Application of FLOT1 in preparation of prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer

Abstract

The invention belongs to the technical field of tumor prognosis evaluation, and particularly relates to application of FLOT1 in preparation of a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer. According to the invention, high expression of FLOT1 in a human paclitaxel drug-resistant ovarian cancer cell line is confirmed for the first time. Furthermore, the expression level of the FLOT1 in the ovarian cancer tissue is in positive correlation with the progression-free lifetime of a patient and is in positive correlation with the age of the patient. Therefore, the FLOT1 can be used as a marker of the paclitaxel drug-resistant ovarian cancer and is used for predicting the prognosis of the ovarian cancer, and high expression of the FLOT1 in ovarian cancer tissues is an independent risk factor for evaluating poor prognosis of ovarian cancer patients. Therefore, the application of the FLOT1 in preparing the prognosis evaluation kit for predicting the paclitaxel-resistant ovarian cancer, provided by the invention, can provide a new way for solving the clinical problems of high drug resistance rate and difficulty in prognosis evaluation of the ovarian cancer.

Description

Technical Field

[0001] The invention belongs to the technical field of tumor prognosis evaluation, and in particular, relates to the application of FLOT1 in preparing a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer. Background Art

[0002] Ovarian cancer (OC) ranks fifth among cancer-related deaths in women worldwide. Due to the lack of specific signs and symptoms in the early stages of the disease, OC is usually diagnosed late, and peritoneal and distant metastases are common at the time of diagnosis, so its mortality rate ranks first among gynecological malignancies.

[0003] At present, the standard treatment for ovarian cancer is based on cytoreductive surgery and combined chemotherapy with taxanes and platinum drugs. Although ovarian cancer patients are usually initially sensitive to taxane and platinum chemotherapy, thus achieving effective treatment effects, 70%-80% of patients will still relapse and eventually develop chemotherapy resistance. The median progression-free survival (PFS) of patients with recurrent ovarian cancer is estimated to be only 1-2 years. Therefore, the diagnosis and treatment of ovarian cancer are faced with huge challenges clinically. In particular, paclitaxel is still the standard first-line chemotherapy drug for the treatment of ovarian cancer at this stage. The remission rate of patients in the first treatment is high, but the prognosis is poor due to the inherent high recurrence rate and resistance to chemotherapy drugs of ovarian cancer, which greatly limits the clinical efficacy and application range of chemotherapy, which is also the main reason for the failure of ovarian cancer treatment.

[0004] Lipid rafts are highly conserved microdomains rich in cholesterol and sphingomyelin located on the cell membrane. Flotillin (FLOT), one of the marker proteins of lipid rafts, is widely present in different tissues and cells in the body and is involved in many biological processes, including changes in multiple signaling pathways, cell adhesion, transmembrane transport, and axon growth. The flotillins family includes two homologous members, Flotillin-1 (FLOT1) and Flotillin-2 (FLOT2).

[0005] Human FLOT1 is a major component of lipid rafts. Its coding gene is located in the chromosome 6p21.3 segment. The gene is 15kb in length, contains 13 exons and 12 introns, encodes 427 amino acids, and constitutes a protein with a molecular mass of 48kD. Studies have shown that FLOT1 expression is associated with tumor invasion and metastasis, and up-regulated FLOT1 expression can promote the invasion and metastasis of melanoma and nasopharyngeal carcinoma. However, most existing studies have demonstrated changes in the expression level of FLOT1 in tumor cells or tissues (for example, the invention patent application with application number 201710536540.5 discloses that ovarian cancer can be diagnosed by detecting the expression level of FLOT1), but it has not been proven whether FLOT1 can be used to predict the prognosis of patients with paclitaxel-resistant ovarian cancer, and there are no reports in the prior art on using FLOT1 levels as a predictor of ovarian cancer prognosis. Summary of the invention

[0006] In view of the deficiencies in the prior art, one of the purposes of the present invention is to provide an application of FLOT1 in the preparation of a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer. The present invention confirms for the first time that the prognosis of paclitaxel-resistant ovarian cancer can be predicted by detecting the FLOT1 expression level in human paclitaxel-resistant ovarian cancer patients, suggesting that the reagent for detecting the FLOT1 expression level can be used to prepare a kit for predicting the prognosis of ovarian cancer, thereby providing a new approach to predicting the prognosis of paclitaxel-resistant ovarian cancer.

[0007] The second object of the present invention is to provide a reagent for detecting the expression level of FLOT1 for use in preparing a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer.

[0008] The purpose of the present invention is achieved by adopting the following technical solutions: Application of FLOT1 in the preparation of a prognostic evaluation kit for predicting paclitaxel-resistant ovarian cancer.

[0009] As a preferred solution, the kit is used to detect the protein expression level of FLOT1 or the mRNA expression level of FLOT1 in a biological sample.

[0010] As a further preferred embodiment, the biological sample is a tumor tissue sample or a serum sample from a patient with paclitaxel-resistant ovarian cancer.

[0011] As a preferred solution, the prognostic assessment is an assessment of the prognostic survival of patients with paclitaxel-resistant ovarian cancer.

[0012] Application of a reagent for detecting FLOT1 expression level in the preparation of a prognostic evaluation kit for predicting paclitaxel-resistant ovarian cancer.

[0013] As a preferred solution, the reagent is used to detect the protein expression level of FLOT1 or the mRNA expression level of FLOT1 in a biological sample.

[0014] As a further preferred embodiment, the biological sample is a tumor tissue sample or a serum sample from a patient with paclitaxel-resistant ovarian cancer.

[0015] As a preferred solution, the prognostic assessment is an assessment of the prognostic survival of patients with paclitaxel-resistant ovarian cancer.

[0016] The technical solution of the present invention has the following beneficial effects: The present invention confirms for the first time that FLOT1 is highly expressed in human paclitaxel-resistant ovarian cancer cell lines, so FLOT1 can be used as a marker for paclitaxel-resistant ovarian cancer to predict the prognosis of ovarian cancer. Further, the present invention confirms that the expression of FLOT1 in ovarian cancer tissue is positively correlated with the patient's progression-free survival and is positively correlated with the patient's age, so high expression of FLOT1 in ovarian cancer tissue is an independent risk factor for evaluating the poor prognosis of ovarian cancer patients.

[0017] Therefore, the present invention provides the use of FLOT1 in preparing a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer, and the use of a reagent for detecting FLOT1 expression level in preparing a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer, thereby providing a new approach to solving the clinical problem of high drug resistance rate and difficult prognosis evaluation in ovarian cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 In Experimental Example 1 of the present invention, qRT-PCR was used to verify the expression level of FLOT1 in two paclitaxel (PTX)-resistant human ovarian cancer cell lines (OV3R-PTX and A2780-PTX); Figure 2 In Experimental Example 2 of the present invention, Western blot was used to verify the expression level of FLOT1 in two paclitaxel (PTX)-resistant human ovarian cancer cell lines (OV3R-PTX and A2780-PTX); Figure 3 In Experimental Example 3 of the present invention, the difference in overall survival (OS) between the FLOT1 high expression group and the low expression group in the ovarian cancer clinical data set was compared by Kaplan-Meier Plotter; Figure 4 In Experimental Example 3 of the present invention, the difference in progression-free survival (PFS) between the FLOT1 high expression group and the low expression group in the ovarian cancer clinical data set was compared by Kaplan-Meier Plotter; Figure 5 In Experimental Example 3 of the present invention, the correlation between FLOT1 expression and the age of ovarian cancer patients was analyzed based on the CPTAC-OV dataset of the UALCAN database. DETAILED DESCRIPTION

[0019] The technical scheme and technical effects of the present invention are further described below in conjunction with specific embodiments and accompanying drawings. The following description is only used to explain the present invention and should not be construed as limiting the scope of protection of the present invention. In the following examples, unless otherwise specified, the methods used are conventional methods in the art. The reagents and biological materials used in the following examples, unless otherwise specified, are conventional reagents or materials that can be obtained from commercial channels in the art. Example

[0020] This embodiment provides the use of FLOT1 in the preparation of a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer. The kit is used to detect the protein expression level of FLOT1 or the mRNA expression level of FLOT1 in a biological sample. The prognosis evaluation is an evaluation of the prognosis and survival of patients with paclitaxel-resistant ovarian cancer. Example

[0021] This embodiment provides the use of a reagent for detecting the expression level of FLOT1 in the preparation of a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer. The reagent is used to detect the protein expression level of FLOT1 or the mRNA expression level of FLOT1 in a biological sample. The prognosis evaluation is an evaluation of the prognosis and survival of patients with paclitaxel-resistant ovarian cancer.

[0022] Experimental Example 1: Real-time fluorescence quantitative PCR (qRT-PCR) to detect the expression level of FLOT1 in ovarian cancer cells This experiment used real-time fluorescence quantitative PCR (qRT-PCR) to detect the expression level of FLOT1 in ovarian cancer cells. The experimental method is as follows: 1.1. Extraction of total cellular RNA (1) Prepare the consumables required for the experiment: enzyme-free pipette tips, enzyme-free EP tubes, RNA experiment-specific pipettes, and RNA rapid extraction kit (from Yishan Biotechnology); (2) OVCAR-3 cells (human ovarian cancer cells), OV3R-PTX cells (paclitaxel-resistant human ovarian cancer cells), A2780 cells (human ovarian cancer cells), and A2780-PTX cells (paclitaxel-resistant human ovarian cancer cells) were plated into six-well plates. When the cell density reached 80%, the waste culture medium in the six-well plates was discarded, and PBS was added to wash three times to remove all liquid. (3) Add 500 μL of lysis buffer to each well. After lysis for 5 min, transfer the cell lysate to an enzyme-free EP tube by pipetting. Vortex for 10 seconds. (4) Add an equal volume of anhydrous ethanol, mix thoroughly, transfer to the adsorption column, and centrifuge at 12000g for 1 min at room temperature; (5) Pour out the liquid in the collection tube, turn the tube upside down on a paper towel to absorb the remaining liquid, then add 500 μL of wash buffer to the adsorption column and centrifuge at 12000g for 1 min at room temperature; (6) Use a pipette tip to suck out the waste liquid in the collection tube, and then centrifuge at room temperature (12000g, 1 min) to remove the residual reagents in the adsorption column to avoid affecting the dissolution of RNA; (7) Place the adsorption column into a new enzyme-free EP tube and leave it to dry for 2 minutes with the lid open; (8) Add 20-30 μL of elution buffer to the center of the column membrane and centrifuge at 12,000 g for 1 min at 4°C. (9) Place the eluted RNA on ice and use NanoDrop software to detect the RNA concentration in a micro-nucleic acid quantifier for subsequent experiments or store it in a -80°C refrigerator.

[0023] 1.2 RNA Reverse Transcription (1) Place the RNA sample and reverse transcription reagent obtained in step 1.1 on ice; (2) Take an enzyme-free eight-tube strip and add (taking a total volume of 10 μL as an example): 2 μL 5×M5 RT Super Mix, μL required for 500 ng RNA calculated based on the corresponding template RNA concentration, and the remaining volume is DEPC water; (3) After low-speed instant centrifugation, place the sample in a common PCR instrument for reverse transcription reaction; (4) After obtaining the reverse transcription product cDNA, add an appropriate volume of DEPC water to dilute it for subsequent experiments or store it in a -20℃ refrigerator.

[0024] 1.3 qRT-PCR (1) Take out the cDNA samples and gene primers required for the experiment obtained in step 1.2 (see Table 1), and place the qRT-PCR reagents on ice; Table 1. PCR primer sequence list Primers Sequence (5'-3') FLOT1-F ATTGCCCAGGTAAAAATCCAGG FLOT1-R CCAAAGAGTGCAAATAGTCCTG Actin-F TCATCACCATTGGCAATGAG Actin-R CACTGTGTTGGCGTACAGGT (2) qRT-PCR reaction system is shown in Table 2; Table 2. qRT-PCR reaction system Reagents Volume (µL) DEPC water 5.1 BeyoFastTMSYBR Green qRT-PCR Mix (2x) 7.5 Forward primer 0.45 Reverse primer 0.45 cDNA 1.5 (3) On-line testing: set up the reaction program according to the qRT-PCR reaction reagents: denaturation at 95°C for 1 min; annealing at 95°C for 10 sec; extension at 60°C for 30 sec (40 cycles); and finally draw the melting curve. (4) Data processing: According to the obtained Ct result value, use 2- ΔΔThe Ct method was used to quantitatively analyze the expression of the target gene.

[0025] Figure 1 To verify the expression level of FLOT1 in two paclitaxel (PTX)-resistant cell lines (OV3R-PTX and A2780-PTX) by qRT-PCR. Figure 1 It can be seen that compared with the paclitaxel-sensitive ovarian cancer parental cell lines (OVCAR-3 and A2780), FLOT1 is highly expressed in human paclitaxel-resistant ovarian cancer cell lines (OV3R-PTX and A2780-PTX) at the mRNA level.

[0026] Experimental Example 2: Western blot to detect the expression level of FLOT1 This experiment used Western blot to verify the expression level of FLOT1 in two paclitaxel-resistant ovarian cancer cell lines (OV3R-PTX and A2780-PTX). The experimental method is as follows: 2.1. Total cell protein extraction and protein concentration determination (1) Prepare the necessary equipment for the experiment: ice, EP tubes, ordinary PBS buffer, cell scraper, SDS cell lysis buffer, PMSF protease inhibitor, PI phosphatase inhibitor, BCA protein assay kit, SDS protein loading buffer; (2) OVCAR-3, OV3R-PTX, A2780, and A2780-PTX cells were plated into six-well plates respectively. When the cell density reached 80%, the six-well plates were placed on ice, the spent culture medium was discarded, and the plates were washed three times with PBS to remove all liquid. (3) Prepare cell lysis buffer at a ratio of SDS: PMSF: PI = 100:1:1 and add to the wells. Shake well and place on ice for 30 min to fully lyse the cells. (4) Use a cell scraper to scrape the cell lysate in the well plate (note that the operation should be done on ice), then transfer it to a pre-cooled 1.5 mL EP tube, use an ultrasonic disruptor on ice to break up the cell structure to fully release the protein, and centrifuge at 12,000 g and 4°C for 30 min. (5) According to the instructions for the BCA protein assay, take the corresponding volume of protein supernatant for protein concentration determination; (6) Take the corresponding volume of the remaining supernatant according to the experimental needs and transfer it to a new 1.5 mL EP tube pre-cooled at 4°C. Add 4× loading buffer to the supernatant to dilute it to its working concentration, pipette to mix, place it in a 100°C metal bath, and shake and heat for 10 min. After the extraction, place the extracted protein on ice for subsequent experiments or store it in a -80°C refrigerator.

[0027] 2.2 Western blot experiment 2.2.1. Glue making (1) Prepare the necessary equipment: clean and dry tooth comb, thin / thick glass plate, gel preparation rack, and gel preparation kit; (2) Fix the glass plate on the glue making rack and prepare the required volumes of upper and lower glue solutions according to the instructions; (3) Slowly and evenly inject the glue into the glass plate in the order of lower layer to upper layer, and quickly insert the tooth comb; (4) Wait for about 30 minutes until the gel has solidified and then use it for electrophoresis or store it in a 4°C refrigerator.

[0028] 2.2.2 Protein electrophoresis (1) Prepare 1 L of fresh electrophoresis buffer: 100 mL of 10× Stock solution (30.3 g Tris and 14.4 g glycine to 1 L), 10 mL of 10% SDS solution, and 890 mL of double distilled water; (2) Place the prepared gel assembly into the electrophoresis device and add an appropriate amount of electrophoresis solution to the inner and outer tanks; (3) According to the experimental arrangement, quantitatively load the protein extracted in 2.1 and add protein marker to the corresponding blank wells; (4) Run the electrophoresis at a constant voltage of 80 V until the protein marker runs into the separation gel (approximately 30 minutes), then switch to a constant voltage of 120 V and continue the electrophoresis. Note that the electrophoresis can be stopped when the bromophenol blue reaches the appropriate level.

[0029] 2.2.3. Transfer (wet transfer method) (1) Prepare 1 L of transfer buffer: 100 mL 10× Stock solution, 200 mL methanol, and 700 mL double distilled water; (2) Prepare transfer clips, ice, ice box, filter paper, cut a 0.45 μm / 0.2 μm PVDF membrane of appropriate size and pour an appropriate amount of methanol to activate it; (3) Place the wet filter paper and activated PVDF membrane on the transfer clamp, gently peel off the glass plate, cut the glue block, transfer it to the PVDF membrane, place it in the order of black glue and white membrane, clamp it and place it in the transfer device; (4) Constant current 250mA, transfer time 90min.

[0030] 2.2.4. Closure (1) Prepare 500 mL of TBST solution: 25 mL 20× TBS, 500 μL Tween-20, and 475 mL double distilled water; (2) Prepare 50 mL of WB blocking solution (5% skim milk powder blocking solution): 2.5 g skim milk powder is diluted with 50 mL of TBST solution; (3) After the transfer is completed, open the sandwich clamp and gently transfer the PVDF membrane to the sealing box (pay attention to the front and back of the membrane), place it on a horizontal shaker, and seal it at room temperature for 1 hour.

[0031] 2.2.5 Antibody incubation and exposure development (1) Pipette the corresponding volume of antibody into the WB primary antibody diluent according to the recommended concentration in the antibody manual, and fully immerse the blocked PVDF membrane in the prepared primary antibody solution at 4°C overnight; (2) Recover the primary antibody solution, store at -20°C, and wash the membrane with TBST for 0 min × 3 times; (3) Prepare a secondary antibody solution of appropriate concentration (1:5000-1:10000) with 5% skim milk powder blocking solution, cover and soak PVDF and incubate on a horizontal shaker at room temperature for 1 hour; (4) Recover the secondary antibody solution, store at -20°C, and wash the membrane with TBST for 10 min × 3 times; (5) Prepare ECL chemiluminescent solution according to the instructions with a volume ratio of 1:1 for solution A and solution B, evenly drip it on the PVDF membrane and place it in the developer. Set appropriate exposure parameters and develop it. After completion, save the photos and perform statistical analysis. The results of Western blot verification of FLOT1 expression levels in two drug-resistant cell lines (OV3R-PTX and A2780-PTX) are shown in the figure. Figure 2 shown.

[0032] Depend on Figure 2 It can be seen that compared with the paclitaxel-sensitive ovarian cancer parental cell lines (OVCAR-3 and A2780), FLOT1 is highly expressed in human paclitaxel-resistant ovarian cancer cell lines (OV3R-PTX and A2780-PTX) at the protein level.

[0033] Experimental Example 3: Clinical Characteristics and Prognostic Analysis of FLOT1 in Ovarian Cancer 3.2 Prognostic analysis The CPTAC (Clinical Proteomic Tumor Analysis Consortium) protein database contains gene protein expression profile data and clinical information of tumor patients. Enter from the Kaplan-Meier plotter database official website (http: / / kmplot.com / analysis / ), refer to the database official website instructions, select the ovarian cancer analysis module, enter FLOT1, set the required analysis conditions to perform prognostic survival analysis. Also enter the CPTAC database online analysis module from the UALCAN database online website (http: / / ualcan.path.uab.edu / ), enter FLOT1 and the Ovarian cancer option to analyze the protein expression level of the FLOT1 gene in ovarian cancer and its relationship with the patient age distribution.

[0034] Figure 3 To compare the overall survival (OS) results between the high and low expression groups of FLOT1 in the ovarian cancer clinical data set using Kaplan-Meier Plotter; Figure 4 To compare the difference in progression-free survival (PFS) between the high and low expression groups of FLOT1 in the ovarian cancer clinical data set using Kaplan-Meier Plotter; Figure 5 The results of the analysis of the correlation between FLOT1 expression and the age of OC patients based on the CPTAC-OV dataset of the UALCAN database. OS: overall survival; PFS: progression-free survival; DFS: disease-free survival; *** P <0.001.

[0035] Depend on Figure 3~Figure 5 The results showed that the high expression of FLOT1 in ovarian cancer tissue was positively correlated with the patient's progression-free survival and the patient's age. Therefore, it was confirmed that the high expression of FLOT1 in ovarian cancer tissue was an independent risk factor for evaluating the poor prognosis of ovarian cancer patients.

[0036] In summary, the present invention confirms that FLOT1 is highly expressed in human paclitaxel-resistant ovarian cancer cell lines, so FLOT1 can be used as a marker for paclitaxel-resistant ovarian cancer and used to predict the prognosis of ovarian cancer. Further, the present invention confirms that the expression of FLOT1 in ovarian cancer tissue is positively correlated with the patient's progression-free survival period and is positively correlated with the patient's age, so the high expression of FLOT1 in ovarian cancer tissue is an independent risk factor for evaluating the poor prognosis of ovarian cancer patients. Therefore, the present invention provides the use of FLOT1 in the preparation of a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer, and the use of a reagent for detecting the expression level of FLOT1 in the preparation of a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer, which can provide a new way to solve the clinical problem of high drug resistance and difficult prognosis evaluation in ovarian cancer.

[0037] The above is only a preferred embodiment of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the method of the present invention. These improvements and supplements should also be regarded as the scope of protection of the present invention.

Claims

1. Application of FLOT1 in the preparation of a prognostic evaluation kit for predicting paclitaxel-resistant ovarian cancer.

2. The use of FLOT1 according to claim 1 in preparing a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer, characterized in that: The kit is used for detecting the protein expression level of FLOT1 or the mRNA expression level of FLOT1 in a biological sample.

3. The use of FLOT1 according to claim 2 in preparing a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer, characterized in that: The biological sample is a tumor tissue sample or a serum sample from a patient with paclitaxel-resistant ovarian cancer.

4. The use of FLOT1 according to claim 1 in preparing a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer, characterized in that: The prognostic evaluation is an evaluation of the prognostic survival of patients with paclitaxel-resistant ovarian cancer.

5. Application of reagents for detecting FLOT1 expression levels in the preparation of a prognostic evaluation kit for predicting paclitaxel-resistant ovarian cancer.

6. Use of the reagent for detecting FLOT1 expression level according to claim 5 in preparing a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer, characterized in that: The reagent is used for detecting the protein expression level of FLOT1 or the mRNA expression level of FLOT1 in a biological sample.

7. Use of the reagent for detecting FLOT1 expression level according to claim 6 in preparing a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer, characterized in that: The biological sample is a tumor tissue sample or a serum sample from a patient with paclitaxel-resistant ovarian cancer.

8. Use of the reagent for detecting FLOT1 expression level according to claim 5 in preparing a prognosis evaluation kit for predicting paclitaxel-resistant ovarian cancer, characterized in that: The prognostic evaluation is an evaluation of the prognostic survival of patients with paclitaxel-resistant ovarian cancer.

Images