahedron-modified liposome probes

[0053] The specific steps for constructing a DNA tetrahedron-modified liposome probe are as follows:

[0054] S1.1 0.2 mmol lecithin and 0.2 mmol cholesterol were dissolved in 20 mL chloroform, and rotary evaporated at 50 °C under vacuum conditions for 20 min to obtain a liposome film. 20 mL PBS buffer was added to the system to dissolve the film, and finally ultrasonic treatment was performed. The power during the ultrasonic process was 200 W, and each ultrasonic treatment was 10 s, with an interval of 10 s, and repeated 15 times to obtain a single-layer liposome with a particle size of 100 nm;

[0055] S1.2 Assembly of DNA tetrahedron and hairpin probe

[0056] S1.2.1 Mix 10 μL of the L1 sequence (concentration of 10 mol / μL) constituting the DNA tetrahedron, 10 μL of the L2 sequence (concentration of 10 mol / μL) constituting the DNA tetrahedron, 10 μL of the L3 sequence (concentration of 10 mol / μL) constituting the DNA tetrahedron, and 10 μL of the L4 sequence (concentration of 10 mol / μL) constituting the DNA tetrahedron, and denature at 95°C for 5 min in a PCR instrument, and then slowly cool to room temperature to obtain DNA tetrahedrons;

[0057] S1.2.2 Mix 10 μL of the third hairpin probe (concentration of 10 mol / μL) and 10 μL of the fourth hairpin probe (concentration of 10 mol / μL), denature at 95°C for 5 min in a PCR instrument, and then slowly cool to room temperature;

[0058] S1.2.3 Mix 10 μL of PDL1 aptamer (concentration of 10 mol / μL), 10 μL of blocking chain (Blocker, concentration of 10 mol / μL), 10 μL of the first hairpin probe (concentration of 10 mol / μL) and 10 μL of the second hairpin probe (concentration of 10 mol / μL), and denature at 95°C for 5 min in a PCR instrument, and then slowly cool to room temperature;

[0059] S1.2.4 Loading the hairpin probe onto the DNA tetrahedron:

[0060] S1.2.4.1. Mix the product obtained in step S1.2.2 with the product obtained in step S1.2.1 and react at room temperature for 1 hour to load the third hairpin probe and the fourth hairpin probe onto the DNA tetrahedron;

[0061] S1.2.4.2 Mix the product obtained in step S1.2.3 and the product obtained in step S1.2.1 and react at room temperature for 1 hour to load the aptamer, the closed strand, the first hairpin probe and the second hairpin probe onto the DNA tetrahedron;

[0062] S1.2.5 Construction of DNA tetrahedron-modified liposome probes:

[0063] The product obtained in step S1.2.4.1 was dissolved together with 0.2 mmol lecithin and 0.2 mmol cholesterol in 20 mL chloroform to obtain cationic liposomes with nucleic acid-priming DNA tetrahedrons modified inside the membrane. Then, 250 μL DNase I (concentration of 1 mg / mL) was used to cut the functional nucleic acid probe on the outside of the liposome membrane. After purification by ultracentrifugation, cationic liposomes with nucleic acid-priming DNA tetrahedrons directed on the inside of the membrane were obtained.

[0064] Add 0.2 mmol cholesterol to the product obtained in S1.2.4.2 and react at room temperature for 30 minutes to modify the cholesterol on the DNA tetrahedron framework. Subsequently, add the cationic liposomes with nucleic acid-activated DNA tetrahedrons modified on the inner side of the membrane and incubate at room temperature for 1 hour to allow the protein-activated DNA tetrahedron to be modified to the outer side of the cationic liposome membrane. After purification by ultracentrifugation, the cationic liposomes with DNA tetrahedron-directed modification are obtained, namely, the DNA tetrahedron-modified liposome probes.

[0065] The obtained DNA tetrahedron-modified liposome probe was subjected to electrophoresis, and the results were as follows: Figure 2 shown.

[0066] Depend on Figure 2 It can be seen that the PAGE experiment verified the successful triggering of the specific CHA reaction by the target miRNA; the PAGE experiment also verified that the specific Triger trigger sequence on the target protein aptamer sequence can indeed successfully initiate the HCR reaction and cause the DNA band to shift backward. This result shows that the PDL1 aptamer, the first hairpin probe (H1), the second hairpin probe (H2) and the closed chain (Blocker) are modified on the outer surface of the DNA tetrahedron and connected to the DNA tetrahedron, and the third hairpin probe (H3) and the fourth hairpin probe (H4) are modified on the inner surface of the DNA tetrahedron and connected to the DNA tetrahedron.

[0067] (II) Sensitivity test

[0068] The sensitivity test of the DNA tetrahedron-modified liposome probe obtained in (a) is carried out, and the specific steps are as follows:

[0069] S2.1 Target source and type: Nucleic acid miR-142 and protein barcode Triger were purchased from Shenzhen BGI Co., Ltd.;

[0070] S2.2 Dilute the target to be tested to 10nM, 1nM, 100pM, 10pM, 1pM, 100fM and 10fM respectively, take 10μL of each diluted sample, and use 10μL PBS buffer as a blank control group;

[0071] S2.3 Prepare the corresponding reaction solutions according to Table 1 and Table 2, and mix 10 μL of the catalytic hairpin assembly (CHA) reaction solution prepared according to Table 1, 10 μL of the hybridization chain reaction (HCR) solution prepared according to Table 2, and 10 μL of the target solution;

[0072] Table 1 Catalytic hairpin assembly (CHA) reaction solution

[0073] Element Sample volume L1 (10 mol / μL) constituting DNA tetrahedron 10μL L2 (10 mol / μL) constituting DNA tetrahedron 10μL L3 (10 mol / μL) constituting DNA tetrahedron 10μL L4 (10 mol / μL) constituting DNA tetrahedron 10μL The first hairpin probe (H3) (10 mol / μL) 10μL Second hairpin probe (H4) (10 mol / μL) 10μL Total volume 60μL

[0074] Table 2 Hybridization chain reaction (HCR) solution

[0075] Element Sample volume L1 (10 mol / μL) constituting DNA tetrahedron 10μL L2 (10 mol / μL) constituting DNA tetrahedron 10μL L3 (10 mol / μL) constituting DNA tetrahedron 10μL L4 (10 mol / μL) constituting DNA tetrahedron 10μL PDL1 aptamer (10 mol / μL) 10μL Blocker (10 mol / μL) 10μL The first hairpin probe (H1) (10 mol / μL) 10μL Second hairpin probe (H2) (10 mol / μL) 10μL Total volume 80μL

[0076] S2.4 Then pre-denature at 95°C for 5 min in a PCR instrument; then stand at 25°C for 30 min, add the reaction system to the EP tube, shake for 3s, centrifuge for 2s, use a pipette to draw all the reaction system and add it to a 96-well flat-bottom fluorescence detection plate, put the detection plate into a fluorescence meter to automatically measure the fluorescence intensity, and then use Prism software to draw a graph to analyze the results. The results are as follows Figure 3 shown.

[0077] Depend on Figure 3 It can be seen that the fluorescence intensity (F) of nucleic acid miR-142 is positively linearly correlated with the logarithm of the target concentration (LogC) in a wide concentration range (10fM-10nM) (3A), and its detection limit (LOD) is calculated according to the linear equation. After calculation, the detection limit (LOD) is 6.61fM; the protein barcode Triger has a positive linear correlation with the logarithm of the target concentration (LogC) in a wide concentration range (10fM-10nM) (3B), and the detection limit (LOD) is calculated according to the linear equation. After calculation, the detection limit (LOD) is 4.43fM. This result shows that the DNA tetrahedron-modified liposome probe of the present application is used to detect nucleic acid miRNA-142 and PDL1 protein with high sensitivity.

[0078] (III) Specificity detection

[0079] The DNA tetrahedron-modified liposome probe obtained in (a) is subjected to specific detection, and the specific steps are as follows:

[0080] S3.1 Target source and type: Nucleic acid miR-142 and protein barcode Triger were purchased from Shenzhen BGI Co., Ltd. Both contain targets with five different sequences: normal target, single-base mutation, double-base mutation, triple-base mutation, and random mutation;

[0081] S3.2 Take 10 μL of each of the two targets to be tested and use 10 μL of PBS buffer as a blank control;

[0082] S3.3 Prepare the corresponding reaction solutions according to Table 1 and Table 2, and mix 10 μL of the catalytic hairpin assembly (CHA) reaction solution prepared according to Table 1, 10 μL of the hybridization chain reaction (HCR) solution prepared according to Table 2, and 10 μL of the target solution;

[0083] 3.4 Then, pre-denature at 95°C for 5 minutes in a PCR instrument; then, let stand at 25°C for 30 minutes, add the reaction system to the EP tube, shake for 3 seconds, centrifuge for 2 seconds, use a pipette to draw all the reaction system and add it to a 96-well flat-bottom fluorescence detection plate, put the detection plate into a fluorescence instrument to automatically measure the fluorescence intensity, and then use Prism software to draw a graph to analyze the results. The results are as follows: Figure 4 As shown, the detection results are divided into two categories according to the fluorescence intensity value: those below 500 are mutant sequence targets, and those above 500 are normal targets. In this way, the five targets are classified.

[0084] Depend on Figure 4It can be seen that the DNA tetrahedron-modified liposome probe of the present application can accurately distinguish normal targets from other mutant sequence targets in both miR-142 and Triger, with a specificity of 100%.

[0085] (IV) Feasibility verification of simultaneous detection of nucleic acids and proteins in circulating extracellular vesicles (cEVs)

[0086] S4.1 Five gastric cancer cell lines, AGS, MKN28, GES-1, A549 and Caski, were cultured (all from the Clinical Medicine Experimental Center of Nanfang Hospital, Southern Medical University), and circulating extracellular vesicles (cEVs) of gastric cancer were extracted using a chip (purchased from Shenzhen Huixin Biomedical Technology Co., Ltd.);

[0087] S4.2 The gastric cancer circulating extracellular vesicles (cEVs) extracted above are detected using the method of the present application, specifically:

[0088] 10 μL of the DNA tetrahedron-modified liposome probe prepared in step (a), 10 μL of the sample to be tested, and 80 μL of PBS buffer were sequentially placed into the EP tube;

[0089] S4.3 Then pre-denature at 95°C for 5 min in a PCR instrument; then stand at 25°C for 30 min, add the reaction system to the EP tube, shake for 3s, centrifuge for 2s, use a pipette to draw all the reaction system and add it to a 96-well flat-bottom fluorescence detection plate, put the detection plate into a fluorescence meter to automatically measure the fluorescence intensity, and then use Prism software to draw a graph to analyze the results. The results are as follows Figure 5 As shown,

[0090] Depend on Figure 5 It can be seen that the system of the present application can detect the fluorescence intensity of nucleic acid miR-142 and PDL1 protein in circulating extracellular vesicles (cEVs) of gastric cancer in five gastric cancer cell lines without fluorescence crosstalk. This result shows that the DNA tetrahedron-modified liposome probe of the present application can achieve the simultaneous detection of nucleic acid miR-142 and PDL1 protein in circulating extracellular vesicles (cEVs).

[0091] As described above, the present application constructed a DNA tetrahedron-modified liposome probe.

[0092] In order to verify the sensitivity of the constructed DNA tetrahedron-modified liposome probe, the present application conducted a sensitivity verification. The results showed that the fluorescence intensity (F) of nucleic acid miR-142 was positively linearly correlated with the logarithmic value (Log C) of the target concentration in a wide concentration range (10fM-10nM) (3A), and the detection limit (LOD) was calculated according to the linear equation, and the detection limit (LOD) was 6.61fM; the protein barcode Triger was positively linearly correlated with the logarithmic value (Log C) of the target concentration in a wide concentration range (10fM-10nM) (3B), and the detection limit (LOD) was calculated according to the linear equation. After calculation, the detection limit (LOD) was 4.43fM. It is suggested that the DNA tetrahedron-modified liposome probe of the present application is used to detect nucleic acid miRNA-142 and PDL1 protein with high sensitivity.

[0093] In order to verify the specificity of the constructed DNA tetrahedron-modified liposome probe, the present application conducted a specificity verification. The results showed that the DNA tetrahedron-modified liposome probe of the present application can accurately distinguish normal targets from other mutant sequence targets in both miR-142 and Triger, with a specificity of 100%. It is suggested that the DNA tetrahedron-modified liposome probe of the present application is highly specific for detecting nucleic acid miRNA-142 and PDL1 protein.

[0094] In order to verify the feasibility of the constructed DNA tetrahedron-modified liposome probe for simultaneous detection of nucleic acids and proteins in circulating extracellular vesicles (cEVs), the present application conducted a feasibility verification. The results showed that the system of the present application can detect the fluorescence intensity of nucleic acid miR-142 and PDL1 protein in circulating extracellular vesicles (cEVs) of gastric cancer in five gastric cancer cell lines without fluorescence crosstalk. It is suggested that the DNA tetrahedron-modified liposome probe of the present application can realize the simultaneous detection of nucleic acid miR-142 and PDL1 protein in circulating extracellular vesicles (cEVs).

[0095] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the technology may modify or change the above embodiments without violating the spirit and scope of the present invention. Therefore, all equivalent modifications or changes made by a person of ordinary skill in the art without departing from the spirit and technical ideas disclosed by the present invention shall still be covered by the claims of the present invention.

Claims

1. A DNA tetrahedron-modified liposome probe, characterized in that: The invention comprises a DNA tetrahedron, an aptamer, a first hairpin probe, a second hairpin probe, a closed chain, a third hairpin probe and a fourth hairpin probe, wherein the nucleotide sequences of the aptamer, the first hairpin probe, the second hairpin probe, the closed chain, the third hairpin probe and the fourth hairpin probe are respectively as shown in SEQ ID NO.1-6, and the DNA tetrahedron is composed of the nucleotide sequences as shown in SEQ ID NO.7-10, and the aptamer, the first hairpin probe, the second hairpin probe and the closed chain are modified on the outer surface of the DNA tetrahedron and connected to the DNA tetrahedron, and the third hairpin probe and the fourth hairpin probe are modified on the inner surface of the DNA tetrahedron and connected to the DNA tetrahedron.

2. The DNA tetrahedron-modified liposome probe according to claim 1, characterized in that: The aptamer, the first hairpin probe and the second hairpin probe specifically bind to and recognize programmed cell death-ligand 1.

3. The DNA tetrahedron-modified liposome probe according to claim 1, characterized in that: The third hairpin probe and the fourth hairpin probe specifically bind to and recognize the nucleic acid miRNA-142.

4. Use of the DNA tetrahedron-modified liposome probe according to any one of claims 1 to 3 in the preparation of a reagent for synchronously detecting proteins and nucleic acids in circulating extracellular vesicles.

5. A reagent for synchronous detection of proteins and nucleic acids in circulating extracellular vesicles, characterized in that: The invention comprises a DNA tetrahedron-modified liposome probe as described in any one of claims 1 to 3.

6. A kit for synchronous detection of proteins and nucleic acids in circulating extracellular vesicles, characterized in that: The invention comprises a DNA tetrahedron-modified liposome probe as described in any one of claims 1 to 3.

7. The kit for synchronous detection of proteins and nucleic acids in circulating extracellular vesicles according to claim 6, characterized in that The molar ratio of the aptamer, the first hairpin probe, the second hairpin probe and the closed chain is 0.5-1.5: 0.5-1.5: 0.5-1.5: 0.5-1.

5.

8. The kit for synchronous detection of proteins and nucleic acids in circulating extracellular vesicles according to claim 6, characterized in that: The molar ratio of the third hairpin probe to the fourth hairpin probe is 0.5-1.5:0.5-1.

5.

9. The kit for synchronous detection of proteins and nucleic acids in circulating extracellular vesicles according to claim 6, characterized in that The molar ratio of the nucleotide sequence shown in SEQ ID NO.7, the nucleotide sequence shown in SEQ ID NO.8, the nucleotide sequence shown in SEQ ID NO.9 and the nucleotide sequence shown in SEQ ID NO.7 is 0.5-1.5: 0.5-1.5: 0.5-1.5: 0.5-1.

5.

10. A method for simultaneous detection of proteins and nucleic acids in circulating extracellular vesicles for the purpose of non-disease diagnosis and / or treatment, characterized in that: The following steps are involved: The concentration of proteins and nucleic acids in circulating extracellular vesicles is determined by amplifying and detecting the template DNA of the sample to be detected using the DNA tetrahedron-modified liposome probe as described in any one of claims 1 to 3 and / or the reagent as described in claim 4 and / or the kit as described in any one of claims 5 to 7.

Images